Starting /dee2/code/volunteer_pipeline.sh SRR7804124 current disk space = 1525402865664 free memory = 1562116004 SRR7804124 SRAfilesize a99a6f737abfc763409bd422835abc79 SRR7804124.sra SRR7804124.sra file validated SRR7804124 is paired end SRR7804124 is conventional basespace SRR7804124 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804124_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.237 37.0 37.0 37.0 37.0 37.0 2 36.2825 37.0 37.0 37.0 37.0 37.0 3 36.315 37.0 37.0 37.0 37.0 37.0 4 36.331 37.0 37.0 37.0 37.0 37.0 5 36.4995 37.0 37.0 37.0 37.0 37.0 6 36.5055 37.0 37.0 37.0 37.0 37.0 7 36.443 37.0 37.0 37.0 37.0 37.0 8 36.425 37.0 37.0 37.0 37.0 37.0 9 36.469 37.0 37.0 37.0 37.0 37.0 10-14 36.51809999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.523199999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.458999999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.4653 37.0 37.0 37.0 37.0 37.0 30-34 36.427800000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.401799999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.4178 37.0 37.0 37.0 37.0 37.0 45-49 36.3606 37.0 37.0 37.0 37.0 37.0 50-54 36.3923 37.0 37.0 37.0 37.0 37.0 55-59 36.3337 37.0 37.0 37.0 37.0 37.0 60-64 36.326 37.0 37.0 37.0 37.0 37.0 65-69 36.2945 37.0 37.0 37.0 37.0 37.0 70-74 36.256400000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.2568 37.0 37.0 37.0 37.0 37.0 80-84 36.199 37.0 37.0 37.0 37.0 37.0 85-89 36.1806 37.0 37.0 37.0 37.0 37.0 90-94 36.137899999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.1031 37.0 37.0 37.0 37.0 37.0 100-104 36.1209 37.0 37.0 37.0 37.0 37.0 105-109 36.0296 37.0 37.0 37.0 37.0 37.0 110-114 36.0228 37.0 37.0 37.0 37.0 37.0 115-119 36.02929999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.9426 37.0 37.0 37.0 37.0 37.0 125-129 35.902499999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.9148 37.0 37.0 37.0 37.0 37.0 135-139 35.7837 37.0 37.0 37.0 37.0 37.0 140-144 35.793099999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.7625 37.0 37.0 37.0 37.0 37.0 150-151 35.226 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 2.0 26 5.0 27 5.0 28 18.0 29 27.0 30 27.0 31 41.0 32 56.0 33 89.0 34 135.0 35 346.0 36 2828.0 37 418.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.199999999999996 13.625000000000002 8.924999999999999 30.25 2 26.974999999999998 14.224999999999998 30.15 28.65 3 22.95 20.325 25.174999999999997 31.55 4 26.400000000000002 25.525 22.0 26.075 5 27.675 27.250000000000004 22.2 22.875 6 25.35 29.75 20.95 23.95 7 19.775000000000002 23.425 35.25 21.55 8 21.675 22.55 25.775 30.0 9 22.375 20.625 30.975 26.025 10-14 24.385 24.72 24.0 26.895000000000003 15-19 24.9 24.224999999999998 24.310000000000002 26.565 20-24 24.529999999999998 24.735 24.104999999999997 26.63 25-29 24.805 23.96 24.33 26.905 30-34 24.875 24.16 23.974999999999998 26.99 35-39 25.419999999999998 23.75 23.465 27.365000000000002 40-44 25.019999999999996 23.61 24.560000000000002 26.810000000000002 45-49 24.86 24.16 23.77 27.21 50-54 24.915000000000003 23.52 24.560000000000002 27.005000000000003 55-59 24.41 23.875 24.395 27.32 60-64 25.515 23.330000000000002 24.4 26.755000000000003 65-69 25.319999999999997 23.474999999999998 23.419999999999998 27.785 70-74 25.230000000000004 23.400000000000002 24.215 27.155 75-79 25.1 23.07 24.235 27.595 80-84 25.424999999999997 23.515 24.12 26.939999999999998 85-89 25.82 22.935 23.745 27.500000000000004 90-94 25.705 23.990000000000002 23.445 26.86 95-99 24.905 23.29 24.525 27.279999999999998 100-104 25.82 23.125 23.77 27.284999999999997 105-109 25.430000000000003 23.135 24.165 27.27 110-114 26.235000000000003 22.900000000000002 24.025 26.840000000000003 115-119 26.375 23.275000000000002 23.335 27.015 120-124 26.064999999999998 23.044999999999998 23.68 27.21 125-129 25.619999999999997 23.075000000000003 24.09 27.215 130-134 25.814999999999998 23.305 23.59 27.29 135-139 25.729999999999997 22.99 23.74 27.54 140-144 26.0 22.650000000000002 23.555 27.794999999999998 145-149 26.625 23.125 23.505000000000003 26.745 150-151 26.8 23.6125 22.875 26.7125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 1.0 28 1.5 29 3.5 30 6.0 31 9.0 32 15.0 33 16.0 34 21.0 35 27.0 36 26.0 37 41.0 38 69.5 39 83.5 40 95.0 41 110.5 42 122.0 43 133.0 44 154.5 45 177.0 46 181.5 47 171.0 48 166.5 49 161.0 50 144.5 51 136.0 52 132.5 53 119.0 54 103.5 55 100.5 56 89.5 57 89.5 58 91.5 59 87.5 60 91.0 61 89.5 62 81.0 63 89.0 64 91.5 65 70.5 66 67.5 67 74.5 68 77.0 69 69.5 70 63.5 71 53.5 72 41.0 73 29.5 74 22.5 75 22.5 76 21.5 77 21.0 78 13.0 79 8.0 80 5.5 81 4.5 82 2.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.95 #Duplication Level Percentage of deduplicated Percentage of total 1 93.11457772996235 86.55000000000001 2 6.1861215707369555 11.5 3 0.6993006993006993 1.95 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.6375 0.0 0.0 0.0 0.0 120-121 0.75 0.0 0.0 0.0 0.0 122-123 0.875 0.0 0.0 0.0 0.0 124-125 0.9375 0.0 0.0 0.0 0.0 126-127 1.025 0.0 0.0 0.0 0.0 128-129 1.175 0.0 0.0 0.0 0.0 130-131 1.2875 0.0 0.0 0.0 0.0 132-133 1.4125 0.0 0.0 0.0 0.0 134-135 1.5625 0.0 0.0 0.0 0.0 136-137 1.6749999999999998 0.0 0.0 0.0 0.0 138-139 1.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTCTT 10 0.006830828 145.0 4 GCATTCT 10 0.006830828 145.0 3 >>END_MODULE SRR7804124 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804124_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.02375 37.0 37.0 37.0 37.0 37.0 2 35.887 37.0 37.0 37.0 37.0 37.0 3 35.632 37.0 37.0 37.0 37.0 37.0 4 35.977 37.0 37.0 37.0 37.0 37.0 5 36.0325 37.0 37.0 37.0 37.0 37.0 6 35.877 37.0 37.0 37.0 37.0 37.0 7 35.6985 37.0 37.0 37.0 37.0 37.0 8 35.935 37.0 37.0 37.0 37.0 37.0 9 35.7685 37.0 37.0 37.0 37.0 37.0 10-14 35.8886 37.0 37.0 37.0 37.0 37.0 15-19 35.782799999999995 37.0 37.0 37.0 37.0 37.0 20-24 35.8055 37.0 37.0 37.0 37.0 37.0 25-29 35.7174 37.0 37.0 37.0 37.0 37.0 30-34 35.690000000000005 37.0 37.0 37.0 37.0 37.0 35-39 35.6259 37.0 37.0 37.0 37.0 37.0 40-44 35.5714 37.0 37.0 37.0 37.0 37.0 45-49 35.5526 37.0 37.0 37.0 37.0 37.0 50-54 35.5124 37.0 37.0 37.0 37.0 37.0 55-59 35.452999999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.4202 37.0 37.0 37.0 37.0 37.0 65-69 35.3918 37.0 37.0 37.0 37.0 37.0 70-74 35.396499999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.3292 37.0 37.0 37.0 37.0 37.0 80-84 35.329 37.0 37.0 37.0 37.0 37.0 85-89 35.3624 37.0 37.0 37.0 37.0 37.0 90-94 35.3077 37.0 37.0 37.0 37.0 37.0 95-99 35.2578 37.0 37.0 37.0 34.6 37.0 100-104 35.167899999999996 37.0 37.0 37.0 32.2 37.0 105-109 35.1155 37.0 37.0 37.0 29.8 37.0 110-114 35.0177 37.0 37.0 37.0 27.4 37.0 115-119 35.0193 37.0 37.0 37.0 27.4 37.0 120-124 35.003699999999995 37.0 37.0 37.0 25.0 37.0 125-129 34.8853 37.0 37.0 37.0 25.0 37.0 130-134 34.9468 37.0 37.0 37.0 25.0 37.0 135-139 34.8272 37.0 37.0 37.0 25.0 37.0 140-144 34.7717 37.0 37.0 37.0 25.0 37.0 145-149 34.517199999999995 37.0 37.0 37.0 25.0 37.0 150-151 34.0895 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 4.0 13 8.0 14 11.0 15 9.0 16 10.0 17 4.0 18 6.0 19 4.0 20 8.0 21 4.0 22 16.0 23 17.0 24 12.0 25 12.0 26 11.0 27 19.0 28 19.0 29 20.0 30 48.0 31 36.0 32 68.0 33 135.0 34 241.0 35 694.0 36 2424.0 37 160.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.18579644911228 18.30457614403601 10.302575643910977 28.207051762940733 2 30.225 22.75 23.875 23.150000000000002 3 26.474999999999998 23.925 26.474999999999998 23.125 4 27.35 31.125000000000004 17.375 24.15 5 28.9 31.724999999999998 16.725 22.650000000000002 6 26.674999999999997 31.674999999999997 17.875 23.775 7 26.275 17.275 29.225 27.224999999999998 8 24.7 22.2 21.25 31.85 9 25.174999999999997 21.224999999999998 23.674999999999997 29.925 10-14 28.060000000000002 24.51 20.34 27.089999999999996 15-19 26.945000000000004 24.525 21.605 26.924999999999997 20-24 27.395000000000003 24.165 21.335 27.105 25-29 26.995 23.845 21.645 27.515 30-34 27.11 24.474999999999998 21.605 26.810000000000002 35-39 27.384999999999998 24.224999999999998 21.59 26.8 40-44 28.175 24.12 21.759999999999998 25.945 45-49 27.63 24.13 21.240000000000002 27.0 50-54 28.395 23.66 21.83 26.115 55-59 28.315 24.435000000000002 20.855 26.395000000000003 60-64 28.139999999999997 23.44 21.425 26.995 65-69 27.85 23.72 21.87 26.56 70-74 28.37 23.715 21.475 26.44 75-79 27.894999999999996 23.505000000000003 21.475 27.125 80-84 27.58 24.12 21.735 26.565 85-89 28.694999999999997 22.835 21.955 26.515 90-94 27.584999999999997 23.674999999999997 21.72 27.02 95-99 27.665 23.799999999999997 21.925 26.61 100-104 27.395000000000003 24.27 22.105 26.229999999999997 105-109 28.63 23.005 21.785 26.58 110-114 27.894999999999996 24.305 21.535 26.265 115-119 28.005000000000003 24.09 21.69 26.215 120-124 27.99 24.075 21.485000000000003 26.450000000000003 125-129 28.599999999999998 24.135 21.825 25.44 130-134 27.91 24.085 22.259999999999998 25.745 135-139 28.18 24.635 21.87 25.314999999999998 140-144 28.82 23.830000000000002 21.505 25.845000000000002 145-149 28.084999999999997 24.39 22.31 25.215 150-151 28.9375 23.45 21.6125 26.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 1.5 11 1.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 2.5 24 3.5 25 2.5 26 1.5 27 2.5 28 2.5 29 4.5 30 7.0 31 7.5 32 6.0 33 5.0 34 11.0 35 18.0 36 24.5 37 35.5 38 49.5 39 54.0 40 68.0 41 87.0 42 97.5 43 119.5 44 134.5 45 149.5 46 148.0 47 142.5 48 137.5 49 120.5 50 117.5 51 117.5 52 120.5 53 127.0 54 130.5 55 110.5 56 99.0 57 106.0 58 100.5 59 100.0 60 109.0 61 102.5 62 103.0 63 112.0 64 92.5 65 85.5 66 92.5 67 85.0 68 93.5 69 95.5 70 75.5 71 70.5 72 65.0 73 48.5 74 37.0 75 31.0 76 22.0 77 18.0 78 17.0 79 10.5 80 6.5 81 5.0 82 3.0 83 1.5 84 1.0 85 0.5 86 1.5 87 1.0 88 0.5 89 1.0 90 1.0 91 0.5 92 0.0 93 1.0 94 2.5 95 3.0 96 3.5 97 2.0 98 1.0 99 1.0 100 8.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.5 #Duplication Level Percentage of deduplicated Percentage of total 1 93.24324324324324 86.25 2 5.972972972972973 11.05 3 0.7027027027027027 1.95 4 0.02702702702702703 0.1 5 0.02702702702702703 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02702702702702703 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 21 0.525 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.42500000000000004 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.5874999999999999 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.75 0.0 0.0 0.0 0.0 122-123 0.875 0.0 0.0 0.0 0.0 124-125 0.9375 0.0 0.0 0.0 0.0 126-127 1.025 0.0 0.0 0.0 0.0 128-129 1.1875 0.0 0.0 0.0 0.0 130-131 1.3125 0.0 0.0 0.0 0.0 132-133 1.4375 0.0 0.0 0.0 0.0 134-135 1.5875 0.0 0.0 0.0 0.0 136-137 1.7000000000000002 0.0 0.0 0.0 0.0 138-139 1.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1127024 spots for SRR7804124.sra Written 1127024 spots for SRR7804124.sra Read 1127024 spots for SRR7804124.sra Written 1127024 spots for SRR7804124.sra Read 1127024 spots for SRR7804124.sra Written 1127024 spots for SRR7804124.sra Read 1127024 spots for SRR7804124.sra Written 1127024 spots for SRR7804124.sra Read 1127024 spots for SRR7804124.sra Written 1127024 spots for SRR7804124.sra Read 1127024 spots for SRR7804124.sra Written 1127024 spots for SRR7804124.sra Read 1127035 spots for SRR7804124.sra Written 1127035 spots for SRR7804124.sra Read 1127024 spots for SRR7804124.sra Written 1127024 spots for SRR7804124.sra Read 1127024 spots for SRR7804124.sra Written 1127024 spots for SRR7804124.sra Read 1127024 spots for SRR7804124.sra Written 1127024 spots for SRR7804124.sra Read 1127024 spots for SRR7804124.sra Written 1127024 spots for SRR7804124.sra Read 1127024 spots for SRR7804124.sra Written 1127024 spots for SRR7804124.sra Read 1127024 spots for SRR7804124.sra Written 1127024 spots for SRR7804124.sra Read 1127024 spots for SRR7804124.sra Written 1127024 spots for SRR7804124.sra Read 1127024 spots for SRR7804124.sra Written 1127024 spots for SRR7804124.sra Read 1127024 spots for SRR7804124.sra Written 1127024 spots for SRR7804124.sra Read 1127024 spots for SRR7804124.sra Written 1127024 spots for SRR7804124.sra Read 1127024 spots for SRR7804124.sra Written 1127024 spots for SRR7804124.sra Read 1127024 spots for SRR7804124.sra Written 1127024 spots for SRR7804124.sra Read 1127024 spots for SRR7804124.sra Written 1127024 spots for SRR7804124.sra SRR ids: ['SRR7804124.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6wnwesga SRR7804124.sra spots: 22540491 blocks: [[1, 1127024], [1127025, 2254048], [2254049, 3381072], [3381073, 4508096], [4508097, 5635120], [5635121, 6762144], [6762145, 7889168], [7889169, 9016192], [9016193, 10143216], [10143217, 11270240], [11270241, 12397264], [12397265, 13524288], [13524289, 14651312], [14651313, 15778336], [15778337, 16905360], [16905361, 18032384], [18032385, 19159408], [19159409, 20286432], [20286433, 21413456], [21413457, 22540491]] SRR7804124 file size 7616532 SRR7804124 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804124 SRR7804124_1.fastq SRR7804124_2.fastq Input file: SRR7804124_1.fastq Paired file: SRR7804124_2.fastq trimmed: SRR7804124-trimmed-pair1.fastq, SRR7804124-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:11:55 2024 >> started Tue Dec 10 02:12:27 2024 >> done (32.655s) 22540491 read pairs processed; of these: 93 ( 0.00%) short read pairs filtered out after trimming by size control 760 ( 0.00%) empty read pairs filtered out after trimming by size control 22539638 (100.00%) read pairs available; of these: 736874 ( 3.27%) trimmed read pairs available after processing 21802764 (96.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 14 0.00% 20 9 0.00% 21 14 0.00% 22 21 0.00% 23 14 0.00% 24 17 0.00% 25 17 0.00% 26 19 0.00% 27 16 0.00% 28 15 0.00% 29 20 0.00% 30 23 0.00% 31 23 0.00% 32 39 0.00% 33 34 0.00% 34 27 0.00% 35 35 0.00% 36 22 0.00% 37 19 0.00% 38 31 0.00% 39 31 0.00% 40 37 0.00% 41 38 0.00% 42 27 0.00% 43 29 0.00% 44 35 0.00% 45 41 0.00% 46 48 0.00% 47 35 0.00% 48 38 0.00% 49 36 0.00% 50 36 0.00% 51 45 0.00% 52 43 0.00% 53 44 0.00% 54 50 0.00% 55 45 0.00% 56 50 0.00% 57 55 0.00% 58 57 0.00% 59 56 0.00% 60 70 0.00% 61 66 0.00% 62 66 0.00% 63 85 0.00% 64 66 0.00% 65 75 0.00% 66 88 0.00% 67 102 0.00% 68 82 0.00% 69 105 0.00% 70 121 0.00% 71 140 0.00% 72 121 0.00% 73 153 0.00% 74 146 0.00% 75 181 0.00% 76 180 0.00% 77 199 0.00% 78 226 0.00% 79 236 0.00% 80 260 0.00% 81 294 0.00% 82 383 0.00% 83 444 0.00% 84 483 0.00% 85 499 0.00% 86 598 0.00% 87 580 0.00% 88 699 0.00% 89 785 0.00% 90 911 0.00% 91 937 0.00% 92 1098 0.00% 93 1241 0.01% 94 1318 0.01% 95 1573 0.01% 96 1656 0.01% 97 1854 0.01% 98 1875 0.01% 99 2024 0.01% 100 2254 0.01% 101 2618 0.01% 102 2768 0.01% 103 2876 0.01% 104 3428 0.02% 105 3476 0.02% 106 3876 0.02% 107 3966 0.02% 108 4180 0.02% 109 4542 0.02% 110 4720 0.02% 111 5143 0.02% 112 5618 0.02% 113 6351 0.03% 114 6651 0.03% 115 7059 0.03% 116 7497 0.03% 117 7848 0.03% 118 8174 0.04% 119 8434 0.04% 120 8777 0.04% 121 9388 0.04% 122 10312 0.05% 123 10784 0.05% 124 11644 0.05% 125 12241 0.05% 126 12818 0.06% 127 13295 0.06% 128 13488 0.06% 129 14351 0.06% 130 14643 0.06% 131 15379 0.07% 132 16561 0.07% 133 17545 0.08% 134 18583 0.08% 135 19527 0.09% 136 20608 0.09% 137 20648 0.09% 138 21155 0.09% 139 21917 0.10% 140 22848 0.10% 141 23425 0.10% 142 24784 0.11% 143 25411 0.11% 144 26995 0.12% 145 28461 0.13% 146 29498 0.13% 147 30782 0.14% 148 31408 0.14% 149 31990 0.14% 150 32795 0.15% 151 21802764 96.73% 22539638 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=23 prefix-density=0.92 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=31 fanout-score=110.25 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=7.0 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAG criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=3.63 fanout-score-rank=12 prefix-density=0.77 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=51.26 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.9 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804124 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:13:16 Started mapping on | Dec 10 02:13:17 Finished on | Dec 10 02:16:52 Mapping speed, Million of reads per hour | 377.41 Number of input reads | 22539638 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 20425395 Uniquely mapped reads % | 90.62% Average mapped length | 299.49 Number of splices: Total | 20656934 Number of splices: Annotated (sjdb) | 19480837 Number of splices: GT/AG | 20356367 Number of splices: GC/AG | 243943 Number of splices: AT/AC | 9598 Number of splices: Non-canonical | 47026 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 315957 % of reads mapped to multiple loci | 1.40% Number of reads mapped to too many loci | 19638 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.20% % of reads unmapped: other | 0.69% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1798286 1798286 1798286 N_multimapping 315957 315957 315957 N_noFeature 567835 19876983 700895 N_ambiguous 531251 3744 115933 UnstrandedReadsAssigned:19326309 PositiveStrandReadsAssigned:544668 NegativeStrandReadsAssigned:19608567 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804124 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804124-trimmed-pair1.fastq SRR7804124-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,539,638 reads, 20,004,577 reads pseudoaligned [quant] estimated average fragment length: 296.753 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52973 SRR7804124.ke.tsv 35125 SRR7804124.se.tsv 88098 total ==> SRR7804124.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 640.818 0 0 PNS24247 1044 748.247 69.96 5.61901 PNS24249 1928 1632.25 213.62 7.86522 PNS24246 1044 748.247 69.96 5.61901 PNS24248 1044 748.247 69.96 5.61901 PNS24244 1471 1175.25 42.5004 2.17329 PNS24243 293 76.91 0 0 KQK14069 1603 1307.25 17959.1 825.623 KQK14071 474 206.65 327.356 95.2008 ==> SRR7804124.se.tsv <== BRADI_1g14170v3 19036 BRADI_1g53295v3 627 BRADI_1g59795v3 361 BRADI_1g07683v3 0 BRADI_1g00485v3 26 BRADI_1g20270v3 1329 BRADI_1g74790v3 531 BRADI_1g09890v3 11 BRADI_1g77505v3 362 BRADI_1g48960v3 2 SRR7804124 completed mapping pipeline successfully