Starting /dee2/code/volunteer_pipeline.sh SRR7804125 current disk space = 1525404332032 free memory = 1563081736 SRR7804125 SRAfilesize a483dedb275db4e8988d5c7c6198cb14 SRR7804125.sra SRR7804125.sra file validated SRR7804125 is paired end SRR7804125 is conventional basespace SRR7804125 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804125_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.388 37.0 37.0 37.0 37.0 37.0 2 36.28 37.0 37.0 37.0 37.0 37.0 3 36.4485 37.0 37.0 37.0 37.0 37.0 4 36.504 37.0 37.0 37.0 37.0 37.0 5 36.536 37.0 37.0 37.0 37.0 37.0 6 36.422 37.0 37.0 37.0 37.0 37.0 7 36.506 37.0 37.0 37.0 37.0 37.0 8 36.533 37.0 37.0 37.0 37.0 37.0 9 36.508 37.0 37.0 37.0 37.0 37.0 10-14 36.550599999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5257 37.0 37.0 37.0 37.0 37.0 20-24 36.500299999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.4674 37.0 37.0 37.0 37.0 37.0 30-34 36.4246 37.0 37.0 37.0 37.0 37.0 35-39 36.4334 37.0 37.0 37.0 37.0 37.0 40-44 36.4466 37.0 37.0 37.0 37.0 37.0 45-49 36.4267 37.0 37.0 37.0 37.0 37.0 50-54 36.3788 37.0 37.0 37.0 37.0 37.0 55-59 36.3591 37.0 37.0 37.0 37.0 37.0 60-64 36.342499999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.2941 37.0 37.0 37.0 37.0 37.0 70-74 36.2894 37.0 37.0 37.0 37.0 37.0 75-79 36.301500000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.2404 37.0 37.0 37.0 37.0 37.0 85-89 36.1644 37.0 37.0 37.0 37.0 37.0 90-94 36.1554 37.0 37.0 37.0 37.0 37.0 95-99 36.1527 37.0 37.0 37.0 37.0 37.0 100-104 36.11110000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.0653 37.0 37.0 37.0 37.0 37.0 110-114 36.072 37.0 37.0 37.0 37.0 37.0 115-119 36.062200000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.978300000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.8511 37.0 37.0 37.0 37.0 37.0 130-134 35.9018 37.0 37.0 37.0 37.0 37.0 135-139 35.8666 37.0 37.0 37.0 37.0 37.0 140-144 35.819500000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.806 37.0 37.0 37.0 37.0 37.0 150-151 35.27875 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 1.0 24 1.0 25 4.0 26 4.0 27 6.0 28 13.0 29 20.0 30 23.0 31 53.0 32 56.0 33 81.0 34 113.0 35 304.0 36 2903.0 37 416.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.75 11.799999999999999 7.925 35.525 2 26.7017017017017 12.537537537537538 30.555555555555557 30.205205205205203 3 23.3 17.825 23.5 35.375 4 27.325 22.725 20.625 29.325000000000003 5 26.924999999999997 26.5 22.900000000000002 23.674999999999997 6 24.8 30.7 21.8 22.7 7 20.05 21.925 36.925000000000004 21.099999999999998 8 22.35 22.275 27.575 27.800000000000004 9 21.075 21.775 32.4 24.75 10-14 24.345 25.21 24.075 26.369999999999997 15-19 23.98 24.325 25.185000000000002 26.51 20-24 24.175 24.865000000000002 24.845 26.115 25-29 24.41 24.66 24.485 26.445 30-34 24.515 24.62 24.7 26.165 35-39 24.990000000000002 23.76 24.404999999999998 26.845000000000002 40-44 24.425 24.37 24.345 26.86 45-49 24.445 24.215 25.14 26.200000000000003 50-54 24.14 24.195 24.545 27.12 55-59 25.045 23.56 24.224999999999998 27.169999999999998 60-64 24.59 24.15 24.060000000000002 27.200000000000003 65-69 24.97 23.96 24.13 26.939999999999998 70-74 25.405 23.56 24.015 27.02 75-79 25.174999999999997 24.11 24.095 26.619999999999997 80-84 25.145 23.549999999999997 24.529999999999998 26.775 85-89 25.215 23.74 24.005000000000003 27.04 90-94 25.135 23.385 24.33 27.150000000000002 95-99 25.005 23.65 24.43 26.915 100-104 24.88 23.919999999999998 24.325 26.875 105-109 25.145 22.98 24.8 27.075 110-114 24.755 23.455000000000002 24.165 27.625 115-119 25.155 23.395 23.635 27.815 120-124 25.290000000000003 23.45 24.375 26.884999999999998 125-129 25.97 23.14 24.26 26.63 130-134 25.77 23.65 23.474999999999998 27.105 135-139 25.245 23.77 23.965 27.02 140-144 26.195 22.685 24.240000000000002 26.88 145-149 26.21 23.23 24.104999999999997 26.455000000000002 150-151 26.674999999999997 23.075000000000003 23.1625 27.0875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 0.5 28 1.0 29 3.0 30 4.0 31 6.5 32 9.0 33 18.5 34 25.0 35 27.5 36 37.0 37 49.5 38 56.5 39 71.0 40 95.5 41 116.0 42 133.0 43 152.0 44 163.5 45 171.0 46 181.0 47 188.0 48 176.5 49 169.0 50 167.5 51 142.5 52 132.0 53 124.5 54 103.0 55 89.0 56 95.0 57 99.0 58 99.5 59 103.5 60 94.0 61 82.0 62 81.0 63 79.5 64 73.0 65 68.0 66 65.5 67 66.5 68 61.0 69 54.5 70 50.5 71 41.0 72 34.0 73 28.5 74 27.0 75 24.0 76 17.5 77 12.5 78 10.5 79 7.5 80 4.0 81 3.0 82 1.0 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.85 #Duplication Level Percentage of deduplicated Percentage of total 1 93.92647842301545 88.14999999999999 2 5.647309536494406 10.6 3 0.37293553542887586 1.05 4 0.05327650506126798 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0125 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0125 0.0 0.0 0.0 0.025 50-51 0.025 0.0 0.0 0.0 0.025 52-53 0.025 0.0 0.0 0.0 0.025 54-55 0.025 0.0 0.0 0.0 0.025 56-57 0.025 0.0 0.0 0.0 0.025 58-59 0.025 0.0 0.0 0.0 0.025 60-61 0.025 0.0 0.0 0.0 0.025 62-63 0.025 0.0 0.0 0.0 0.025 64-65 0.025 0.0 0.0 0.0 0.025 66-67 0.025 0.0 0.0 0.0 0.025 68-69 0.025 0.0 0.0 0.0 0.025 70-71 0.025 0.0 0.0 0.0 0.025 72-73 0.025 0.0 0.0 0.0 0.025 74-75 0.025 0.0 0.0 0.0 0.025 76-77 0.025 0.0 0.0 0.0 0.025 78-79 0.037500000000000006 0.0 0.0 0.0 0.025 80-81 0.05 0.0 0.0 0.0 0.025 82-83 0.05 0.0 0.0 0.0 0.025 84-85 0.05 0.0 0.0 0.0 0.025 86-87 0.05 0.0 0.0 0.0 0.025 88-89 0.05 0.0 0.0 0.0 0.025 90-91 0.05 0.0 0.0 0.0 0.025 92-93 0.05 0.0 0.0 0.0 0.025 94-95 0.05 0.0 0.0 0.0 0.025 96-97 0.05 0.0 0.0 0.0 0.025 98-99 0.05 0.0 0.0 0.0 0.025 100-101 0.0625 0.0 0.0 0.0 0.025 102-103 0.075 0.0 0.0 0.0 0.025 104-105 0.1 0.0 0.0 0.0 0.025 106-107 0.1 0.0 0.0 0.0 0.025 108-109 0.1 0.0 0.0 0.0 0.025 110-111 0.125 0.0 0.0 0.0 0.025 112-113 0.125 0.0 0.0 0.0 0.025 114-115 0.25 0.0 0.0 0.0 0.025 116-117 0.3375 0.0 0.0 0.0 0.025 118-119 0.375 0.0 0.0 0.0 0.025 120-121 0.3875 0.0 0.0 0.0 0.025 122-123 0.4375 0.0 0.0 0.0 0.025 124-125 0.5625 0.0 0.0 0.0 0.025 126-127 0.6875 0.0 0.0 0.0 0.025 128-129 0.8 0.0 0.0 0.0 0.025 130-131 0.875 0.0 0.0 0.0 0.025 132-133 1.0125 0.0 0.0 0.0 0.025 134-135 1.0875 0.0 0.0 0.0 0.025 136-137 1.1625 0.0 0.0 0.0 0.025 138-139 1.4 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804125 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804125_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3905 37.0 37.0 37.0 37.0 37.0 2 36.276 37.0 37.0 37.0 37.0 37.0 3 36.315 37.0 37.0 37.0 37.0 37.0 4 36.4445 37.0 37.0 37.0 37.0 37.0 5 36.3185 37.0 37.0 37.0 37.0 37.0 6 36.3955 37.0 37.0 37.0 37.0 37.0 7 36.2745 37.0 37.0 37.0 37.0 37.0 8 36.367 37.0 37.0 37.0 37.0 37.0 9 36.2875 37.0 37.0 37.0 37.0 37.0 10-14 36.3432 37.0 37.0 37.0 37.0 37.0 15-19 36.26610000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.2883 37.0 37.0 37.0 37.0 37.0 25-29 36.2432 37.0 37.0 37.0 37.0 37.0 30-34 36.2171 37.0 37.0 37.0 37.0 37.0 35-39 36.2431 37.0 37.0 37.0 37.0 37.0 40-44 36.22239999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.123599999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.144600000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.0486 37.0 37.0 37.0 37.0 37.0 60-64 36.0335 37.0 37.0 37.0 37.0 37.0 65-69 36.0269 37.0 37.0 37.0 37.0 37.0 70-74 36.0161 37.0 37.0 37.0 37.0 37.0 75-79 35.9567 37.0 37.0 37.0 37.0 37.0 80-84 35.9874 37.0 37.0 37.0 37.0 37.0 85-89 35.9316 37.0 37.0 37.0 37.0 37.0 90-94 35.929500000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.862199999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.8788 37.0 37.0 37.0 37.0 37.0 105-109 35.7577 37.0 37.0 37.0 37.0 37.0 110-114 35.699 37.0 37.0 37.0 37.0 37.0 115-119 35.72 37.0 37.0 37.0 37.0 37.0 120-124 35.6587 37.0 37.0 37.0 37.0 37.0 125-129 35.6195 37.0 37.0 37.0 37.0 37.0 130-134 35.58630000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.53099999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.5555 37.0 37.0 37.0 37.0 37.0 145-149 35.4249 37.0 37.0 37.0 37.0 37.0 150-151 34.870000000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 8.0 15 1.0 16 3.0 17 3.0 18 1.0 19 3.0 20 2.0 21 2.0 22 5.0 23 6.0 24 4.0 25 6.0 26 7.0 27 7.0 28 8.0 29 19.0 30 20.0 31 45.0 32 41.0 33 75.0 34 171.0 35 486.0 36 2795.0 37 279.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.71935967983992 17.38369184592296 11.13056528264132 32.7663831915958 2 30.625000000000004 22.650000000000002 24.725 22.0 3 25.674999999999997 24.45 25.35 24.525 4 27.85 28.125 18.35 25.674999999999997 5 30.0 30.45 18.375 21.175 6 25.2 34.300000000000004 17.9 22.6 7 24.15 18.775 32.475 24.6 8 24.65 21.25 22.025 32.074999999999996 9 26.25 21.825 25.624999999999996 26.3 10-14 27.250000000000004 24.185000000000002 21.625 26.939999999999998 15-19 26.790000000000003 23.380000000000003 22.770000000000003 27.060000000000002 20-24 26.595000000000002 24.310000000000002 22.475 26.619999999999997 25-29 26.435 24.065 22.79 26.71 30-34 26.245 24.54 22.355 26.86 35-39 26.745 23.87 22.335 27.05 40-44 26.505000000000003 24.345 22.715 26.435 45-49 26.35 24.325 22.495 26.83 50-54 26.515 24.115000000000002 22.81 26.56 55-59 26.825 23.825 22.615 26.735 60-64 26.950000000000003 23.91 22.34 26.8 65-69 27.27 23.52 22.52 26.69 70-74 27.01 23.630000000000003 22.745 26.615 75-79 27.18 24.21 22.650000000000002 25.96 80-84 26.71 24.490000000000002 22.720000000000002 26.08 85-89 26.724999999999998 24.52 22.56 26.195 90-94 27.13 23.89 22.955000000000002 26.025 95-99 27.694999999999997 24.33 22.475 25.5 100-104 27.08 23.76 22.945 26.215 105-109 27.42 23.9 23.145 25.535000000000004 110-114 27.61 23.97 22.685 25.735000000000003 115-119 27.534999999999997 23.665 22.615 26.185000000000002 120-124 27.48 24.490000000000002 22.545 25.485000000000003 125-129 27.68 23.625 22.425 26.27 130-134 27.01 23.830000000000002 23.28 25.88 135-139 27.334999999999997 24.52 23.080000000000002 25.064999999999998 140-144 27.384999999999998 24.535 22.81 25.27 145-149 26.924999999999997 24.745 22.884999999999998 25.445 150-151 27.05 24.75 22.1875 26.0125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.5 21 1.0 22 0.5 23 0.5 24 1.5 25 3.0 26 1.5 27 1.0 28 3.5 29 5.5 30 4.5 31 7.0 32 9.0 33 11.0 34 12.5 35 19.0 36 26.0 37 33.5 38 46.5 39 61.0 40 79.0 41 90.5 42 113.0 43 141.5 44 143.0 45 143.5 46 168.5 47 176.5 48 152.0 49 137.5 50 138.5 51 134.0 52 129.0 53 119.5 54 102.0 55 100.0 56 97.5 57 103.5 58 110.5 59 97.0 60 97.5 61 99.5 62 102.0 63 101.0 64 91.0 65 95.0 66 97.0 67 81.5 68 73.0 69 75.5 70 61.5 71 53.0 72 55.5 73 48.0 74 38.5 75 29.5 76 21.5 77 15.5 78 11.0 79 5.0 80 3.0 81 1.5 82 1.5 83 2.0 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.7 #Duplication Level Percentage of deduplicated Percentage of total 1 93.64994663820706 87.75 2 5.9765208110992525 11.200000000000001 3 0.3735325506937033 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.3875 0.0 0.0 0.0 0.0 122-123 0.4375 0.0 0.0 0.0 0.0 124-125 0.5625 0.0 0.0 0.0 0.0 126-127 0.6875 0.0 0.0 0.0 0.0 128-129 0.8 0.0 0.0 0.0 0.0 130-131 0.875 0.0 0.0 0.0 0.0 132-133 1.0125 0.0 0.0 0.0 0.0 134-135 1.0875 0.0 0.0 0.0 0.0 136-137 1.1625 0.0 0.0 0.0 0.0 138-139 1.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTCCT 10 0.006830828 145.0 4 TTTCCTG 10 0.006830828 145.0 5 ACCTTTC 10 0.006830828 145.0 2 TACTCAG 10 0.006830828 145.0 5 >>END_MODULE Read 1836455 spots for SRR7804125.sra Written 1836455 spots for SRR7804125.sra Read 1836455 spots for SRR7804125.sra Written 1836455 spots for SRR7804125.sra Read 1836455 spots for SRR7804125.sra Written 1836455 spots for SRR7804125.sra Read 1836455 spots for SRR7804125.sra Written 1836455 spots for SRR7804125.sra Read 1836455 spots for SRR7804125.sra Written 1836455 spots for SRR7804125.sra Read 1836455 spots for SRR7804125.sra Written 1836455 spots for SRR7804125.sra Read 1836458 spots for SRR7804125.sra Written 1836458 spots for SRR7804125.sra Read 1836455 spots for SRR7804125.sra Written 1836455 spots for SRR7804125.sra Read 1836455 spots for SRR7804125.sra Written 1836455 spots for SRR7804125.sra Read 1836455 spots for SRR7804125.sra Written 1836455 spots for SRR7804125.sra Read 1836455 spots for SRR7804125.sra Written 1836455 spots for SRR7804125.sra Read 1836455 spots for SRR7804125.sra Written 1836455 spots for SRR7804125.sra Read 1836455 spots for SRR7804125.sra Written 1836455 spots for SRR7804125.sra Read 1836455 spots for SRR7804125.sra Written 1836455 spots for SRR7804125.sra Read 1836455 spots for SRR7804125.sra Written 1836455 spots for SRR7804125.sra Read 1836455 spots for SRR7804125.sra Written 1836455 spots for SRR7804125.sra Read 1836455 spots for SRR7804125.sra Written 1836455 spots for SRR7804125.sra Read 1836455 spots for SRR7804125.sra Written 1836455 spots for SRR7804125.sra Read 1836455 spots for SRR7804125.sra Written 1836455 spots for SRR7804125.sra Read 1836455 spots for SRR7804125.sra Written 1836455 spots for SRR7804125.sra SRR ids: ['SRR7804125.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ydo390ez SRR7804125.sra spots: 36729103 blocks: [[1, 1836455], [1836456, 3672910], [3672911, 5509365], [5509366, 7345820], [7345821, 9182275], [9182276, 11018730], [11018731, 12855185], [12855186, 14691640], [14691641, 16528095], [16528096, 18364550], [18364551, 20201005], [20201006, 22037460], [22037461, 23873915], [23873916, 25710370], [25710371, 27546825], [27546826, 29383280], [29383281, 31219735], [31219736, 33056190], [33056191, 34892645], [34892646, 36729103]] SRR7804125 file size 12424587 SRR7804125 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804125 SRR7804125_1.fastq SRR7804125_2.fastq Input file: SRR7804125_1.fastq Paired file: SRR7804125_2.fastq trimmed: SRR7804125-trimmed-pair1.fastq, SRR7804125-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:12:43 2024 >> started Tue Dec 10 02:13:25 2024 >> done (42.206s) 36729103 read pairs processed; of these: 109 ( 0.00%) short read pairs filtered out after trimming by size control 724 ( 0.00%) empty read pairs filtered out after trimming by size control 36728270 (100.00%) read pairs available; of these: 1034264 ( 2.82%) trimmed read pairs available after processing 35694006 (97.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 11 0.00% 20 9 0.00% 21 8 0.00% 22 14 0.00% 23 16 0.00% 24 16 0.00% 25 20 0.00% 26 23 0.00% 27 19 0.00% 28 22 0.00% 29 31 0.00% 30 28 0.00% 31 25 0.00% 32 27 0.00% 33 37 0.00% 34 25 0.00% 35 28 0.00% 36 31 0.00% 37 24 0.00% 38 51 0.00% 39 28 0.00% 40 41 0.00% 41 35 0.00% 42 42 0.00% 43 44 0.00% 44 46 0.00% 45 44 0.00% 46 41 0.00% 47 59 0.00% 48 45 0.00% 49 53 0.00% 50 48 0.00% 51 48 0.00% 52 46 0.00% 53 51 0.00% 54 62 0.00% 55 60 0.00% 56 64 0.00% 57 62 0.00% 58 58 0.00% 59 70 0.00% 60 91 0.00% 61 75 0.00% 62 74 0.00% 63 91 0.00% 64 88 0.00% 65 87 0.00% 66 109 0.00% 67 114 0.00% 68 115 0.00% 69 122 0.00% 70 140 0.00% 71 157 0.00% 72 158 0.00% 73 181 0.00% 74 206 0.00% 75 242 0.00% 76 244 0.00% 77 287 0.00% 78 308 0.00% 79 315 0.00% 80 417 0.00% 81 418 0.00% 82 423 0.00% 83 535 0.00% 84 592 0.00% 85 705 0.00% 86 706 0.00% 87 769 0.00% 88 913 0.00% 89 1027 0.00% 90 1134 0.00% 91 1356 0.00% 92 1423 0.00% 93 1605 0.00% 94 1769 0.00% 95 1980 0.01% 96 2206 0.01% 97 2410 0.01% 98 2626 0.01% 99 2788 0.01% 100 3074 0.01% 101 3394 0.01% 102 3642 0.01% 103 4061 0.01% 104 4514 0.01% 105 4733 0.01% 106 5185 0.01% 107 5549 0.02% 108 6008 0.02% 109 6350 0.02% 110 6667 0.02% 111 7119 0.02% 112 7956 0.02% 113 8455 0.02% 114 9171 0.02% 115 9816 0.03% 116 10374 0.03% 117 10884 0.03% 118 11445 0.03% 119 11957 0.03% 120 12705 0.03% 121 13320 0.04% 122 13899 0.04% 123 15011 0.04% 124 16028 0.04% 125 16922 0.05% 126 17845 0.05% 127 18621 0.05% 128 19427 0.05% 129 20075 0.05% 130 20988 0.06% 131 21922 0.06% 132 22906 0.06% 133 24466 0.07% 134 25695 0.07% 135 26859 0.07% 136 27972 0.08% 137 29389 0.08% 138 30049 0.08% 139 31472 0.09% 140 31993 0.09% 141 33602 0.09% 142 35045 0.10% 143 36789 0.10% 144 38589 0.11% 145 40025 0.11% 146 41732 0.11% 147 42896 0.12% 148 44525 0.12% 149 45653 0.12% 150 46963 0.13% 151 35694006 97.18% 36728270 reads passed initial QC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=24 prefix-density=0.87 prefix-fanout=2.3 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=131.39 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=11.5 sequence=AGAAGAACAAAGATGCCCGGATTCATCTCACAAATAACCAAGGGATATTACACAAACACCATCTTTAGTGTACAACACCAACTCCTCATCTCTGACTTTCACATGCAACATCTATCAGTCCTGACTCCTGACTCAATCTCGACACATGCAGCAGCATCCATCATCAACAATGACGTCGTCGGCCAAGCGCCTCAGCATAGAGCAGGCGCTGGAGCTTGCTAACTAAGCTCACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCAGGCGTTGTTGTTCACTGGGTCGGACAGGTGGTCGGCCAGGTTCTCGAG criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=25 prefix-density=0.67 prefix-fanout=2.2 sequence=CTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=89.32 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=8.7 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804125 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:14:14 Started mapping on | Dec 10 02:14:15 Finished on | Dec 10 02:19:15 Mapping speed, Million of reads per hour | 440.74 Number of input reads | 36728270 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 34241008 Uniquely mapped reads % | 93.23% Average mapped length | 299.83 Number of splices: Total | 35493037 Number of splices: Annotated (sjdb) | 33477545 Number of splices: GT/AG | 34970661 Number of splices: GC/AG | 429911 Number of splices: AT/AC | 16690 Number of splices: Non-canonical | 75775 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.97 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 472987 % of reads mapped to multiple loci | 1.29% Number of reads mapped to too many loci | 38284 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.63% % of reads unmapped: other | 0.75% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2014275 2014275 2014275 N_multimapping 472987 472987 472987 N_noFeature 986149 33252032 1229456 N_ambiguous 921826 6110 176913 UnstrandedReadsAssigned:32333033 PositiveStrandReadsAssigned:982866 NegativeStrandReadsAssigned:32834639 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804125 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804125-trimmed-pair1.fastq SRR7804125-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,728,270 reads, 33,110,908 reads pseudoaligned [quant] estimated average fragment length: 296.269 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,136 rounds 52973 SRR7804125.ke.tsv 35125 SRR7804125.se.tsv 88098 total ==> SRR7804125.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 641.194 0 0 PNS24247 1044 748.731 136.607 7.15773 PNS24249 1928 1632.73 249.957 6.00589 PNS24246 1044 748.731 136.607 7.15773 PNS24248 1044 748.731 136.607 7.15773 PNS24244 1471 1175.73 169.221 5.64641 PNS24243 293 72.9751 0 0 KQK14069 1603 1307.73 2351.02 70.5284 KQK14071 474 203.447 15.4824 2.98546 ==> SRR7804125.se.tsv <== BRADI_1g14170v3 2471 BRADI_1g53295v3 1770 BRADI_1g59795v3 666 BRADI_1g07683v3 0 BRADI_1g00485v3 40 BRADI_1g20270v3 3224 BRADI_1g74790v3 933 BRADI_1g09890v3 11 BRADI_1g77505v3 610 BRADI_1g48960v3 0 SRR7804125 completed mapping pipeline successfully