Starting /dee2/code/volunteer_pipeline.sh SRR7804126 current disk space = 1525304127488 free memory = 1408742204 SRR7804126 SRAfilesize 5b881da195708fd4089133f4e26b0f53 SRR7804126.sra SRR7804126.sra file validated SRR7804126 is paired end SRR7804126 is conventional basespace SRR7804126 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804126_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2665 37.0 37.0 37.0 37.0 37.0 2 36.27025 37.0 37.0 37.0 37.0 37.0 3 36.4495 37.0 37.0 37.0 37.0 37.0 4 36.4945 37.0 37.0 37.0 37.0 37.0 5 36.5535 37.0 37.0 37.0 37.0 37.0 6 36.4915 37.0 37.0 37.0 37.0 37.0 7 36.445 37.0 37.0 37.0 37.0 37.0 8 36.5065 37.0 37.0 37.0 37.0 37.0 9 36.406 37.0 37.0 37.0 37.0 37.0 10-14 36.518299999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5383 37.0 37.0 37.0 37.0 37.0 20-24 36.4664 37.0 37.0 37.0 37.0 37.0 25-29 36.4695 37.0 37.0 37.0 37.0 37.0 30-34 36.413 37.0 37.0 37.0 37.0 37.0 35-39 36.3959 37.0 37.0 37.0 37.0 37.0 40-44 36.4383 37.0 37.0 37.0 37.0 37.0 45-49 36.4103 37.0 37.0 37.0 37.0 37.0 50-54 36.4053 37.0 37.0 37.0 37.0 37.0 55-59 36.351099999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.3694 37.0 37.0 37.0 37.0 37.0 65-69 36.3125 37.0 37.0 37.0 37.0 37.0 70-74 36.2537 37.0 37.0 37.0 37.0 37.0 75-79 36.216499999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.209199999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.188 37.0 37.0 37.0 37.0 37.0 90-94 36.156 37.0 37.0 37.0 37.0 37.0 95-99 36.13190000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.1161 37.0 37.0 37.0 37.0 37.0 105-109 36.0876 37.0 37.0 37.0 37.0 37.0 110-114 36.0628 37.0 37.0 37.0 37.0 37.0 115-119 36.060500000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.9738 37.0 37.0 37.0 37.0 37.0 125-129 35.917100000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.9004 37.0 37.0 37.0 37.0 37.0 135-139 35.8296 37.0 37.0 37.0 37.0 37.0 140-144 35.7587 37.0 37.0 37.0 37.0 37.0 145-149 35.7833 37.0 37.0 37.0 37.0 37.0 150-151 35.25775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 2.0 23 1.0 24 4.0 25 4.0 26 4.0 27 10.0 28 8.0 29 13.0 30 25.0 31 42.0 32 69.0 33 78.0 34 126.0 35 317.0 36 2887.0 37 408.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.324999999999996 11.0 9.125 35.55 2 26.870152614460846 12.83462596947711 32.07405554165624 28.221165874405806 3 21.125 18.2 24.375 36.3 4 26.25 24.975 21.025 27.750000000000004 5 27.125 28.199999999999996 21.65 23.025000000000002 6 23.875 30.725 21.55 23.849999999999998 7 17.9 24.224999999999998 37.175000000000004 20.7 8 21.325 24.55 26.5 27.625 9 19.7 21.6 32.45 26.25 10-14 23.52 25.535000000000004 25.195 25.75 15-19 23.064999999999998 24.895 25.840000000000003 26.200000000000003 20-24 23.419999999999998 25.31 25.27 26.0 25-29 23.369999999999997 24.965 25.47 26.195 30-34 23.385 26.085 24.3 26.229999999999997 35-39 23.79 25.474999999999998 25.069999999999997 25.665 40-44 23.415 25.275 24.610000000000003 26.700000000000003 45-49 23.674999999999997 25.095 25.130000000000003 26.1 50-54 23.799999999999997 24.995 24.59 26.615 55-59 24.245 24.77 24.32 26.665 60-64 23.880000000000003 24.55 24.95 26.619999999999997 65-69 23.765 25.395 25.019999999999996 25.82 70-74 24.235 25.34 24.69 25.735000000000003 75-79 24.099999999999998 24.81 24.54 26.55 80-84 23.599999999999998 25.009999999999998 24.95 26.44 85-89 23.765 24.925 24.68 26.63 90-94 23.735 24.740000000000002 24.95 26.575 95-99 24.125 25.145 24.515 26.215 100-104 24.69 24.45 24.675 26.185000000000002 105-109 24.12 24.265 25.324999999999996 26.290000000000003 110-114 24.535 24.36 25.1 26.005 115-119 24.42 24.415 24.335 26.83 120-124 24.39 25.025 24.275 26.31 125-129 25.09 24.755 24.104999999999997 26.05 130-134 24.515 24.38 24.305 26.8 135-139 24.125 24.709999999999997 24.285 26.88 140-144 24.125 24.175 24.875 26.825 145-149 24.54 24.79 24.060000000000002 26.61 150-151 24.975 24.587500000000002 24.3 26.137500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 0.0 24 0.5 25 1.0 26 1.5 27 2.0 28 2.5 29 2.5 30 5.5 31 9.0 32 13.5 33 16.5 34 21.0 35 27.5 36 39.5 37 52.5 38 62.0 39 81.5 40 108.5 41 132.0 42 165.0 43 187.5 44 187.5 45 189.0 46 194.5 47 201.5 48 188.0 49 168.0 50 155.0 51 151.5 52 158.0 53 144.0 54 120.5 55 106.5 56 91.0 57 86.5 58 87.0 59 75.5 60 69.0 61 65.5 62 64.0 63 59.5 64 59.0 65 59.0 66 51.0 67 57.5 68 56.0 69 39.5 70 32.5 71 34.5 72 33.0 73 24.5 74 19.0 75 14.0 76 7.0 77 7.0 78 4.5 79 1.5 80 1.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.425 #Duplication Level Percentage of deduplicated Percentage of total 1 93.44393898849344 87.3 2 6.154669521006155 11.5 3 0.34787262510034783 0.975 4 0.02675943270002676 0.1 5 0.02675943270002676 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGACAAACAGTGGGAGACAGAGTGACCTTTTGCCGCATGAATGTCTTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.2875 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.5874999999999999 0.0 0.0 0.0 0.0 126-127 0.7749999999999999 0.0 0.0 0.0 0.0 128-129 0.925 0.0 0.0 0.0 0.0 130-131 1.075 0.0 0.0 0.0 0.0 132-133 1.175 0.0 0.0 0.0 0.0 134-135 1.3375 0.0 0.0 0.0 0.0 136-137 1.4625 0.0 0.0 0.0 0.0 138-139 1.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAGATT 10 0.006830828 145.0 4 TGACAGA 10 0.006830828 145.0 2 TGAAGTA 10 0.006830828 145.0 8 TCTGATA 10 0.006830828 145.0 8 CACTCCC 10 0.006830828 145.0 145 GTGACAG 10 0.006830828 145.0 1 GATCAAC 10 0.006830828 145.0 5 GATTAGG 10 0.006830828 145.0 7 AGATTAG 10 0.006830828 145.0 6 >>END_MODULE SRR7804126 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804126_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.37275 37.0 37.0 37.0 37.0 37.0 2 36.1355 37.0 37.0 37.0 37.0 37.0 3 36.1995 37.0 37.0 37.0 37.0 37.0 4 36.3225 37.0 37.0 37.0 37.0 37.0 5 36.328 37.0 37.0 37.0 37.0 37.0 6 36.2595 37.0 37.0 37.0 37.0 37.0 7 36.227 37.0 37.0 37.0 37.0 37.0 8 36.4145 37.0 37.0 37.0 37.0 37.0 9 36.207 37.0 37.0 37.0 37.0 37.0 10-14 36.3147 37.0 37.0 37.0 37.0 37.0 15-19 36.268899999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.2723 37.0 37.0 37.0 37.0 37.0 25-29 36.1691 37.0 37.0 37.0 37.0 37.0 30-34 36.20100000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.1555 37.0 37.0 37.0 37.0 37.0 40-44 36.1077 37.0 37.0 37.0 37.0 37.0 45-49 36.0796 37.0 37.0 37.0 37.0 37.0 50-54 35.993700000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.9395 37.0 37.0 37.0 37.0 37.0 60-64 35.957 37.0 37.0 37.0 37.0 37.0 65-69 35.9222 37.0 37.0 37.0 37.0 37.0 70-74 35.9267 37.0 37.0 37.0 37.0 37.0 75-79 35.89040000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.8535 37.0 37.0 37.0 37.0 37.0 85-89 35.8312 37.0 37.0 37.0 37.0 37.0 90-94 35.8706 37.0 37.0 37.0 37.0 37.0 95-99 35.771699999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.816900000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.781600000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.604099999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.601000000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.6016 37.0 37.0 37.0 37.0 37.0 125-129 35.5559 37.0 37.0 37.0 37.0 37.0 130-134 35.6268 37.0 37.0 37.0 37.0 37.0 135-139 35.4978 37.0 37.0 37.0 37.0 37.0 140-144 35.4739 37.0 37.0 37.0 37.0 37.0 145-149 35.2927 37.0 37.0 37.0 32.2 37.0 150-151 34.789 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 2.0 15 4.0 16 2.0 17 0.0 18 1.0 19 1.0 20 1.0 21 6.0 22 8.0 23 6.0 24 4.0 25 5.0 26 6.0 27 13.0 28 17.0 29 19.0 30 35.0 31 45.0 32 45.0 33 94.0 34 161.0 35 572.0 36 2712.0 37 240.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.859464866216555 19.204801200300075 10.977744436109028 31.957989497374346 2 30.15 23.45 23.724999999999998 22.675 3 22.925 25.124999999999996 27.3 24.65 4 25.825 30.025000000000002 19.625 24.525 5 28.4 29.875 19.025 22.7 6 23.724999999999998 34.625 19.925 21.725 7 23.625 19.725 32.550000000000004 24.099999999999998 8 25.05 23.25 21.525 30.175 9 23.1 23.175 25.85 27.875 10-14 25.905 25.324999999999996 22.495 26.275 15-19 26.015 24.085 23.665 26.235000000000003 20-24 25.540000000000003 24.75 23.535 26.174999999999997 25-29 26.55 24.84 22.89 25.72 30-34 25.97 24.305 23.655 26.07 35-39 26.025 24.14 23.94 25.895000000000003 40-44 26.055 24.425 23.799999999999997 25.72 45-49 26.435 24.26 23.275000000000002 26.029999999999998 50-54 26.450000000000003 24.23 23.79 25.53 55-59 26.584999999999997 24.255 23.65 25.509999999999998 60-64 26.655 24.779999999999998 23.48 25.085 65-69 26.595000000000002 25.185000000000002 23.345 24.875 70-74 26.790000000000003 24.52 24.255 24.435000000000002 75-79 26.479999999999997 24.295 24.145 25.080000000000002 80-84 27.02 24.55 23.794999999999998 24.635 85-89 26.6 25.705 23.425 24.27 90-94 26.945000000000004 25.115 23.305 24.635 95-99 26.515 24.505 24.025 24.955 100-104 26.615 24.87 23.315 25.2 105-109 26.935 24.805 23.78 24.48 110-114 26.965 24.695 23.674999999999997 24.665 115-119 26.83 24.404999999999998 23.89 24.875 120-124 26.810000000000002 25.740000000000002 23.669999999999998 23.78 125-129 27.229999999999997 24.92 24.235 23.615 130-134 27.48 25.124999999999996 23.205000000000002 24.19 135-139 26.795 24.86 24.015 24.33 140-144 26.845000000000002 24.93 23.385 24.84 145-149 26.965 24.73 24.205 24.099999999999998 150-151 26.775 24.65 24.175 24.4 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 1.0 25 1.5 26 1.5 27 2.0 28 1.5 29 2.0 30 3.0 31 6.0 32 7.5 33 14.0 34 21.0 35 26.5 36 34.0 37 41.5 38 61.5 39 79.0 40 97.0 41 112.0 42 126.0 43 149.5 44 170.0 45 195.5 46 191.5 47 164.0 48 164.5 49 164.5 50 138.5 51 135.5 52 136.0 53 120.0 54 121.0 55 118.5 56 110.0 57 98.0 58 96.5 59 99.0 60 91.5 61 76.5 62 63.0 63 75.0 64 72.5 65 71.0 66 72.5 67 61.5 68 63.0 69 61.0 70 57.0 71 46.5 72 35.0 73 35.5 74 34.0 75 23.5 76 12.5 77 8.0 78 7.0 79 6.0 80 3.5 81 1.0 82 1.0 83 0.5 84 0.5 85 0.0 86 1.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 1.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.0 #Duplication Level Percentage of deduplicated Percentage of total 1 93.44086021505376 86.9 2 5.994623655913978 11.15 3 0.3763440860215054 1.05 4 0.053763440860215055 0.2 5 0.08064516129032258 0.375 6 0.026881720430107527 0.15 7 0.026881720430107527 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 7 0.17500000000000002 No Hit CCTTAACTGAGCTCCTCACTCACTCACTGCAGCTAGCCTCTTCTTCCTCA 6 0.15 No Hit CTTCTATTGATCTTGCTGGGAGATCGTCTGCAAGTGCAACCAACAGCAAT 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit GAAACATCCTTAACTGAGCTCCTCACTCACTCACTGCAGCTAGCCTCTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.2875 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.5874999999999999 0.0 0.0 0.0 0.0 126-127 0.7749999999999999 0.0 0.0 0.0 0.0 128-129 0.925 0.0 0.0 0.0 0.0 130-131 1.075 0.0 0.0 0.0 0.0 132-133 1.175 0.0 0.0 0.0 0.0 134-135 1.3375 0.0 0.0 0.0 0.0 136-137 1.4625 0.0 0.0 0.0 0.0 138-139 1.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATGTCA 10 0.006830828 145.0 4 GACGGCG 10 0.006830828 145.0 145 ATATGTC 10 0.006830828 145.0 3 CCATATG 10 0.006830828 145.0 145 ATGTCAT 10 0.006830828 145.0 5 >>END_MODULE Read 1953269 spots for SRR7804126.sra Written 1953269 spots for SRR7804126.sra Read 1953269 spots for SRR7804126.sra Written 1953269 spots for SRR7804126.sra Read 1953269 spots for SRR7804126.sra Written 1953269 spots for SRR7804126.sra Read 1953269 spots for SRR7804126.sra Written 1953269 spots for SRR7804126.sra Read 1953269 spots for SRR7804126.sra Written 1953269 spots for SRR7804126.sra Read 1953269 spots for SRR7804126.sra Written 1953269 spots for SRR7804126.sra Read 1953269 spots for SRR7804126.sra Written 1953269 spots for SRR7804126.sra Read 1953269 spots for SRR7804126.sra Written 1953269 spots for SRR7804126.sra Read 1953269 spots for SRR7804126.sra Written 1953269 spots for SRR7804126.sra Read 1953271 spots for SRR7804126.sra Written 1953271 spots for SRR7804126.sra Read 1953269 spots for SRR7804126.sra Written 1953269 spots for SRR7804126.sra Read 1953269 spots for SRR7804126.sra Written 1953269 spots for SRR7804126.sra Read 1953269 spots for SRR7804126.sra Written 1953269 spots for SRR7804126.sra Read 1953269 spots for SRR7804126.sra Written 1953269 spots for SRR7804126.sra Read 1953269 spots for SRR7804126.sra Written 1953269 spots for SRR7804126.sra Read 1953269 spots for SRR7804126.sra Written 1953269 spots for SRR7804126.sra Read 1953269 spots for SRR7804126.sra Written 1953269 spots for SRR7804126.sra Read 1953269 spots for SRR7804126.sra Written 1953269 spots for SRR7804126.sra Read 1953269 spots for SRR7804126.sra Written 1953269 spots for SRR7804126.sra Read 1953269 spots for SRR7804126.sra Written 1953269 spots for SRR7804126.sra SRR ids: ['SRR7804126.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_00jdtt28 SRR7804126.sra spots: 39065382 blocks: [[1, 1953269], [1953270, 3906538], [3906539, 5859807], [5859808, 7813076], [7813077, 9766345], [9766346, 11719614], [11719615, 13672883], [13672884, 15626152], [15626153, 17579421], [17579422, 19532690], [19532691, 21485959], [21485960, 23439228], [23439229, 25392497], [25392498, 27345766], [27345767, 29299035], [29299036, 31252304], [31252305, 33205573], [33205574, 35158842], [35158843, 37112111], [37112112, 39065382]] SRR7804126 file size 13216275 SRR7804126 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804126 SRR7804126_1.fastq SRR7804126_2.fastq Input file: SRR7804126_1.fastq Paired file: SRR7804126_2.fastq trimmed: SRR7804126-trimmed-pair1.fastq, SRR7804126-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:17:30 2024 >> started Tue Dec 10 02:18:25 2024 >> done (54.736s) 39065382 read pairs processed; of these: 110 ( 0.00%) short read pairs filtered out after trimming by size control 628 ( 0.00%) empty read pairs filtered out after trimming by size control 39064644 (100.00%) read pairs available; of these: 1079729 ( 2.76%) trimmed read pairs available after processing 37984915 (97.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 12 0.00% 20 18 0.00% 21 18 0.00% 22 15 0.00% 23 19 0.00% 24 27 0.00% 25 29 0.00% 26 28 0.00% 27 27 0.00% 28 32 0.00% 29 18 0.00% 30 29 0.00% 31 43 0.00% 32 31 0.00% 33 35 0.00% 34 38 0.00% 35 42 0.00% 36 37 0.00% 37 37 0.00% 38 46 0.00% 39 41 0.00% 40 54 0.00% 41 52 0.00% 42 43 0.00% 43 48 0.00% 44 54 0.00% 45 55 0.00% 46 63 0.00% 47 63 0.00% 48 48 0.00% 49 79 0.00% 50 57 0.00% 51 59 0.00% 52 71 0.00% 53 61 0.00% 54 67 0.00% 55 72 0.00% 56 79 0.00% 57 74 0.00% 58 75 0.00% 59 69 0.00% 60 70 0.00% 61 94 0.00% 62 82 0.00% 63 102 0.00% 64 118 0.00% 65 107 0.00% 66 131 0.00% 67 134 0.00% 68 124 0.00% 69 138 0.00% 70 132 0.00% 71 179 0.00% 72 204 0.00% 73 229 0.00% 74 217 0.00% 75 266 0.00% 76 249 0.00% 77 267 0.00% 78 313 0.00% 79 391 0.00% 80 415 0.00% 81 438 0.00% 82 545 0.00% 83 644 0.00% 84 693 0.00% 85 797 0.00% 86 828 0.00% 87 910 0.00% 88 1004 0.00% 89 1032 0.00% 90 1229 0.00% 91 1409 0.00% 92 1624 0.00% 93 1775 0.00% 94 2017 0.01% 95 2131 0.01% 96 2299 0.01% 97 2582 0.01% 98 2810 0.01% 99 3012 0.01% 100 3411 0.01% 101 3526 0.01% 102 3952 0.01% 103 4455 0.01% 104 4672 0.01% 105 4919 0.01% 106 5383 0.01% 107 5642 0.01% 108 6192 0.02% 109 6506 0.02% 110 6768 0.02% 111 7438 0.02% 112 8192 0.02% 113 8630 0.02% 114 9368 0.02% 115 9804 0.03% 116 10322 0.03% 117 11282 0.03% 118 11460 0.03% 119 12246 0.03% 120 12639 0.03% 121 13758 0.04% 122 14417 0.04% 123 15542 0.04% 124 16653 0.04% 125 17351 0.04% 126 18313 0.05% 127 18933 0.05% 128 19847 0.05% 129 20698 0.05% 130 21553 0.06% 131 22727 0.06% 132 23886 0.06% 133 25167 0.06% 134 26650 0.07% 135 27945 0.07% 136 29403 0.08% 137 30456 0.08% 138 31478 0.08% 139 32843 0.08% 140 33838 0.09% 141 35142 0.09% 142 37241 0.10% 143 38032 0.10% 144 39780 0.10% 145 41826 0.11% 146 44072 0.11% 147 45760 0.12% 148 46809 0.12% 149 48755 0.12% 150 50434 0.13% 151 37984915 97.24% 39064644 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.43 fanout-score-rank=25 prefix-density=0.54 prefix-fanout=3.1 sequence=TGCCGCACTTGCAG criterion=fanout-score sequence-density=0.11 sequence-density-rank=13 fanout-score=294.39 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=30.9 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=1.38 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=25 prefix-density=1.48 prefix-fanout=2.6 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=972.88 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=19.6 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR7804126 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Dec 10 02:43:50 Started mapping on | Dec 10 02:44:01 Finished on | Dec 10 02:48:53 Mapping speed, Million of reads per hour | 481.61 Number of input reads | 39064102 Average input read length | 281 UNIQUE READS: Uniquely mapped reads number | 34468130 Uniquely mapped reads % | 88.23% Average mapped length | 279.77 Number of splices: Total | 34205132 Number of splices: Annotated (sjdb) | 32129188 Number of splices: GT/AG | 33713708 Number of splices: GC/AG | 383519 Number of splices: AT/AC | 27538 Number of splices: Non-canonical | 80367 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 535289 % of reads mapped to multiple loci | 1.37% Number of reads mapped to too many loci | 27927 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.94% % of reads unmapped: other | 0.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4060720 4060720 4060720 N_multimapping 535289 535289 535289 N_noFeature 1027200 33631379 1291275 N_ambiguous 728054 6356 159632 UnstrandedReadsAssigned:32712876 PositiveStrandReadsAssigned:830395 NegativeStrandReadsAssigned:33017223 Dataset is classified negative stranded MeadianReadLen=131 20thPercentileLength=131 echo kmer=127 SRR7804126 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804126-trimmed-pair1.fastq SRR7804126-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,064,102 reads, 34,858,543 reads pseudoaligned [quant] estimated average fragment length: 274.977 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,272 rounds 52973 SRR7804126.ke.tsv 35125 SRR7804126.se.tsv 88098 total ==> SRR7804126.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 662.635 0 0 PNS24247 1044 770.023 189.445 9.64963 PNS24249 1928 1654.02 400.043 9.48627 PNS24246 1044 770.023 189.445 9.64963 PNS24248 1044 770.023 189.445 9.64963 PNS24244 1471 1197.02 230.621 7.55661 PNS24243 293 84.8486 1 0.46226 KQK14069 1603 1329.02 7218.02 213.018 KQK14071 474 220.992 57.2791 10.166 ==> SRR7804126.se.tsv <== BRADI_1g14170v3 7167 BRADI_1g53295v3 1615 BRADI_1g59795v3 514 BRADI_1g07683v3 0 BRADI_1g00485v3 115 BRADI_1g20270v3 2549 BRADI_1g74790v3 112 BRADI_1g09890v3 1 BRADI_1g77505v3 688 BRADI_1g48960v3 0 SRR7804126 completed mapping pipeline successfully