Starting /dee2/code/volunteer_pipeline.sh SRR7804127 current disk space = 1525371158528 free memory = 1562018680 SRR7804127 SRAfilesize cf10fa801cc6f33b654affb6310a2238 SRR7804127.sra SRR7804127.sra file validated SRR7804127 is paired end SRR7804127 is conventional basespace SRR7804127 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804127_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.134 37.0 37.0 37.0 37.0 37.0 2 36.3135 37.0 37.0 37.0 37.0 37.0 3 36.349 37.0 37.0 37.0 37.0 37.0 4 36.4095 37.0 37.0 37.0 37.0 37.0 5 36.405 37.0 37.0 37.0 37.0 37.0 6 36.4605 37.0 37.0 37.0 37.0 37.0 7 36.401 37.0 37.0 37.0 37.0 37.0 8 36.542 37.0 37.0 37.0 37.0 37.0 9 36.4595 37.0 37.0 37.0 37.0 37.0 10-14 36.4697 37.0 37.0 37.0 37.0 37.0 15-19 36.463100000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.4759 37.0 37.0 37.0 37.0 37.0 25-29 36.430299999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.4351 37.0 37.0 37.0 37.0 37.0 35-39 36.445800000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.424099999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.3807 37.0 37.0 37.0 37.0 37.0 50-54 36.3712 37.0 37.0 37.0 37.0 37.0 55-59 36.366400000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.309 37.0 37.0 37.0 37.0 37.0 65-69 36.3211 37.0 37.0 37.0 37.0 37.0 70-74 36.261199999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.25150000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.1721 37.0 37.0 37.0 37.0 37.0 85-89 36.1933 37.0 37.0 37.0 37.0 37.0 90-94 36.11919999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.162600000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.1507 37.0 37.0 37.0 37.0 37.0 105-109 36.0508 37.0 37.0 37.0 37.0 37.0 110-114 36.0804 37.0 37.0 37.0 37.0 37.0 115-119 36.0244 37.0 37.0 37.0 37.0 37.0 120-124 35.9948 37.0 37.0 37.0 37.0 37.0 125-129 35.921299999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.8467 37.0 37.0 37.0 37.0 37.0 135-139 35.858999999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.7826 37.0 37.0 37.0 37.0 37.0 145-149 35.7922 37.0 37.0 37.0 37.0 37.0 150-151 35.256 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 0.0 25 0.0 26 2.0 27 5.0 28 21.0 29 22.0 30 30.0 31 47.0 32 67.0 33 87.0 34 122.0 35 345.0 36 2824.0 37 427.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.025000000000006 11.675 9.875 35.425000000000004 2 26.813406703351678 14.557278639319659 30.71535767883942 27.913956978489246 3 23.575 19.625 24.65 32.15 4 27.175 24.4 21.075 27.35 5 26.700000000000003 27.05 23.125 23.125 6 23.7 30.275000000000002 22.0 24.025 7 19.0 22.55 36.199999999999996 22.25 8 21.55 21.85 26.75 29.849999999999998 9 21.425 20.724999999999998 31.525 26.325 10-14 24.62 24.455 24.15 26.775 15-19 24.18 24.349999999999998 24.740000000000002 26.729999999999997 20-24 24.91 23.785 24.779999999999998 26.525 25-29 24.36 24.005000000000003 24.25 27.384999999999998 30-34 24.92 23.76 23.575 27.744999999999997 35-39 24.955 23.565 24.67 26.810000000000002 40-44 25.36 23.599999999999998 23.79 27.250000000000004 45-49 24.575 23.7 24.145 27.58 50-54 24.785 23.72 23.995 27.500000000000004 55-59 25.5 23.235 24.075 27.189999999999998 60-64 24.925 23.96 23.71 27.405 65-69 25.47 23.65 23.96 26.919999999999998 70-74 24.995 23.375 24.115000000000002 27.515 75-79 25.045 23.39 23.794999999999998 27.77 80-84 25.785000000000004 22.865 23.75 27.6 85-89 24.93 22.915 24.169999999999998 27.985 90-94 25.6 22.575 24.565 27.26 95-99 25.585 22.61 23.755000000000003 28.050000000000004 100-104 25.56 22.55 23.94 27.950000000000003 105-109 25.840000000000003 23.09 23.255 27.815 110-114 25.185000000000002 23.535 23.54 27.74 115-119 25.740000000000002 22.71 23.674999999999997 27.875 120-124 25.929999999999996 22.675 23.195 28.199999999999996 125-129 25.775 23.03 23.535 27.66 130-134 26.290000000000003 23.119999999999997 23.5 27.089999999999996 135-139 26.515 22.6 23.56 27.325 140-144 26.345000000000002 23.18 23.215 27.26 145-149 25.929999999999996 23.225 23.015 27.83 150-151 26.4625 23.1 23.25 27.187499999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 1.0 26 1.0 27 1.5 28 2.5 29 3.5 30 8.0 31 13.5 32 11.5 33 13.5 34 21.5 35 31.5 36 44.5 37 65.0 38 74.5 39 72.5 40 85.0 41 106.0 42 127.5 43 128.5 44 125.5 45 133.5 46 148.0 47 151.5 48 157.0 49 154.5 50 131.5 51 126.0 52 135.5 53 132.0 54 118.5 55 116.5 56 111.5 57 108.0 58 98.5 59 104.5 60 121.5 61 100.0 62 74.0 63 71.5 64 84.5 65 81.5 66 75.5 67 75.5 68 79.0 69 76.5 70 62.5 71 51.0 72 38.0 73 34.5 74 32.0 75 22.5 76 13.0 77 13.0 78 10.5 79 6.5 80 5.0 81 2.5 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.7 #Duplication Level Percentage of deduplicated Percentage of total 1 92.96116504854369 86.175 2 6.28371089536138 11.65 3 0.674217907227616 1.875 4 0.08090614886731393 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.38749999999999996 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.775 0.0 0.0 0.0 0.0 124-125 0.925 0.0 0.0 0.0 0.0 126-127 1.0125 0.0 0.0 0.0 0.0 128-129 1.0750000000000002 0.0 0.0 0.0 0.0 130-131 1.25 0.0 0.0 0.0 0.0 132-133 1.5625 0.0 0.0 0.0 0.0 134-135 1.8 0.0 0.0 0.0 0.0 136-137 1.9625 0.0 0.0 0.0 0.0 138-139 2.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAGTT 10 0.006830828 145.0 3 TGGCCTC 10 0.006830828 145.0 145 >>END_MODULE SRR7804127 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804127_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4765 37.0 37.0 37.0 37.0 37.0 2 36.238 37.0 37.0 37.0 37.0 37.0 3 36.256 37.0 37.0 37.0 37.0 37.0 4 36.2885 37.0 37.0 37.0 37.0 37.0 5 36.3275 37.0 37.0 37.0 37.0 37.0 6 36.182 37.0 37.0 37.0 37.0 37.0 7 36.1395 37.0 37.0 37.0 37.0 37.0 8 36.3565 37.0 37.0 37.0 37.0 37.0 9 36.2665 37.0 37.0 37.0 37.0 37.0 10-14 36.2263 37.0 37.0 37.0 37.0 37.0 15-19 36.156600000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.189299999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.0944 37.0 37.0 37.0 37.0 37.0 30-34 36.1165 37.0 37.0 37.0 37.0 37.0 35-39 36.055099999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.0308 37.0 37.0 37.0 37.0 37.0 45-49 36.002399999999994 37.0 37.0 37.0 37.0 37.0 50-54 35.9687 37.0 37.0 37.0 37.0 37.0 55-59 35.992399999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.9805 37.0 37.0 37.0 37.0 37.0 65-69 35.956399999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.9221 37.0 37.0 37.0 37.0 37.0 75-79 35.880399999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.8101 37.0 37.0 37.0 37.0 37.0 85-89 35.8484 37.0 37.0 37.0 37.0 37.0 90-94 35.839999999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.7567 37.0 37.0 37.0 37.0 37.0 100-104 35.818400000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.7669 37.0 37.0 37.0 37.0 37.0 110-114 35.59009999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.6006 37.0 37.0 37.0 37.0 37.0 120-124 35.6147 37.0 37.0 37.0 37.0 37.0 125-129 35.544900000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.6 37.0 37.0 37.0 37.0 37.0 135-139 35.5042 37.0 37.0 37.0 37.0 37.0 140-144 35.439800000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.301100000000005 37.0 37.0 37.0 37.0 37.0 150-151 34.86175 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 10.0 15 3.0 16 2.0 17 4.0 18 5.0 19 4.0 20 3.0 21 6.0 22 6.0 23 12.0 24 7.0 25 6.0 26 12.0 27 7.0 28 8.0 29 25.0 30 19.0 31 36.0 32 56.0 33 77.0 34 152.0 35 454.0 36 2775.0 37 307.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.52026013006503 17.70885442721361 10.955477738869435 30.81540770385193 2 32.125 24.0 22.575 21.3 3 24.474999999999998 24.775 25.424999999999997 25.324999999999996 4 28.075 29.525000000000002 18.65 23.75 5 28.575 31.0 17.65 22.775000000000002 6 27.075 31.85 17.775 23.3 7 24.275 19.275000000000002 31.2 25.25 8 27.35 23.5 19.75 29.4 9 26.875 22.35 22.725 28.050000000000004 10-14 27.29 24.755 21.04 26.915 15-19 27.139999999999997 24.240000000000002 22.045 26.575 20-24 27.55 24.465 21.675 26.31 25-29 27.51 23.945 22.18 26.365 30-34 27.455000000000002 24.905 21.39 26.25 35-39 27.839999999999996 24.365000000000002 21.475 26.32 40-44 27.644999999999996 23.474999999999998 22.2 26.68 45-49 27.825 24.169999999999998 21.6 26.405 50-54 27.500000000000004 24.245 21.54 26.715 55-59 27.85 23.945 21.29 26.915 60-64 28.12 23.59 21.725 26.565 65-69 27.71 24.4 21.605 26.284999999999997 70-74 28.060000000000002 23.86 21.759999999999998 26.32 75-79 27.79 23.315 22.2 26.695 80-84 28.02 24.355 21.3 26.325 85-89 28.055000000000003 23.315 21.895 26.735 90-94 28.225 23.56 21.725 26.490000000000002 95-99 28.13 23.345 21.8 26.724999999999998 100-104 27.315 23.96 22.075 26.650000000000002 105-109 27.500000000000004 24.015 22.095000000000002 26.39 110-114 27.694999999999997 23.855 21.725 26.724999999999998 115-119 27.975 23.775 22.05 26.200000000000003 120-124 28.015 24.0 21.595 26.39 125-129 27.944999999999997 23.9 22.085 26.07 130-134 27.83 23.95 22.045 26.174999999999997 135-139 28.04 23.93 22.065 25.965 140-144 28.005000000000003 24.05 22.545 25.4 145-149 27.884999999999998 24.375 22.220000000000002 25.52 150-151 27.800000000000004 23.799999999999997 22.037499999999998 26.3625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 1.5 9 1.5 10 0.0 11 0.0 12 1.0 13 1.5 14 0.5 15 0.0 16 1.0 17 1.5 18 2.0 19 1.5 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 1.0 26 1.5 27 3.0 28 3.0 29 2.0 30 4.5 31 6.5 32 7.5 33 8.5 34 12.0 35 19.5 36 28.5 37 30.5 38 37.0 39 64.5 40 84.0 41 86.0 42 93.0 43 119.5 44 140.0 45 128.0 46 120.5 47 130.0 48 141.0 49 137.5 50 122.0 51 125.0 52 119.0 53 108.5 54 122.5 55 132.0 56 121.0 57 103.0 58 112.0 59 126.0 60 104.5 61 98.5 62 104.5 63 98.0 64 99.5 65 96.5 66 97.0 67 110.0 68 97.5 69 80.5 70 76.5 71 68.5 72 63.5 73 52.5 74 37.5 75 27.5 76 17.0 77 8.5 78 12.0 79 10.5 80 4.5 81 2.5 82 1.5 83 1.5 84 1.0 85 0.5 86 1.5 87 1.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 1.0 96 0.5 97 0.5 98 0.5 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.925 #Duplication Level Percentage of deduplicated Percentage of total 1 92.7658417187925 85.275 2 6.146314930649986 11.3 3 0.8702746804460157 2.4 4 0.13598041881968997 0.5 5 0.027196083763937992 0.125 6 0.027196083763937992 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027196083763937992 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTGGGTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGT 10 0.25 No Hit GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 6 0.15 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.30000000000000004 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.48750000000000004 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.775 0.0 0.0 0.0 0.0 124-125 0.925 0.0 0.0 0.0 0.0 126-127 1.0125 0.0 0.0 0.0 0.0 128-129 1.0875 0.0 0.0 0.0 0.0 130-131 1.275 0.0 0.0 0.0 0.0 132-133 1.5875 0.0 0.0 0.0 0.0 134-135 1.825 0.0 0.0 0.0 0.0 136-137 1.9874999999999998 0.0 0.0 0.0 0.0 138-139 2.1624999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1105966 spots for SRR7804127.sra Written 1105966 spots for SRR7804127.sra Read 1105966 spots for SRR7804127.sra Written 1105966 spots for SRR7804127.sra Read 1105966 spots for SRR7804127.sra Written 1105966 spots for SRR7804127.sra Read 1105966 spots for SRR7804127.sra Written 1105966 spots for SRR7804127.sra Read 1105966 spots for SRR7804127.sra Written 1105966 spots for SRR7804127.sra Read 1105966 spots for SRR7804127.sra Written 1105966 spots for SRR7804127.sra Read 1105966 spots for SRR7804127.sra Written 1105966 spots for SRR7804127.sra Read 1105966 spots for SRR7804127.sra Written 1105966 spots for SRR7804127.sra Read 1105966 spots for SRR7804127.sra Written 1105966 spots for SRR7804127.sra Read 1105966 spots for SRR7804127.sra Written 1105966 spots for SRR7804127.sra Read 1105980 spots for SRR7804127.sra Written 1105980 spots for SRR7804127.sra Read 1105966 spots for SRR7804127.sra Written 1105966 spots for SRR7804127.sra Read 1105966 spots for SRR7804127.sra Written 1105966 spots for SRR7804127.sra Read 1105966 spots for SRR7804127.sra Written 1105966 spots for SRR7804127.sra Read 1105966 spots for SRR7804127.sra Written 1105966 spots for SRR7804127.sra Read 1105966 spots for SRR7804127.sra Written 1105966 spots for SRR7804127.sra Read 1105966 spots for SRR7804127.sra Written 1105966 spots for SRR7804127.sra Read 1105966 spots for SRR7804127.sra Written 1105966 spots for SRR7804127.sra Read 1105966 spots for SRR7804127.sra Written 1105966 spots for SRR7804127.sra Read 1105966 spots for SRR7804127.sra Written 1105966 spots for SRR7804127.sra SRR ids: ['SRR7804127.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4m_o1aog SRR7804127.sra spots: 22119334 blocks: [[1, 1105966], [1105967, 2211932], [2211933, 3317898], [3317899, 4423864], [4423865, 5529830], [5529831, 6635796], [6635797, 7741762], [7741763, 8847728], [8847729, 9953694], [9953695, 11059660], [11059661, 12165626], [12165627, 13271592], [13271593, 14377558], [14377559, 15483524], [15483525, 16589490], [16589491, 17695456], [17695457, 18801422], [18801423, 19907388], [19907389, 21013354], [21013355, 22119334]] SRR7804127 file size 7473816 SRR7804127 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804127 SRR7804127_1.fastq SRR7804127_2.fastq Input file: SRR7804127_1.fastq Paired file: SRR7804127_2.fastq trimmed: SRR7804127-trimmed-pair1.fastq, SRR7804127-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:14:45 2024 >> started Tue Dec 10 02:15:12 2024 >> done (26.515s) 22119334 read pairs processed; of these: 49 ( 0.00%) short read pairs filtered out after trimming by size control 414 ( 0.00%) empty read pairs filtered out after trimming by size control 22118871 (100.00%) read pairs available; of these: 668497 ( 3.02%) trimmed read pairs available after processing 21450374 (96.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 8 0.00% 20 10 0.00% 21 12 0.00% 22 10 0.00% 23 14 0.00% 24 9 0.00% 25 17 0.00% 26 15 0.00% 27 11 0.00% 28 9 0.00% 29 9 0.00% 30 14 0.00% 31 17 0.00% 32 26 0.00% 33 11 0.00% 34 19 0.00% 35 20 0.00% 36 17 0.00% 37 15 0.00% 38 23 0.00% 39 17 0.00% 40 21 0.00% 41 18 0.00% 42 22 0.00% 43 20 0.00% 44 32 0.00% 45 15 0.00% 46 35 0.00% 47 23 0.00% 48 33 0.00% 49 25 0.00% 50 32 0.00% 51 23 0.00% 52 23 0.00% 53 33 0.00% 54 28 0.00% 55 28 0.00% 56 46 0.00% 57 42 0.00% 58 36 0.00% 59 39 0.00% 60 38 0.00% 61 49 0.00% 62 51 0.00% 63 53 0.00% 64 38 0.00% 65 50 0.00% 66 68 0.00% 67 61 0.00% 68 66 0.00% 69 59 0.00% 70 78 0.00% 71 77 0.00% 72 88 0.00% 73 99 0.00% 74 115 0.00% 75 133 0.00% 76 153 0.00% 77 150 0.00% 78 177 0.00% 79 199 0.00% 80 233 0.00% 81 248 0.00% 82 293 0.00% 83 371 0.00% 84 362 0.00% 85 434 0.00% 86 496 0.00% 87 545 0.00% 88 597 0.00% 89 676 0.00% 90 770 0.00% 91 830 0.00% 92 1043 0.00% 93 1097 0.00% 94 1218 0.01% 95 1291 0.01% 96 1402 0.01% 97 1605 0.01% 98 1726 0.01% 99 1880 0.01% 100 1901 0.01% 101 2246 0.01% 102 2415 0.01% 103 2779 0.01% 104 3021 0.01% 105 3189 0.01% 106 3321 0.02% 107 3662 0.02% 108 3821 0.02% 109 4237 0.02% 110 4317 0.02% 111 4657 0.02% 112 4910 0.02% 113 5404 0.02% 114 5969 0.03% 115 6292 0.03% 116 6921 0.03% 117 6883 0.03% 118 7253 0.03% 119 7615 0.03% 120 7908 0.04% 121 8463 0.04% 122 8895 0.04% 123 9981 0.05% 124 10577 0.05% 125 11070 0.05% 126 11625 0.05% 127 12099 0.05% 128 12488 0.06% 129 12928 0.06% 130 13515 0.06% 131 14109 0.06% 132 14952 0.07% 133 15614 0.07% 134 16614 0.08% 135 18037 0.08% 136 18510 0.08% 137 18830 0.09% 138 19378 0.09% 139 20222 0.09% 140 20533 0.09% 141 21082 0.10% 142 22412 0.10% 143 23623 0.11% 144 24870 0.11% 145 26268 0.12% 146 26940 0.12% 147 27959 0.13% 148 28606 0.13% 149 29222 0.13% 150 30547 0.14% 151 21450374 96.98% 22118871 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=5.18 fanout-score-rank=8 prefix-density=0.84 prefix-fanout=4.1 sequence=AGGTTCTCGAGGGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=33 fanout-score=50.98 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=3.3 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=24 prefix-density=0.79 prefix-fanout=2.4 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCGGGCAGCCCGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=83.50 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=1.6 sequence=ACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCGGCCAAGAAGAAGGTGCAGA SRR7804127 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:16:03 Started mapping on | Dec 10 02:16:03 Finished on | Dec 10 02:19:29 Mapping speed, Million of reads per hour | 386.54 Number of input reads | 22118871 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 19114347 Uniquely mapped reads % | 86.42% Average mapped length | 299.71 Number of splices: Total | 17773186 Number of splices: Annotated (sjdb) | 16797853 Number of splices: GT/AG | 17511561 Number of splices: GC/AG | 209983 Number of splices: AT/AC | 6827 Number of splices: Non-canonical | 44815 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 740243 % of reads mapped to multiple loci | 3.35% Number of reads mapped to too many loci | 92995 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.55% % of reads unmapped: other | 3.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2264281 2264281 2264281 N_multimapping 740243 740243 740243 N_noFeature 1156652 18509845 1283625 N_ambiguous 582890 3094 106545 UnstrandedReadsAssigned:17374805 PositiveStrandReadsAssigned:601408 NegativeStrandReadsAssigned:17724177 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804127 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804127-trimmed-pair1.fastq SRR7804127-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,118,871 reads, 18,073,170 reads pseudoaligned [quant] estimated average fragment length: 292.723 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52973 SRR7804127.ke.tsv 35125 SRR7804127.se.tsv 88098 total ==> SRR7804127.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 644.701 0 0 PNS24247 1044 752.277 66.5087 5.51292 PNS24249 1928 1636.28 125.824 4.79499 PNS24246 1044 752.277 66.5087 5.51292 PNS24248 1044 752.277 66.5087 5.51292 PNS24244 1471 1179.28 97.6499 5.16342 PNS24243 293 75.1104 0 0 KQK14069 1603 1311.28 7029.98 334.303 KQK14071 474 205.621 83.5065 25.3241 ==> SRR7804127.se.tsv <== BRADI_1g14170v3 7140 BRADI_1g53295v3 755 BRADI_1g59795v3 304 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 206 BRADI_1g74790v3 353 BRADI_1g09890v3 0 BRADI_1g77505v3 483 BRADI_1g48960v3 2 SRR7804127 completed mapping pipeline successfully