Starting /dee2/code/volunteer_pipeline.sh SRR7804128 current disk space = 1515110068224 free memory = 1570796140 SRR7804128 SRAfilesize 354c07f41e7d9dd9ffcc0bd8dab49234 SRR7804128.sra SRR7804128.sra file validated SRR7804128 is paired end SRR7804128 is conventional basespace SRR7804128 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804128_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.314 37.0 37.0 37.0 37.0 37.0 2 36.28375 37.0 37.0 37.0 37.0 37.0 3 36.3675 37.0 37.0 37.0 37.0 37.0 4 36.4275 37.0 37.0 37.0 37.0 37.0 5 36.582 37.0 37.0 37.0 37.0 37.0 6 36.38 37.0 37.0 37.0 37.0 37.0 7 36.4765 37.0 37.0 37.0 37.0 37.0 8 36.4835 37.0 37.0 37.0 37.0 37.0 9 36.483 37.0 37.0 37.0 37.0 37.0 10-14 36.45440000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.4653 37.0 37.0 37.0 37.0 37.0 20-24 36.4747 37.0 37.0 37.0 37.0 37.0 25-29 36.4348 37.0 37.0 37.0 37.0 37.0 30-34 36.450100000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.418400000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.4161 37.0 37.0 37.0 37.0 37.0 45-49 36.374399999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.3303 37.0 37.0 37.0 37.0 37.0 55-59 36.2629 37.0 37.0 37.0 37.0 37.0 60-64 36.3161 37.0 37.0 37.0 37.0 37.0 65-69 36.274100000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.2236 37.0 37.0 37.0 37.0 37.0 75-79 36.2053 37.0 37.0 37.0 37.0 37.0 80-84 36.147400000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.178200000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.147800000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.107600000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.0691 37.0 37.0 37.0 37.0 37.0 105-109 35.9962 37.0 37.0 37.0 37.0 37.0 110-114 35.997699999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.0014 37.0 37.0 37.0 37.0 37.0 120-124 35.967200000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.826 37.0 37.0 37.0 37.0 37.0 130-134 35.8197 37.0 37.0 37.0 37.0 37.0 135-139 35.7849 37.0 37.0 37.0 37.0 37.0 140-144 35.7254 37.0 37.0 37.0 37.0 37.0 145-149 35.6825 37.0 37.0 37.0 37.0 37.0 150-151 35.27225 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 3.0 25 1.0 26 7.0 27 11.0 28 17.0 29 25.0 30 26.0 31 42.0 32 55.0 33 86.0 34 146.0 35 335.0 36 2863.0 37 380.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.925 12.325 9.15 32.6 2 27.506876719179797 13.828457114278569 30.607651912978245 28.057014253563388 3 23.200000000000003 20.25 25.5 31.05 4 25.924999999999997 25.25 22.1 26.724999999999998 5 26.5 27.85 22.775000000000002 22.875 6 25.025 29.875 22.075 23.025000000000002 7 19.475 21.775 38.2 20.549999999999997 8 22.475 22.55 26.700000000000003 28.275 9 21.125 20.775 31.525 26.575 10-14 24.435000000000002 24.68 24.135 26.75 15-19 24.52 23.955000000000002 25.03 26.495 20-24 24.154999999999998 24.535 24.26 27.05 25-29 24.46 23.724999999999998 24.884999999999998 26.93 30-34 24.404999999999998 24.45 24.54 26.605 35-39 25.55 23.5 24.12 26.83 40-44 24.4 24.490000000000002 24.13 26.979999999999997 45-49 24.88 23.965 24.585 26.57 50-54 24.64 24.52 23.59 27.250000000000004 55-59 25.115 23.7 23.599999999999998 27.584999999999997 60-64 25.759999999999998 24.035 23.775 26.43 65-69 25.41 23.65 24.349999999999998 26.590000000000003 70-74 25.005 23.465 23.905 27.625 75-79 25.56 23.845 23.715 26.88 80-84 25.005 23.580000000000002 24.52 26.895000000000003 85-89 25.7 23.61 23.56 27.13 90-94 25.6 23.76 23.96 26.68 95-99 25.81 23.53 24.169999999999998 26.490000000000002 100-104 25.314999999999998 23.724999999999998 23.549999999999997 27.41 105-109 25.35 23.485 24.115000000000002 27.05 110-114 25.509999999999998 23.52 24.02 26.950000000000003 115-119 25.335 23.855 23.835 26.974999999999998 120-124 25.814999999999998 22.869999999999997 24.099999999999998 27.215 125-129 26.095000000000002 23.165 23.48 27.26 130-134 26.185000000000002 23.105 23.875 26.834999999999997 135-139 26.375 23.055 23.494999999999997 27.075 140-144 26.085 22.875 24.425 26.615 145-149 26.045 22.939999999999998 24.23 26.784999999999997 150-151 26.5875 22.912499999999998 23.4375 27.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 0.5 27 1.0 28 4.5 29 6.0 30 8.5 31 10.5 32 11.5 33 15.5 34 21.5 35 29.0 36 34.0 37 47.5 38 66.5 39 86.0 40 91.0 41 120.0 42 141.0 43 134.0 44 153.0 45 165.0 46 184.5 47 180.5 48 152.0 49 146.0 50 132.0 51 115.0 52 114.0 53 124.5 54 122.0 55 109.5 56 104.0 57 95.5 58 86.0 59 84.0 60 102.0 61 103.5 62 87.5 63 86.5 64 84.5 65 75.5 66 82.0 67 82.0 68 64.0 69 52.5 70 54.5 71 53.0 72 46.5 73 37.5 74 23.0 75 19.0 76 13.0 77 10.0 78 9.0 79 7.0 80 5.0 81 2.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.2 #Duplication Level Percentage of deduplicated Percentage of total 1 93.3744635193133 87.02499999999999 2 6.008583690987124 11.200000000000001 3 0.5633047210300429 1.575 4 0.0536480686695279 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.675 0.0 0.0 0.0 0.0 126-127 0.775 0.0 0.0 0.0 0.0 128-129 0.8374999999999999 0.0 0.0 0.0 0.0 130-131 0.9375 0.0 0.0 0.0 0.0 132-133 1.0625 0.0 0.0 0.0 0.0 134-135 1.1625 0.0 0.0 0.0 0.0 136-137 1.275 0.0 0.0 0.0 0.0 138-139 1.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTATTG 10 0.006830828 145.0 5 AATATTA 10 0.006830828 145.0 9 >>END_MODULE SRR7804128 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804128_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3275 37.0 37.0 37.0 37.0 37.0 2 36.0465 37.0 37.0 37.0 37.0 37.0 3 35.8745 37.0 37.0 37.0 37.0 37.0 4 36.0595 37.0 37.0 37.0 37.0 37.0 5 35.942 37.0 37.0 37.0 37.0 37.0 6 36.177 37.0 37.0 37.0 37.0 37.0 7 36.0755 37.0 37.0 37.0 37.0 37.0 8 36.138 37.0 37.0 37.0 37.0 37.0 9 35.88 37.0 37.0 37.0 37.0 37.0 10-14 36.1275 37.0 37.0 37.0 37.0 37.0 15-19 35.992200000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.0577 37.0 37.0 37.0 37.0 37.0 25-29 35.9544 37.0 37.0 37.0 37.0 37.0 30-34 35.92909999999999 37.0 37.0 37.0 37.0 37.0 35-39 35.9105 37.0 37.0 37.0 37.0 37.0 40-44 35.850300000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.798199999999994 37.0 37.0 37.0 37.0 37.0 50-54 35.7734 37.0 37.0 37.0 37.0 37.0 55-59 35.7031 37.0 37.0 37.0 37.0 37.0 60-64 35.723 37.0 37.0 37.0 37.0 37.0 65-69 35.6848 37.0 37.0 37.0 37.0 37.0 70-74 35.6872 37.0 37.0 37.0 37.0 37.0 75-79 35.681799999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.626000000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.6384 37.0 37.0 37.0 37.0 37.0 90-94 35.6612 37.0 37.0 37.0 37.0 37.0 95-99 35.5516 37.0 37.0 37.0 37.0 37.0 100-104 35.505100000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.3844 37.0 37.0 37.0 37.0 37.0 110-114 35.34439999999999 37.0 37.0 37.0 34.6 37.0 115-119 35.3243 37.0 37.0 37.0 34.6 37.0 120-124 35.3155 37.0 37.0 37.0 34.6 37.0 125-129 35.2658 37.0 37.0 37.0 37.0 37.0 130-134 35.295100000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.2046 37.0 37.0 37.0 32.2 37.0 140-144 35.1336 37.0 37.0 37.0 27.4 37.0 145-149 35.021699999999996 37.0 37.0 37.0 25.0 37.0 150-151 34.628 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 8.0 14 10.0 15 6.0 16 5.0 17 1.0 18 0.0 19 2.0 20 2.0 21 1.0 22 10.0 23 11.0 24 11.0 25 6.0 26 16.0 27 15.0 28 18.0 29 29.0 30 32.0 31 39.0 32 55.0 33 123.0 34 223.0 35 571.0 36 2573.0 37 230.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.075 18.2 10.35 30.375000000000004 2 31.974999999999998 21.675 24.075 22.275 3 25.775 23.525 26.35 24.349999999999998 4 28.199999999999996 29.299999999999997 18.675 23.825 5 27.075 31.45 19.0 22.475 6 24.825 32.275 18.425 24.474999999999998 7 24.7 19.375 30.775000000000002 25.15 8 25.6 22.675 20.849999999999998 30.875000000000004 9 25.275 22.5 22.725 29.5 10-14 27.089999999999996 24.93 21.325 26.655 15-19 27.065 23.990000000000002 22.07 26.875 20-24 27.455000000000002 23.74 22.52 26.284999999999997 25-29 27.74 24.015 21.36 26.884999999999998 30-34 27.305 24.365000000000002 21.73 26.6 35-39 27.18 23.915 21.82 27.084999999999997 40-44 27.63 24.175 22.035 26.16 45-49 27.339999999999996 23.775 21.634999999999998 27.250000000000004 50-54 27.615000000000002 24.245 21.605 26.534999999999997 55-59 27.93 22.919999999999998 22.18 26.97 60-64 27.855 23.755000000000003 21.86 26.529999999999998 65-69 27.235 23.995 22.175 26.595000000000002 70-74 27.400000000000002 23.395 21.9 27.305 75-79 27.084999999999997 24.19 21.89 26.834999999999997 80-84 27.634999999999998 23.580000000000002 22.085 26.700000000000003 85-89 27.474999999999998 23.665 22.37 26.490000000000002 90-94 27.305 22.85 22.74 27.105 95-99 27.57 23.669999999999998 21.945 26.815 100-104 27.57 23.525 22.115000000000002 26.790000000000003 105-109 27.075 24.165 22.61 26.150000000000002 110-114 27.845 23.875 22.09 26.19 115-119 27.76 23.745 21.82 26.674999999999997 120-124 27.345000000000002 24.05 22.285 26.32 125-129 28.194999999999997 24.099999999999998 22.105 25.6 130-134 28.389999999999997 24.15 21.535 25.924999999999997 135-139 27.57 23.895 22.795 25.740000000000002 140-144 27.725 24.375 22.264999999999997 25.635 145-149 27.6 24.23 22.145 26.025 150-151 27.762500000000003 23.3875 22.3375 26.5125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 1.0 10 1.0 11 1.5 12 1.0 13 0.5 14 0.5 15 0.0 16 1.0 17 2.0 18 1.5 19 1.0 20 1.5 21 1.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.0 27 1.5 28 3.5 29 4.0 30 2.0 31 2.0 32 5.5 33 14.0 34 16.0 35 13.0 36 22.0 37 33.0 38 43.5 39 58.0 40 65.0 41 81.5 42 117.5 43 139.0 44 137.5 45 139.0 46 129.0 47 128.0 48 137.0 49 133.5 50 141.0 51 135.5 52 116.0 53 109.0 54 120.5 55 119.5 56 101.0 57 101.5 58 115.5 59 111.5 60 109.0 61 105.5 62 106.5 63 117.5 64 108.0 65 96.5 66 89.0 67 91.0 68 92.5 69 84.0 70 72.5 71 62.5 72 58.0 73 47.5 74 31.5 75 24.5 76 18.0 77 15.0 78 14.5 79 6.0 80 3.0 81 4.0 82 3.5 83 2.5 84 2.0 85 1.5 86 1.0 87 0.5 88 0.5 89 0.0 90 0.0 91 1.0 92 1.5 93 0.5 94 0.5 95 0.5 96 0.0 97 1.5 98 1.5 99 0.0 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.9 #Duplication Level Percentage of deduplicated Percentage of total 1 93.46071044133477 86.825 2 5.785791173304629 10.75 3 0.5920344456404736 1.6500000000000001 4 0.13455328310010764 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026910656620021525 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0125 108-109 0.2 0.0 0.0 0.0 0.025 110-111 0.2375 0.0 0.0 0.0 0.025 112-113 0.2625 0.0 0.0 0.0 0.025 114-115 0.3 0.0 0.0 0.0 0.025 116-117 0.35 0.0 0.0 0.0 0.025 118-119 0.375 0.0 0.0 0.0 0.025 120-121 0.5 0.0 0.0 0.0 0.025 122-123 0.575 0.0 0.0 0.0 0.025 124-125 0.625 0.0 0.0 0.0 0.025 126-127 0.725 0.0 0.0 0.0 0.025 128-129 0.7875000000000001 0.0 0.0 0.0 0.025 130-131 0.8875 0.0 0.0 0.0 0.025 132-133 1.0125 0.0 0.0 0.0 0.025 134-135 1.1125 0.0 0.0 0.0 0.025 136-137 1.225 0.0 0.0 0.0 0.025 138-139 1.3875000000000002 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1477638 spots for SRR7804128.sra Written 1477638 spots for SRR7804128.sra Read 1477638 spots for SRR7804128.sra Written 1477638 spots for SRR7804128.sra Read 1477638 spots for SRR7804128.sra Written 1477638 spots for SRR7804128.sra Read 1477638 spots for SRR7804128.sra Written 1477638 spots for SRR7804128.sra Read 1477654 spots for SRR7804128.sra Written 1477654 spots for SRR7804128.sra Read 1477638 spots for SRR7804128.sra Written 1477638 spots for SRR7804128.sra Read 1477638 spots for SRR7804128.sra Written 1477638 spots for SRR7804128.sra Read 1477638 spots for SRR7804128.sra Written 1477638 spots for SRR7804128.sra Read 1477638 spots for SRR7804128.sra Written 1477638 spots for SRR7804128.sra Read 1477638 spots for SRR7804128.sra Written 1477638 spots for SRR7804128.sra Read 1477638 spots for SRR7804128.sra Written 1477638 spots for SRR7804128.sra Read 1477638 spots for SRR7804128.sra Written 1477638 spots for SRR7804128.sra Read 1477638 spots for SRR7804128.sra Written 1477638 spots for SRR7804128.sra Read 1477638 spots for SRR7804128.sra Written 1477638 spots for SRR7804128.sra Read 1477638 spots for SRR7804128.sra Written 1477638 spots for SRR7804128.sra Read 1477638 spots for SRR7804128.sra Written 1477638 spots for SRR7804128.sra Read 1477638 spots for SRR7804128.sra Written 1477638 spots for SRR7804128.sra Read 1477638 spots for SRR7804128.sra Written 1477638 spots for SRR7804128.sra Read 1477638 spots for SRR7804128.sra Written 1477638 spots for SRR7804128.sra Read 1477638 spots for SRR7804128.sra Written 1477638 spots for SRR7804128.sra SRR ids: ['SRR7804128.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f84s__zi SRR7804128.sra spots: 29552776 blocks: [[1, 1477638], [1477639, 2955276], [2955277, 4432914], [4432915, 5910552], [5910553, 7388190], [7388191, 8865828], [8865829, 10343466], [10343467, 11821104], [11821105, 13298742], [13298743, 14776380], [14776381, 16254018], [16254019, 17731656], [17731657, 19209294], [19209295, 20686932], [20686933, 22164570], [22164571, 23642208], [23642209, 25119846], [25119847, 26597484], [26597485, 28075122], [28075123, 29552776]] SRR7804128 file size 9992765 SRR7804128 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804128 SRR7804128_1.fastq SRR7804128_2.fastq Input file: SRR7804128_1.fastq Paired file: SRR7804128_2.fastq trimmed: SRR7804128-trimmed-pair1.fastq, SRR7804128-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 03:23:23 2024 >> started Thu Dec 12 03:23:57 2024 >> done (34.309s) 29552776 read pairs processed; of these: 76 ( 0.00%) short read pairs filtered out after trimming by size control 503 ( 0.00%) empty read pairs filtered out after trimming by size control 29552197 (100.00%) read pairs available; of these: 765674 ( 2.59%) trimmed read pairs available after processing 28786523 (97.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 13 0.00% 20 16 0.00% 21 8 0.00% 22 18 0.00% 23 18 0.00% 24 21 0.00% 25 15 0.00% 26 26 0.00% 27 24 0.00% 28 28 0.00% 29 33 0.00% 30 25 0.00% 31 20 0.00% 32 36 0.00% 33 30 0.00% 34 33 0.00% 35 29 0.00% 36 38 0.00% 37 30 0.00% 38 36 0.00% 39 28 0.00% 40 41 0.00% 41 39 0.00% 42 41 0.00% 43 50 0.00% 44 42 0.00% 45 55 0.00% 46 47 0.00% 47 46 0.00% 48 45 0.00% 49 51 0.00% 50 56 0.00% 51 52 0.00% 52 52 0.00% 53 62 0.00% 54 80 0.00% 55 69 0.00% 56 70 0.00% 57 78 0.00% 58 58 0.00% 59 79 0.00% 60 93 0.00% 61 68 0.00% 62 86 0.00% 63 90 0.00% 64 98 0.00% 65 106 0.00% 66 91 0.00% 67 123 0.00% 68 140 0.00% 69 133 0.00% 70 139 0.00% 71 151 0.00% 72 173 0.00% 73 188 0.00% 74 210 0.00% 75 214 0.00% 76 236 0.00% 77 266 0.00% 78 255 0.00% 79 313 0.00% 80 340 0.00% 81 401 0.00% 82 449 0.00% 83 515 0.00% 84 584 0.00% 85 652 0.00% 86 670 0.00% 87 709 0.00% 88 836 0.00% 89 885 0.00% 90 963 0.00% 91 1109 0.00% 92 1378 0.00% 93 1378 0.00% 94 1669 0.01% 95 1707 0.01% 96 1839 0.01% 97 2048 0.01% 98 2053 0.01% 99 2270 0.01% 100 2510 0.01% 101 2794 0.01% 102 3026 0.01% 103 3406 0.01% 104 3600 0.01% 105 3917 0.01% 106 4256 0.01% 107 4352 0.01% 108 4501 0.02% 109 4766 0.02% 110 4948 0.02% 111 5486 0.02% 112 6036 0.02% 113 6658 0.02% 114 7149 0.02% 115 7695 0.03% 116 7848 0.03% 117 8279 0.03% 118 8606 0.03% 119 9001 0.03% 120 9292 0.03% 121 9558 0.03% 122 10518 0.04% 123 11202 0.04% 124 11964 0.04% 125 12533 0.04% 126 13444 0.05% 127 13748 0.05% 128 14180 0.05% 129 14767 0.05% 130 15251 0.05% 131 15738 0.05% 132 16903 0.06% 133 17924 0.06% 134 18808 0.06% 135 20229 0.07% 136 20631 0.07% 137 21276 0.07% 138 21731 0.07% 139 22570 0.08% 140 23197 0.08% 141 23808 0.08% 142 25084 0.08% 143 26120 0.09% 144 28063 0.09% 145 29653 0.10% 146 30690 0.10% 147 31612 0.11% 148 32716 0.11% 149 32806 0.11% 150 33552 0.11% 151 28786523 97.41% 29552197 reads passed initial QC criterion=sequence-density sequence-density=1.11 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=26 prefix-density=1.16 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.24 sequence-density-rank=30 fanout-score=12.28 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=4.2 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=25 prefix-density=0.73 prefix-fanout=2.5 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCGGGCAGCCCGTGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=43.52 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.7 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804128 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 03:25:18 Started mapping on | Dec 12 03:25:18 Finished on | Dec 12 03:29:42 Mapping speed, Million of reads per hour | 402.98 Number of input reads | 29552197 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 27290614 Uniquely mapped reads % | 92.35% Average mapped length | 299.82 Number of splices: Total | 26213983 Number of splices: Annotated (sjdb) | 24828557 Number of splices: GT/AG | 25852197 Number of splices: GC/AG | 289288 Number of splices: AT/AC | 12104 Number of splices: Non-canonical | 60394 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 372615 % of reads mapped to multiple loci | 1.26% Number of reads mapped to too many loci | 30452 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.49% % of reads unmapped: other | 0.80% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1888968 1888968 1888968 N_multimapping 372615 372615 372615 N_noFeature 736418 26525845 948255 N_ambiguous 670528 4287 118234 UnstrandedReadsAssigned:25883668 PositiveStrandReadsAssigned:760482 NegativeStrandReadsAssigned:26224125 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804128 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804128-trimmed-pair1.fastq SRR7804128-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,552,197 reads, 26,495,051 reads pseudoaligned [quant] estimated average fragment length: 307.012 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52973 SRR7804128.ke.tsv 35125 SRR7804128.se.tsv 88098 total ==> SRR7804128.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 630.449 0 0 PNS24247 1044 737.988 59.2307 3.85077 PNS24249 1928 1621.99 151.772 4.48947 PNS24246 1044 737.988 59.2307 3.85077 PNS24248 1044 737.988 59.2307 3.85077 PNS24244 1471 1164.99 88.5354 3.64624 PNS24243 293 72.5583 0 0 KQK14069 1603 1296.99 6828.85 252.616 KQK14071 474 198.907 48.7864 11.7679 ==> SRR7804128.se.tsv <== BRADI_1g14170v3 7033 BRADI_1g53295v3 3261 BRADI_1g59795v3 272 BRADI_1g07683v3 0 BRADI_1g00485v3 67 BRADI_1g20270v3 1989 BRADI_1g74790v3 486 BRADI_1g09890v3 17 BRADI_1g77505v3 297 BRADI_1g48960v3 0 SRR7804128 completed mapping pipeline successfully