Starting /dee2/code/volunteer_pipeline.sh SRR7804129 current disk space = 1525401759744 free memory = 1561009464 SRR7804129 SRAfilesize ddf361916e37b3466ec0028510c61667 SRR7804129.sra SRR7804129.sra file validated SRR7804129 is paired end SRR7804129 is conventional basespace SRR7804129 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804129_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.211 37.0 37.0 37.0 37.0 37.0 2 36.2175 37.0 37.0 37.0 37.0 37.0 3 36.3445 37.0 37.0 37.0 37.0 37.0 4 36.5015 37.0 37.0 37.0 37.0 37.0 5 36.5615 37.0 37.0 37.0 37.0 37.0 6 36.478 37.0 37.0 37.0 37.0 37.0 7 36.33 37.0 37.0 37.0 37.0 37.0 8 36.2945 37.0 37.0 37.0 37.0 37.0 9 36.4205 37.0 37.0 37.0 37.0 37.0 10-14 36.491 37.0 37.0 37.0 37.0 37.0 15-19 36.458 37.0 37.0 37.0 37.0 37.0 20-24 36.4557 37.0 37.0 37.0 37.0 37.0 25-29 36.418099999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.4015 37.0 37.0 37.0 37.0 37.0 35-39 36.3663 37.0 37.0 37.0 37.0 37.0 40-44 36.3858 37.0 37.0 37.0 37.0 37.0 45-49 36.378499999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.3709 37.0 37.0 37.0 37.0 37.0 55-59 36.3682 37.0 37.0 37.0 37.0 37.0 60-64 36.3043 37.0 37.0 37.0 37.0 37.0 65-69 36.2638 37.0 37.0 37.0 37.0 37.0 70-74 36.2282 37.0 37.0 37.0 37.0 37.0 75-79 36.200300000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.196000000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.155499999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.1349 37.0 37.0 37.0 37.0 37.0 95-99 36.0905 37.0 37.0 37.0 37.0 37.0 100-104 36.1206 37.0 37.0 37.0 37.0 37.0 105-109 36.067 37.0 37.0 37.0 37.0 37.0 110-114 36.014599999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.9919 37.0 37.0 37.0 37.0 37.0 120-124 36.010999999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.896699999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.801 37.0 37.0 37.0 37.0 37.0 135-139 35.796499999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.745999999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.6942 37.0 37.0 37.0 37.0 37.0 150-151 35.2805 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 1.0 25 2.0 26 8.0 27 7.0 28 9.0 29 26.0 30 35.0 31 40.0 32 55.0 33 102.0 34 146.0 35 354.0 36 2834.0 37 380.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.5 12.65 8.674999999999999 32.175 2 27.37737737737738 14.814814814814813 29.354354354354356 28.453453453453452 3 23.45 22.55 26.025 27.975 4 25.900000000000002 25.025 22.5 26.575 5 26.55 27.750000000000004 21.375 24.325 6 24.125 31.874999999999996 20.575 23.425 7 19.1 24.525 37.1 19.275000000000002 8 22.1 22.225 26.700000000000003 28.975 9 21.675 21.725 30.275000000000002 26.325 10-14 24.224999999999998 25.369999999999997 23.755000000000003 26.650000000000002 15-19 24.14 24.785 25.074999999999996 26.0 20-24 24.005000000000003 24.625 25.035 26.334999999999997 25-29 24.315 24.685000000000002 24.735 26.265 30-34 23.57 24.46 24.834999999999997 27.134999999999998 35-39 24.560000000000002 24.82 24.285 26.334999999999997 40-44 24.84 24.065 24.709999999999997 26.384999999999998 45-49 24.349999999999998 24.385 24.560000000000002 26.705000000000002 50-54 24.33 24.610000000000003 24.275 26.784999999999997 55-59 25.295 24.145 23.72 26.840000000000003 60-64 25.25 24.3 24.42 26.029999999999998 65-69 24.66 24.205 24.795 26.340000000000003 70-74 24.89 24.310000000000002 24.185000000000002 26.615 75-79 24.97 23.895 24.305 26.83 80-84 24.81 23.73 24.335 27.125 85-89 24.665 24.16 24.39 26.784999999999997 90-94 25.419999999999998 24.03 24.18 26.369999999999997 95-99 24.65 24.065 24.41 26.875 100-104 25.319999999999997 23.79 23.89 27.0 105-109 25.115 24.18 24.08 26.625 110-114 24.895 24.66 23.580000000000002 26.865 115-119 25.21 24.044999999999998 24.349999999999998 26.395000000000003 120-124 25.115 24.15 23.66 27.075 125-129 25.39 23.77 23.98 26.86 130-134 26.06 23.5 23.385 27.055 135-139 25.45 24.07 23.685000000000002 26.795 140-144 25.655 24.15 23.69 26.505000000000003 145-149 25.275 23.46 23.98 27.284999999999997 150-151 25.0625 23.974999999999998 23.75 27.212500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 3.0 28 4.0 29 4.0 30 7.0 31 10.0 32 9.5 33 14.5 34 21.0 35 27.5 36 39.5 37 46.5 38 65.5 39 88.5 40 104.5 41 124.5 42 142.0 43 164.0 44 176.5 45 169.0 46 169.5 47 167.5 48 165.5 49 162.5 50 157.0 51 159.0 52 139.5 53 127.0 54 125.0 55 114.0 56 104.0 57 91.5 58 86.0 59 83.0 60 75.0 61 75.0 62 78.5 63 74.0 64 65.5 65 64.0 66 59.5 67 55.0 68 55.5 69 51.0 70 52.0 71 48.0 72 41.0 73 36.0 74 27.0 75 20.0 76 16.0 77 11.5 78 8.5 79 5.0 80 2.5 81 2.5 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.85 #Duplication Level Percentage of deduplicated Percentage of total 1 92.99946149703824 86.35000000000001 2 6.381260096930533 11.85 3 0.5654281098546041 1.575 4 0.026925148088314487 0.1 5 0.026925148088314487 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTGCTGACTCCATACCAATCTCTCCAGCAAGTCCAAAGATGGCAAGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.7250000000000001 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 0.9750000000000001 0.0 0.0 0.0 0.0 126-127 1.0875 0.0 0.0 0.0 0.0 128-129 1.3125 0.0 0.0 0.0 0.0 130-131 1.5 0.0 0.0 0.0 0.0 132-133 1.8 0.0 0.0 0.0 0.0 134-135 2.1624999999999996 0.0 0.0 0.0 0.0 136-137 2.3375000000000004 0.0 0.0 0.0 0.0 138-139 2.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGTAT 10 0.006830828 145.0 3 >>END_MODULE SRR7804129 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804129_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.31675 37.0 37.0 37.0 37.0 37.0 2 36.189 37.0 37.0 37.0 37.0 37.0 3 36.243 37.0 37.0 37.0 37.0 37.0 4 36.242 37.0 37.0 37.0 37.0 37.0 5 36.2035 37.0 37.0 37.0 37.0 37.0 6 36.2265 37.0 37.0 37.0 37.0 37.0 7 36.084 37.0 37.0 37.0 37.0 37.0 8 36.2975 37.0 37.0 37.0 37.0 37.0 9 36.073 37.0 37.0 37.0 37.0 37.0 10-14 36.1419 37.0 37.0 37.0 37.0 37.0 15-19 36.0822 37.0 37.0 37.0 37.0 37.0 20-24 36.1199 37.0 37.0 37.0 37.0 37.0 25-29 36.04299999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.0188 37.0 37.0 37.0 37.0 37.0 35-39 35.9304 37.0 37.0 37.0 37.0 37.0 40-44 35.96339999999999 37.0 37.0 37.0 37.0 37.0 45-49 35.8817 37.0 37.0 37.0 37.0 37.0 50-54 35.85629999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.771699999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.8604 37.0 37.0 37.0 37.0 37.0 65-69 35.750699999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.70620000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.7367 37.0 37.0 37.0 37.0 37.0 80-84 35.6657 37.0 37.0 37.0 37.0 37.0 85-89 35.7386 37.0 37.0 37.0 37.0 37.0 90-94 35.6673 37.0 37.0 37.0 37.0 37.0 95-99 35.658300000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.6582 37.0 37.0 37.0 37.0 37.0 105-109 35.5746 37.0 37.0 37.0 37.0 37.0 110-114 35.501400000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.4951 37.0 37.0 37.0 37.0 37.0 120-124 35.423300000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.3755 37.0 37.0 37.0 34.6 37.0 130-134 35.36030000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.3135 37.0 37.0 37.0 34.6 37.0 140-144 35.32809999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.0838 37.0 37.0 37.0 27.4 37.0 150-151 34.591499999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 10.0 15 3.0 16 5.0 17 5.0 18 2.0 19 5.0 20 4.0 21 7.0 22 11.0 23 8.0 24 12.0 25 10.0 26 8.0 27 13.0 28 16.0 29 14.0 30 29.0 31 33.0 32 59.0 33 115.0 34 177.0 35 517.0 36 2666.0 37 268.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.43535883970993 19.654913728432106 10.05251312828207 28.857214303575894 2 31.825 21.825 23.075000000000003 23.275000000000002 3 24.075 26.450000000000003 25.624999999999996 23.849999999999998 4 27.575 29.475 18.875 24.075 5 27.1 32.0 18.075 22.825 6 25.6 31.724999999999998 18.75 23.925 7 22.775000000000002 19.125 32.300000000000004 25.8 8 24.9 22.2 21.099999999999998 31.8 9 24.099999999999998 21.575 25.0 29.325000000000003 10-14 26.474999999999998 24.55 21.48 27.495000000000005 15-19 26.340000000000003 24.349999999999998 22.675 26.634999999999998 20-24 26.82 24.615000000000002 22.46 26.105 25-29 26.3 24.38 22.805 26.515 30-34 26.640000000000004 23.73 22.884999999999998 26.745 35-39 27.295 23.97 22.335 26.400000000000002 40-44 26.745 24.29 22.66 26.305 45-49 26.68 23.965 22.915 26.44 50-54 26.68 24.115000000000002 22.615 26.590000000000003 55-59 26.729999999999997 24.585 22.634999999999998 26.05 60-64 26.56 24.52 22.23 26.69 65-69 27.115000000000002 24.215 22.835 25.835 70-74 27.07 24.32 23.23 25.380000000000003 75-79 26.834999999999997 24.505 22.795 25.865 80-84 27.694999999999997 24.474999999999998 22.425 25.405 85-89 27.08 25.069999999999997 22.045 25.805 90-94 27.48 24.385 22.46 25.674999999999997 95-99 27.105 24.65 22.884999999999998 25.36 100-104 27.1 24.41 22.71 25.779999999999998 105-109 27.284999999999997 24.915000000000003 22.405 25.395 110-114 27.500000000000004 24.08 22.85 25.569999999999997 115-119 27.255000000000003 24.529999999999998 23.175 25.040000000000003 120-124 27.79 24.595 22.68 24.935 125-129 26.91 24.625 23.1 25.365 130-134 27.944999999999997 24.55 22.645 24.86 135-139 27.015 24.404999999999998 23.1 25.480000000000004 140-144 27.639999999999997 24.525 22.39 25.445 145-149 26.924999999999997 24.875 23.380000000000003 24.82 150-151 27.725 25.162499999999998 21.9375 25.174999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 1.0 13 1.0 14 2.0 15 3.0 16 2.5 17 1.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 0.5 25 1.5 26 3.0 27 3.0 28 2.0 29 2.5 30 3.5 31 3.5 32 5.0 33 7.0 34 9.0 35 18.5 36 24.5 37 32.0 38 48.0 39 65.0 40 78.0 41 93.5 42 125.0 43 144.0 44 144.0 45 155.5 46 176.5 47 167.0 48 159.0 49 161.0 50 141.0 51 134.0 52 148.5 53 148.5 54 126.0 55 108.5 56 104.0 57 92.5 58 91.0 59 91.0 60 83.5 61 91.5 62 84.5 63 72.0 64 76.5 65 88.0 66 93.5 67 87.5 68 77.5 69 71.0 70 65.0 71 55.5 72 49.5 73 39.0 74 30.0 75 23.5 76 15.5 77 12.0 78 8.5 79 6.0 80 4.5 81 3.5 82 3.0 83 3.0 84 1.0 85 0.0 86 0.5 87 1.5 88 2.0 89 1.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.5 95 1.0 96 0.5 97 0.5 98 0.5 99 0.5 100 6.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.85 #Duplication Level Percentage of deduplicated Percentage of total 1 93.37641357027464 86.7 2 6.00430802369413 11.15 3 0.5115778136779752 1.425 4 0.026925148088314487 0.1 5 0.026925148088314487 0.125 6 0.026925148088314487 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026925148088314487 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 14 0.35000000000000003 No Hit GCTCATCATCTTGTTCAATCCCAAAGCTCTTCTTCTTCTCCTCCTTGATT 6 0.15 No Hit GCAGTATCCGGTGCTGTAGATTTCATCACCGATGGGAAGCAGGTCATTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.5874999999999999 0.0 0.0 0.0 0.0 118-119 0.65 0.0 0.0 0.0 0.0 120-121 0.7749999999999999 0.0 0.0 0.0 0.0 122-123 0.875 0.0 0.0 0.0 0.0 124-125 1.025 0.0 0.0 0.0 0.0 126-127 1.1375000000000002 0.0 0.0 0.0 0.0 128-129 1.3625 0.0 0.0 0.0 0.0 130-131 1.55 0.0 0.0 0.0 0.0 132-133 1.85 0.0 0.0 0.0 0.0 134-135 2.225 0.0 0.0 0.0 0.0 136-137 2.4124999999999996 0.0 0.0 0.0 0.0 138-139 2.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCGAA 10 0.006830828 145.0 5 >>END_MODULE Read 1460635 spots for SRR7804129.sra Written 1460635 spots for SRR7804129.sra Read 1460635 spots for SRR7804129.sra Written 1460635 spots for SRR7804129.sra Read 1460635 spots for SRR7804129.sra Written 1460635 spots for SRR7804129.sra Read 1460637 spots for SRR7804129.sra Written 1460637 spots for SRR7804129.sra Read 1460635 spots for SRR7804129.sra Written 1460635 spots for SRR7804129.sra Read 1460635 spots for SRR7804129.sra Written 1460635 spots for SRR7804129.sra Read 1460635 spots for SRR7804129.sra Written 1460635 spots for SRR7804129.sra Read 1460635 spots for SRR7804129.sra Written 1460635 spots for SRR7804129.sra Read 1460635 spots for SRR7804129.sra Written 1460635 spots for SRR7804129.sra Read 1460635 spots for SRR7804129.sra Written 1460635 spots for SRR7804129.sra Read 1460635 spots for SRR7804129.sra Written 1460635 spots for SRR7804129.sra Read 1460635 spots for SRR7804129.sra Written 1460635 spots for SRR7804129.sra Read 1460635 spots for SRR7804129.sra Written 1460635 spots for SRR7804129.sra Read 1460635 spots for SRR7804129.sra Written 1460635 spots for SRR7804129.sra Read 1460635 spots for SRR7804129.sra Written 1460635 spots for SRR7804129.sra Read 1460635 spots for SRR7804129.sra Written 1460635 spots for SRR7804129.sra Read 1460635 spots for SRR7804129.sra Written 1460635 spots for SRR7804129.sra Read 1460635 spots for SRR7804129.sra Written 1460635 spots for SRR7804129.sra Read 1460635 spots for SRR7804129.sra Written 1460635 spots for SRR7804129.sra Read 1460635 spots for SRR7804129.sra Written 1460635 spots for SRR7804129.sra SRR ids: ['SRR7804129.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vkyrrubc SRR7804129.sra spots: 29212702 blocks: [[1, 1460635], [1460636, 2921270], [2921271, 4381905], [4381906, 5842540], [5842541, 7303175], [7303176, 8763810], [8763811, 10224445], [10224446, 11685080], [11685081, 13145715], [13145716, 14606350], [14606351, 16066985], [16066986, 17527620], [17527621, 18988255], [18988256, 20448890], [20448891, 21909525], [21909526, 23370160], [23370161, 24830795], [24830796, 26291430], [26291431, 27752065], [27752066, 29212702]] SRR7804129 file size 9877525 SRR7804129 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804129 SRR7804129_1.fastq SRR7804129_2.fastq Input file: SRR7804129_1.fastq Paired file: SRR7804129_2.fastq trimmed: SRR7804129-trimmed-pair1.fastq, SRR7804129-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:17:36 2024 >> started Tue Dec 10 02:18:40 2024 >> done (64.135s) 29212702 read pairs processed; of these: 107 ( 0.00%) short read pairs filtered out after trimming by size control 708 ( 0.00%) empty read pairs filtered out after trimming by size control 29211887 (100.00%) read pairs available; of these: 1065892 ( 3.65%) trimmed read pairs available after processing 28145995 (96.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 13 0.00% 20 11 0.00% 21 9 0.00% 22 30 0.00% 23 20 0.00% 24 20 0.00% 25 22 0.00% 26 21 0.00% 27 22 0.00% 28 40 0.00% 29 30 0.00% 30 26 0.00% 31 32 0.00% 32 32 0.00% 33 30 0.00% 34 29 0.00% 35 36 0.00% 36 43 0.00% 37 39 0.00% 38 47 0.00% 39 38 0.00% 40 36 0.00% 41 45 0.00% 42 60 0.00% 43 57 0.00% 44 50 0.00% 45 54 0.00% 46 65 0.00% 47 55 0.00% 48 51 0.00% 49 59 0.00% 50 68 0.00% 51 64 0.00% 52 74 0.00% 53 86 0.00% 54 60 0.00% 55 63 0.00% 56 77 0.00% 57 69 0.00% 58 66 0.00% 59 84 0.00% 60 97 0.00% 61 97 0.00% 62 96 0.00% 63 92 0.00% 64 102 0.00% 65 115 0.00% 66 127 0.00% 67 123 0.00% 68 151 0.00% 69 143 0.00% 70 152 0.00% 71 155 0.00% 72 181 0.00% 73 220 0.00% 74 214 0.00% 75 249 0.00% 76 274 0.00% 77 303 0.00% 78 392 0.00% 79 350 0.00% 80 394 0.00% 81 456 0.00% 82 553 0.00% 83 630 0.00% 84 695 0.00% 85 746 0.00% 86 860 0.00% 87 918 0.00% 88 1004 0.00% 89 1124 0.00% 90 1214 0.00% 91 1488 0.01% 92 1633 0.01% 93 1818 0.01% 94 2112 0.01% 95 2246 0.01% 96 2374 0.01% 97 2662 0.01% 98 2796 0.01% 99 3159 0.01% 100 3471 0.01% 101 3655 0.01% 102 4134 0.01% 103 4655 0.02% 104 5063 0.02% 105 5498 0.02% 106 5765 0.02% 107 6197 0.02% 108 6376 0.02% 109 6805 0.02% 110 7377 0.03% 111 7797 0.03% 112 8508 0.03% 113 9234 0.03% 114 10174 0.03% 115 10672 0.04% 116 11366 0.04% 117 11635 0.04% 118 12025 0.04% 119 12579 0.04% 120 13356 0.05% 121 14178 0.05% 122 14979 0.05% 123 16002 0.05% 124 17416 0.06% 125 18060 0.06% 126 18918 0.06% 127 19742 0.07% 128 20194 0.07% 129 21054 0.07% 130 21555 0.07% 131 22844 0.08% 132 23895 0.08% 133 25597 0.09% 134 26931 0.09% 135 28243 0.10% 136 28864 0.10% 137 29633 0.10% 138 30800 0.11% 139 31758 0.11% 140 31973 0.11% 141 33559 0.11% 142 35007 0.12% 143 36309 0.12% 144 38551 0.13% 145 40086 0.14% 146 42006 0.14% 147 42978 0.15% 148 43710 0.15% 149 44782 0.15% 150 45566 0.16% 151 28145995 96.35% 29211887 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=34 prefix-density=0.31 prefix-fanout=2.0 sequence=GCAAGACATCTTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=173.28 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=21.6 sequence=GCAGCAGCAGCA criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=32 prefix-density=0.99 prefix-fanout=2.2 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=887.25 fanout-score-rank=1 prefix-density=1.09 prefix-fanout=21.8 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR7804129 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Dec 10 02:37:36 Started mapping on | Dec 10 02:37:39 Finished on | Dec 10 02:41:34 Mapping speed, Million of reads per hour | 447.49 Number of input reads | 29211370 Average input read length | 280 UNIQUE READS: Uniquely mapped reads number | 25117322 Uniquely mapped reads % | 85.98% Average mapped length | 279.31 Number of splices: Total | 23953508 Number of splices: Annotated (sjdb) | 22424714 Number of splices: GT/AG | 23607666 Number of splices: GC/AG | 260374 Number of splices: AT/AC | 19049 Number of splices: Non-canonical | 66419 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 377503 % of reads mapped to multiple loci | 1.29% Number of reads mapped to too many loci | 22280 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.24% % of reads unmapped: other | 0.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3716582 3716582 3716582 N_multimapping 377503 377503 377503 N_noFeature 505629 24400290 731501 N_ambiguous 603108 4546 113159 UnstrandedReadsAssigned:24008585 PositiveStrandReadsAssigned:712486 NegativeStrandReadsAssigned:24272662 Dataset is classified negative stranded MeadianReadLen=131 20thPercentileLength=131 echo kmer=127 SRR7804129 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804129-trimmed-pair1.fastq SRR7804129-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,211,370 reads, 26,145,219 reads pseudoaligned [quant] estimated average fragment length: 278.031 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52973 SRR7804129.ke.tsv 35125 SRR7804129.se.tsv 88098 total ==> SRR7804129.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 659.588 0 0 PNS24247 1044 766.969 122.827 8.04824 PNS24249 1928 1650.97 374.406 11.397 PNS24246 1044 766.969 122.827 8.04824 PNS24248 1044 766.969 122.827 8.04824 PNS24244 1471 1193.97 76.113 3.20369 PNS24243 293 90.4774 0 0 KQK14069 1603 1325.97 18284.4 692.999 KQK14071 474 222.281 158.47 35.8286 ==> SRR7804129.se.tsv <== BRADI_1g14170v3 17431 BRADI_1g53295v3 1130 BRADI_1g59795v3 167 BRADI_1g07683v3 0 BRADI_1g00485v3 64 BRADI_1g20270v3 1009 BRADI_1g74790v3 50 BRADI_1g09890v3 0 BRADI_1g77505v3 399 BRADI_1g48960v3 0 SRR7804129 completed mapping pipeline successfully