Starting /dee2/code/volunteer_pipeline.sh SRR7804130 current disk space = 1541420605440 free memory = 1426795264 SRR7804130 SRAfilesize 355a94a0234cbde69032565dc3e3baee SRR7804130.sra SRR7804130.sra file validated SRR7804130 is paired end SRR7804130 is conventional basespace SRR7804130 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804130_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.311 37.0 37.0 37.0 37.0 37.0 2 36.33725 37.0 37.0 37.0 37.0 37.0 3 36.4085 37.0 37.0 37.0 37.0 37.0 4 36.4425 37.0 37.0 37.0 37.0 37.0 5 36.653 37.0 37.0 37.0 37.0 37.0 6 36.491 37.0 37.0 37.0 37.0 37.0 7 36.5055 37.0 37.0 37.0 37.0 37.0 8 36.498 37.0 37.0 37.0 37.0 37.0 9 36.5615 37.0 37.0 37.0 37.0 37.0 10-14 36.5704 37.0 37.0 37.0 37.0 37.0 15-19 36.5204 37.0 37.0 37.0 37.0 37.0 20-24 36.525099999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.460300000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.459 37.0 37.0 37.0 37.0 37.0 35-39 36.4385 37.0 37.0 37.0 37.0 37.0 40-44 36.449200000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.4113 37.0 37.0 37.0 37.0 37.0 50-54 36.3838 37.0 37.0 37.0 37.0 37.0 55-59 36.3642 37.0 37.0 37.0 37.0 37.0 60-64 36.3735 37.0 37.0 37.0 37.0 37.0 65-69 36.37339999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.2383 37.0 37.0 37.0 37.0 37.0 75-79 36.2941 37.0 37.0 37.0 37.0 37.0 80-84 36.1714 37.0 37.0 37.0 37.0 37.0 85-89 36.2197 37.0 37.0 37.0 37.0 37.0 90-94 36.2074 37.0 37.0 37.0 37.0 37.0 95-99 36.147800000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.1613 37.0 37.0 37.0 37.0 37.0 105-109 36.0801 37.0 37.0 37.0 37.0 37.0 110-114 36.0614 37.0 37.0 37.0 37.0 37.0 115-119 36.0752 37.0 37.0 37.0 37.0 37.0 120-124 35.9726 37.0 37.0 37.0 37.0 37.0 125-129 35.9625 37.0 37.0 37.0 37.0 37.0 130-134 35.8592 37.0 37.0 37.0 37.0 37.0 135-139 35.8731 37.0 37.0 37.0 37.0 37.0 140-144 35.767 37.0 37.0 37.0 37.0 37.0 145-149 35.733000000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.338499999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 3.0 26 6.0 27 6.0 28 12.0 29 20.0 30 29.0 31 47.0 32 67.0 33 88.0 34 121.0 35 305.0 36 2842.0 37 453.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.175000000000004 13.025 10.299999999999999 33.5 2 26.294721040780583 13.284963722792096 28.34625969477108 32.07405554165624 3 22.650000000000002 16.3 22.575 38.475 4 26.775 21.8 20.025000000000002 31.4 5 26.974999999999998 25.8 21.95 25.275 6 24.625 28.599999999999998 22.05 24.725 7 19.15 25.05 35.275 20.525 8 20.125 24.75 28.525 26.6 9 21.075 20.724999999999998 31.374999999999996 26.825 10-14 23.599999999999998 25.045 24.81 26.545 15-19 24.085 24.27 25.019999999999996 26.625 20-24 23.835 24.68 24.815 26.669999999999998 25-29 24.005000000000003 24.25 24.23 27.515 30-34 24.05 24.085 24.67 27.195000000000004 35-39 24.145 24.595 24.6 26.66 40-44 24.13 24.4 24.735 26.735 45-49 23.84 24.735 24.07 27.355 50-54 24.205 24.335 24.099999999999998 27.36 55-59 24.12 23.810000000000002 24.9 27.169999999999998 60-64 24.615000000000002 23.825 24.16 27.400000000000002 65-69 24.39 23.294999999999998 24.395 27.92 70-74 24.224999999999998 24.355 24.545 26.875 75-79 24.4 23.845 24.104999999999997 27.650000000000002 80-84 24.654999999999998 23.86 24.085 27.400000000000002 85-89 25.635 23.265 24.385 26.715 90-94 24.52 24.005000000000003 23.9 27.575 95-99 25.650000000000002 23.845 23.645 26.86 100-104 25.235000000000003 24.025 23.865 26.875 105-109 25.31 23.45 23.765 27.474999999999998 110-114 25.080000000000002 23.9 23.57 27.450000000000003 115-119 25.355 23.45 23.71 27.485 120-124 25.240000000000002 23.805 24.08 26.875 125-129 25.31 23.935000000000002 23.995 26.76 130-134 26.0 23.395 23.3 27.305 135-139 24.85 23.974999999999998 23.49 27.685 140-144 25.105 23.599999999999998 23.919999999999998 27.375 145-149 25.380000000000003 23.585 23.3 27.735 150-151 25.8125 23.45 22.900000000000002 27.8375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.5 28 1.5 29 3.5 30 4.5 31 5.5 32 13.5 33 20.0 34 23.5 35 33.0 36 46.0 37 54.0 38 62.5 39 78.5 40 97.0 41 122.0 42 140.5 43 146.0 44 145.0 45 155.0 46 171.5 47 166.5 48 162.0 49 154.0 50 145.0 51 142.0 52 149.0 53 136.5 54 113.5 55 110.0 56 111.0 57 104.0 58 91.5 59 95.0 60 94.5 61 87.0 62 72.5 63 74.0 64 75.5 65 71.5 66 74.0 67 69.0 68 64.0 69 57.5 70 51.5 71 42.5 72 35.5 73 28.5 74 22.0 75 19.5 76 15.0 77 16.0 78 12.5 79 6.5 80 4.0 81 1.0 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.95 #Duplication Level Percentage of deduplicated Percentage of total 1 92.00652528548125 84.6 2 7.313757476889614 13.450000000000001 3 0.5981511691136487 1.6500000000000001 4 0.08156606851549755 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.5375000000000001 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.8 0.0 0.0 0.0 0.0 124-125 0.9624999999999999 0.0 0.0 0.0 0.0 126-127 1.1 0.0 0.0 0.0 0.0 128-129 1.2125 0.0 0.0 0.0 0.0 130-131 1.325 0.0 0.0 0.0 0.0 132-133 1.4375 0.0 0.0 0.0 0.0 134-135 1.6 0.0 0.0 0.0 0.0 136-137 1.8125 0.0 0.0 0.0 0.0 138-139 2.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCATTT 10 0.006830828 145.0 3 GGGTCAT 10 0.006830828 145.0 1 TTGCTTT 10 0.006830828 145.0 7 >>END_MODULE SRR7804130 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804130_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.20775 37.0 37.0 37.0 37.0 37.0 2 36.12 37.0 37.0 37.0 37.0 37.0 3 36.068 37.0 37.0 37.0 37.0 37.0 4 36.275 37.0 37.0 37.0 37.0 37.0 5 36.1455 37.0 37.0 37.0 37.0 37.0 6 36.1595 37.0 37.0 37.0 37.0 37.0 7 36.0785 37.0 37.0 37.0 37.0 37.0 8 36.134 37.0 37.0 37.0 37.0 37.0 9 36.076 37.0 37.0 37.0 37.0 37.0 10-14 36.19619999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.0587 37.0 37.0 37.0 37.0 37.0 20-24 36.0858 37.0 37.0 37.0 37.0 37.0 25-29 36.0299 37.0 37.0 37.0 37.0 37.0 30-34 35.9972 37.0 37.0 37.0 37.0 37.0 35-39 35.9885 37.0 37.0 37.0 37.0 37.0 40-44 35.8948 37.0 37.0 37.0 37.0 37.0 45-49 35.88719999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.8085 37.0 37.0 37.0 37.0 37.0 55-59 35.7878 37.0 37.0 37.0 37.0 37.0 60-64 35.8073 37.0 37.0 37.0 37.0 37.0 65-69 35.8148 37.0 37.0 37.0 37.0 37.0 70-74 35.7351 37.0 37.0 37.0 37.0 37.0 75-79 35.6611 37.0 37.0 37.0 37.0 37.0 80-84 35.672000000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.6907 37.0 37.0 37.0 37.0 37.0 90-94 35.643600000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.5778 37.0 37.0 37.0 37.0 37.0 100-104 35.612199999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.55069999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.470000000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.4039 37.0 37.0 37.0 37.0 37.0 120-124 35.398199999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.37179999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.3403 37.0 37.0 37.0 37.0 37.0 135-139 35.214999999999996 37.0 37.0 37.0 32.2 37.0 140-144 35.2413 37.0 37.0 37.0 34.6 37.0 145-149 35.0661 37.0 37.0 37.0 25.0 37.0 150-151 34.553250000000006 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 5.0 14 6.0 15 4.0 16 5.0 17 5.0 18 3.0 19 4.0 20 2.0 21 4.0 22 6.0 23 7.0 24 9.0 25 4.0 26 11.0 27 5.0 28 19.0 29 31.0 30 21.0 31 53.0 32 69.0 33 99.0 34 197.0 35 572.0 36 2635.0 37 221.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.98474618654664 18.0545136284071 11.927981995498875 31.032758189547387 2 32.425 21.099999999999998 23.075000000000003 23.400000000000002 3 26.424999999999997 24.7 24.175 24.7 4 27.0 28.775000000000002 19.575 24.65 5 28.9 29.25 19.075 22.775000000000002 6 25.75 33.375 18.75 22.125 7 25.324999999999996 19.625 30.15 24.9 8 26.224999999999998 20.3 22.35 31.125000000000004 9 26.525 22.25 24.349999999999998 26.875 10-14 27.744999999999997 24.16 21.72 26.375 15-19 26.779999999999998 24.65 22.625 25.945 20-24 27.055 24.275 22.650000000000002 26.02 25-29 27.18 24.055 22.825 25.94 30-34 26.765 24.67 22.475 26.090000000000003 35-39 27.265 24.0 22.58 26.155 40-44 27.735 24.825 21.775 25.665 45-49 27.12 23.865 23.24 25.775 50-54 27.92 23.79 22.400000000000002 25.89 55-59 28.225 23.97 22.36 25.445 60-64 27.76 24.349999999999998 22.05 25.840000000000003 65-69 27.715 24.115000000000002 22.835 25.335 70-74 28.325 24.075 22.11 25.490000000000002 75-79 27.529999999999998 24.195 22.82 25.455 80-84 28.655 24.16 22.73 24.455 85-89 28.42 24.0 21.675 25.905 90-94 27.560000000000002 23.585 23.14 25.715 95-99 28.544999999999998 23.62 22.15 25.685000000000002 100-104 28.33 24.185000000000002 22.395 25.09 105-109 28.43 23.685000000000002 22.865 25.019999999999996 110-114 28.27 24.07 22.88 24.779999999999998 115-119 27.975 24.095 22.55 25.380000000000003 120-124 27.32 24.905 22.95 24.825 125-129 27.93 23.935000000000002 22.720000000000002 25.415 130-134 28.055000000000003 24.154999999999998 22.655 25.135 135-139 27.525 24.64 22.939999999999998 24.895 140-144 27.650000000000002 24.48 23.14 24.73 145-149 28.525 24.535 22.875 24.065 150-151 27.8125 24.05 23.5 24.637500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 1.5 16 1.5 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 0.5 23 0.5 24 1.0 25 1.0 26 1.0 27 1.5 28 2.5 29 3.5 30 4.0 31 3.0 32 4.5 33 12.5 34 16.5 35 20.5 36 29.5 37 36.5 38 44.5 39 58.0 40 67.0 41 77.0 42 103.5 43 135.5 44 149.5 45 152.0 46 155.5 47 152.0 48 158.5 49 167.5 50 156.0 51 132.5 52 135.5 53 128.5 54 106.0 55 105.5 56 113.0 57 122.0 58 127.5 59 117.5 60 99.5 61 92.0 62 88.0 63 94.5 64 86.5 65 73.0 66 67.5 67 81.0 68 80.0 69 66.0 70 56.5 71 50.0 72 52.5 73 47.0 74 39.5 75 24.0 76 18.0 77 17.5 78 13.0 79 7.0 80 4.0 81 4.0 82 3.0 83 1.0 84 1.5 85 1.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.5 92 1.0 93 0.5 94 1.0 95 2.0 96 1.5 97 1.5 98 1.0 99 1.5 100 5.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.68496158068056 83.525 2 7.436882546652031 13.55 3 0.6860592755214051 1.875 4 0.13721185510428102 0.5 5 0.027442371020856202 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027442371020856202 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 17 0.42500000000000004 No Hit GGGTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0125 110-111 0.25 0.0 0.0 0.0 0.025 112-113 0.3125 0.0 0.0 0.0 0.025 114-115 0.4125 0.0 0.0 0.0 0.025 116-117 0.5125 0.0 0.0 0.0 0.025 118-119 0.5375000000000001 0.0 0.0 0.0 0.025 120-121 0.625 0.0 0.0 0.0 0.025 122-123 0.8 0.0 0.0 0.0 0.025 124-125 0.9624999999999999 0.0 0.0 0.0 0.025 126-127 1.1 0.0 0.0 0.0 0.025 128-129 1.2125 0.0 0.0 0.0 0.025 130-131 1.325 0.0 0.0 0.0 0.025 132-133 1.4375 0.0 0.0 0.0 0.025 134-135 1.6 0.0 0.0 0.0 0.025 136-137 1.8 0.0 0.0 0.0 0.025 138-139 2.0625 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGAGGA 10 0.006830828 145.0 7 >>END_MODULE Read 1588364 spots for SRR7804130.sra Written 1588364 spots for SRR7804130.sra Read 1588364 spots for SRR7804130.sra Written 1588364 spots for SRR7804130.sra Read 1588364 spots for SRR7804130.sra Written 1588364 spots for SRR7804130.sra Read 1588364 spots for SRR7804130.sra Written 1588364 spots for SRR7804130.sra Read 1588364 spots for SRR7804130.sra Written 1588364 spots for SRR7804130.sra Read 1588364 spots for SRR7804130.sra Written 1588364 spots for SRR7804130.sra Read 1588364 spots for SRR7804130.sra Written 1588364 spots for SRR7804130.sra Read 1588364 spots for SRR7804130.sra Written 1588364 spots for SRR7804130.sra Read 1588364 spots for SRR7804130.sra Written 1588364 spots for SRR7804130.sra Read 1588364 spots for SRR7804130.sra Written 1588364 spots for SRR7804130.sra Read 1588364 spots for SRR7804130.sra Written 1588364 spots for SRR7804130.sra Read 1588364 spots for SRR7804130.sra Written 1588364 spots for SRR7804130.sra Read 1588364 spots for SRR7804130.sra Written 1588364 spots for SRR7804130.sra Read 1588364 spots for SRR7804130.sra Written 1588364 spots for SRR7804130.sra Read 1588364 spots for SRR7804130.sra Written 1588364 spots for SRR7804130.sra Read 1588364 spots for SRR7804130.sra Written 1588364 spots for SRR7804130.sra Read 1588364 spots for SRR7804130.sra Written 1588364 spots for SRR7804130.sra Read 1588377 spots for SRR7804130.sra Written 1588377 spots for SRR7804130.sra Read 1588364 spots for SRR7804130.sra Written 1588364 spots for SRR7804130.sra Read 1588364 spots for SRR7804130.sra Written 1588364 spots for SRR7804130.sra SRR ids: ['SRR7804130.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iab_yeqe SRR7804130.sra spots: 31767293 blocks: [[1, 1588364], [1588365, 3176728], [3176729, 4765092], [4765093, 6353456], [6353457, 7941820], [7941821, 9530184], [9530185, 11118548], [11118549, 12706912], [12706913, 14295276], [14295277, 15883640], [15883641, 17472004], [17472005, 19060368], [19060369, 20648732], [20648733, 22237096], [22237097, 23825460], [23825461, 25413824], [25413825, 27002188], [27002189, 28590552], [28590553, 30178916], [30178917, 31767293]] SRR7804130 file size 10743192 SRR7804130 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804130 SRR7804130_1.fastq SRR7804130_2.fastq Input file: SRR7804130_1.fastq Paired file: SRR7804130_2.fastq trimmed: SRR7804130-trimmed-pair1.fastq, SRR7804130-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:14:57 2024 >> started Sat Dec 7 17:15:34 2024 >> done (37.377s) 31767293 read pairs processed; of these: 171 ( 0.00%) short read pairs filtered out after trimming by size control 21443 ( 0.07%) empty read pairs filtered out after trimming by size control 31745679 (99.93%) read pairs available; of these: 1390969 ( 4.38%) trimmed read pairs available after processing 30354710 (95.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 14 0.00% 20 18 0.00% 21 8 0.00% 22 16 0.00% 23 16 0.00% 24 17 0.00% 25 22 0.00% 26 13 0.00% 27 15 0.00% 28 16 0.00% 29 28 0.00% 30 45 0.00% 31 14 0.00% 32 35 0.00% 33 23 0.00% 34 29 0.00% 35 30 0.00% 36 32 0.00% 37 30 0.00% 38 41 0.00% 39 38 0.00% 40 39 0.00% 41 35 0.00% 42 39 0.00% 43 49 0.00% 44 34 0.00% 45 41 0.00% 46 47 0.00% 47 68 0.00% 48 54 0.00% 49 55 0.00% 50 56 0.00% 51 59 0.00% 52 64 0.00% 53 64 0.00% 54 72 0.00% 55 83 0.00% 56 72 0.00% 57 65 0.00% 58 91 0.00% 59 76 0.00% 60 88 0.00% 61 71 0.00% 62 93 0.00% 63 107 0.00% 64 90 0.00% 65 94 0.00% 66 120 0.00% 67 154 0.00% 68 151 0.00% 69 165 0.00% 70 183 0.00% 71 196 0.00% 72 219 0.00% 73 250 0.00% 74 247 0.00% 75 351 0.00% 76 345 0.00% 77 416 0.00% 78 460 0.00% 79 510 0.00% 80 572 0.00% 81 638 0.00% 82 756 0.00% 83 853 0.00% 84 985 0.00% 85 1074 0.00% 86 1186 0.00% 87 1483 0.00% 88 1538 0.00% 89 1660 0.01% 90 1836 0.01% 91 2075 0.01% 92 2226 0.01% 93 2555 0.01% 94 2834 0.01% 95 3112 0.01% 96 3413 0.01% 97 3883 0.01% 98 4066 0.01% 99 4338 0.01% 100 4750 0.01% 101 5216 0.02% 102 5613 0.02% 103 6209 0.02% 104 6665 0.02% 105 7138 0.02% 106 7712 0.02% 107 8190 0.03% 108 8903 0.03% 109 9274 0.03% 110 9944 0.03% 111 10205 0.03% 112 11033 0.03% 113 11956 0.04% 114 12701 0.04% 115 13638 0.04% 116 14289 0.05% 117 15170 0.05% 118 16002 0.05% 119 16962 0.05% 120 17858 0.06% 121 18168 0.06% 122 19060 0.06% 123 20689 0.07% 124 21782 0.07% 125 23186 0.07% 126 23950 0.08% 127 25389 0.08% 128 26301 0.08% 129 27688 0.09% 130 28882 0.09% 131 29820 0.09% 132 31063 0.10% 133 32810 0.10% 134 34205 0.11% 135 35655 0.11% 136 37162 0.12% 137 38139 0.12% 138 40208 0.13% 139 41336 0.13% 140 42616 0.13% 141 44423 0.14% 142 46564 0.15% 143 48064 0.15% 144 49962 0.16% 145 51318 0.16% 146 53048 0.17% 147 55392 0.17% 148 57560 0.18% 149 59000 0.19% 150 61029 0.19% 151 30354710 95.62% 31745679 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.07 fanout-score-rank=28 prefix-density=0.48 prefix-fanout=3.0 sequence=TGCCGCACTTGCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=29 fanout-score=72.90 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=15.7 sequence=CTTCTTCAGCTTCT criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=32 prefix-density=0.84 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=30 fanout-score=32.18 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=4.8 sequence=GCTGGAGGAGGTCAAGAAGGAGT SRR7804130 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:16:31 Started mapping on | Dec 07 17:16:32 Finished on | Dec 07 17:22:03 Mapping speed, Million of reads per hour | 345.27 Number of input reads | 31745679 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 28704988 Uniquely mapped reads % | 90.42% Average mapped length | 299.01 Number of splices: Total | 27772865 Number of splices: Annotated (sjdb) | 26025095 Number of splices: GT/AG | 27352115 Number of splices: GC/AG | 324829 Number of splices: AT/AC | 16840 Number of splices: Non-canonical | 79081 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 3.09 Insertion rate per base | 0.02% Insertion average length | 2.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 552027 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 44888 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.33% % of reads unmapped: other | 1.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2488664 2488664 2488664 N_multimapping 552027 552027 552027 N_noFeature 964790 27582258 1384364 N_ambiguous 842533 6494 138296 UnstrandedReadsAssigned:26897665 PositiveStrandReadsAssigned:1116236 NegativeStrandReadsAssigned:27182328 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804130 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804130-trimmed-pair1.fastq SRR7804130-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,745,679 reads, 27,595,444 reads pseudoaligned [quant] estimated average fragment length: 273.459 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52973 SRR7804130.ke.tsv 35125 SRR7804130.se.tsv 88098 total ==> SRR7804130.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 663.859 118.554 7.40754 PNS24247 1044 771.541 84.7284 4.55517 PNS24249 1928 1655.54 235.231 5.89372 PNS24246 1044 771.541 84.7284 4.55517 PNS24248 1044 771.541 84.7284 4.55517 PNS24244 1471 1198.54 230.03 7.96098 PNS24243 293 79.3861 0 0 KQK14069 1603 1330.54 266.627 8.31212 KQK14071 474 218.807 0 0 ==> SRR7804130.se.tsv <== BRADI_1g14170v3 285 BRADI_1g53295v3 4571 BRADI_1g59795v3 959 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 1368 BRADI_1g74790v3 1357 BRADI_1g09890v3 0 BRADI_1g77505v3 656 BRADI_1g48960v3 0 SRR7804130 completed mapping pipeline successfully