Starting /dee2/code/volunteer_pipeline.sh SRR7804131 current disk space = 1525337329664 free memory = 1598600832 SRR7804131 SRAfilesize c7d1552b9bf03c6e67071d4cb406c9c9 SRR7804131.sra SRR7804131.sra file validated SRR7804131 is paired end SRR7804131 is conventional basespace SRR7804131 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804131_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2435 37.0 37.0 37.0 37.0 37.0 2 36.2135 37.0 37.0 37.0 37.0 37.0 3 36.3535 37.0 37.0 37.0 37.0 37.0 4 36.3295 37.0 37.0 37.0 37.0 37.0 5 36.4825 37.0 37.0 37.0 37.0 37.0 6 36.356 37.0 37.0 37.0 37.0 37.0 7 36.3995 37.0 37.0 37.0 37.0 37.0 8 36.4575 37.0 37.0 37.0 37.0 37.0 9 36.416 37.0 37.0 37.0 37.0 37.0 10-14 36.4508 37.0 37.0 37.0 37.0 37.0 15-19 36.4591 37.0 37.0 37.0 37.0 37.0 20-24 36.4425 37.0 37.0 37.0 37.0 37.0 25-29 36.3946 37.0 37.0 37.0 37.0 37.0 30-34 36.435199999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.393499999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.38720000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.347300000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.35609999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.313900000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.3157 37.0 37.0 37.0 37.0 37.0 65-69 36.281099999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.2551 37.0 37.0 37.0 37.0 37.0 75-79 36.229699999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.1931 37.0 37.0 37.0 37.0 37.0 85-89 36.1723 37.0 37.0 37.0 37.0 37.0 90-94 36.138 37.0 37.0 37.0 37.0 37.0 95-99 36.1457 37.0 37.0 37.0 37.0 37.0 100-104 36.1764 37.0 37.0 37.0 37.0 37.0 105-109 36.085300000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.0656 37.0 37.0 37.0 37.0 37.0 115-119 36.0092 37.0 37.0 37.0 37.0 37.0 120-124 35.9208 37.0 37.0 37.0 37.0 37.0 125-129 35.92360000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.831900000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.85439999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.7453 37.0 37.0 37.0 37.0 37.0 145-149 35.737700000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.267250000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 0.0 24 4.0 25 1.0 26 4.0 27 3.0 28 11.0 29 28.0 30 27.0 31 45.0 32 55.0 33 96.0 34 154.0 35 305.0 36 2936.0 37 330.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.449999999999996 12.325 9.8 35.425000000000004 2 26.23811905952976 14.007003501750875 32.566283141570786 27.188594297148573 3 22.45 19.175 24.2 34.175 4 25.85 26.6 20.775 26.775 5 26.174999999999997 28.925 22.2 22.7 6 24.875 32.2 21.5 21.425 7 17.95 23.05 39.225 19.775000000000002 8 19.7 25.174999999999997 27.125 28.000000000000004 9 21.175 21.9 30.125 26.8 10-14 22.615 26.19 25.47 25.724999999999998 15-19 22.655 26.27 25.0 26.075 20-24 23.445 25.895000000000003 25.31 25.35 25-29 23.085 25.480000000000004 25.259999999999998 26.174999999999997 30-34 23.265 25.27 25.585 25.88 35-39 22.85 25.35 25.615 26.185000000000002 40-44 23.375 25.4 25.555 25.669999999999998 45-49 22.869999999999997 25.61 25.335 26.185000000000002 50-54 23.575 25.735000000000003 25.330000000000002 25.36 55-59 23.27 25.4 25.195 26.135 60-64 23.064999999999998 25.064999999999998 25.845000000000002 26.025 65-69 23.745 25.174999999999997 25.130000000000003 25.95 70-74 23.395 25.305 25.145 26.155 75-79 23.49 24.805 25.240000000000002 26.465 80-84 23.9 24.955 24.845 26.3 85-89 23.810000000000002 25.4 24.91 25.88 90-94 23.29 25.25 25.185000000000002 26.275 95-99 23.685000000000002 24.57 25.45 26.295 100-104 23.64 24.67 25.39 26.3 105-109 23.724999999999998 25.5 24.89 25.885 110-114 23.745 25.03 24.605 26.619999999999997 115-119 23.255 25.019999999999996 25.255 26.47 120-124 24.72 24.84 24.89 25.55 125-129 23.555 25.06 25.319999999999997 26.064999999999998 130-134 24.255 24.759999999999998 24.39 26.595000000000002 135-139 23.745 24.975 24.985 26.295 140-144 24.695 24.515 24.755 26.035000000000004 145-149 23.46 25.124999999999996 24.69 26.724999999999998 150-151 24.349999999999998 24.7 25.1 25.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.5 27 2.0 28 3.0 29 7.0 30 9.0 31 10.5 32 13.0 33 23.0 34 33.5 35 34.5 36 43.0 37 58.0 38 78.0 39 95.5 40 126.0 41 154.0 42 164.0 43 172.5 44 184.5 45 178.5 46 184.5 47 202.0 48 193.0 49 193.5 50 172.0 51 154.0 52 145.5 53 133.0 54 125.0 55 104.5 56 88.0 57 81.5 58 82.0 59 72.0 60 62.0 61 64.5 62 68.5 63 62.5 64 52.0 65 49.5 66 55.5 67 45.5 68 31.5 69 32.0 70 29.0 71 27.5 72 24.0 73 16.5 74 14.0 75 12.5 76 11.0 77 9.5 78 5.0 79 3.0 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.3 #Duplication Level Percentage of deduplicated Percentage of total 1 94.27359490986214 88.9 2 5.434782608695652 10.25 3 0.2651113467656416 0.75 4 0.02651113467656416 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.275 0.0 0.0 0.0 0.0 120-121 0.3375 0.0 0.0 0.0 0.0 122-123 0.4125 0.0 0.0 0.0 0.0 124-125 0.4625 0.0 0.0 0.0 0.0 126-127 0.525 0.0 0.0 0.0 0.0 128-129 0.675 0.0 0.0 0.0 0.0 130-131 0.7625 0.0 0.0 0.0 0.0 132-133 0.8 0.0 0.0 0.0 0.0 134-135 0.8875 0.0 0.0 0.0 0.0 136-137 0.9624999999999999 0.0 0.0 0.0 0.0 138-139 1.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804131 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804131_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2205 37.0 37.0 37.0 37.0 37.0 2 35.825 37.0 37.0 37.0 37.0 37.0 3 35.9725 37.0 37.0 37.0 37.0 37.0 4 36.116 37.0 37.0 37.0 37.0 37.0 5 36.0845 37.0 37.0 37.0 37.0 37.0 6 36.1465 37.0 37.0 37.0 37.0 37.0 7 35.986 37.0 37.0 37.0 37.0 37.0 8 36.214 37.0 37.0 37.0 37.0 37.0 9 35.9685 37.0 37.0 37.0 37.0 37.0 10-14 36.141 37.0 37.0 37.0 37.0 37.0 15-19 36.103899999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.0613 37.0 37.0 37.0 37.0 37.0 25-29 36.0004 37.0 37.0 37.0 37.0 37.0 30-34 36.0303 37.0 37.0 37.0 37.0 37.0 35-39 35.9568 37.0 37.0 37.0 37.0 37.0 40-44 35.8797 37.0 37.0 37.0 37.0 37.0 45-49 35.862899999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.7771 37.0 37.0 37.0 37.0 37.0 55-59 35.7724 37.0 37.0 37.0 37.0 37.0 60-64 35.7851 37.0 37.0 37.0 37.0 37.0 65-69 35.727799999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.7125 37.0 37.0 37.0 37.0 37.0 75-79 35.630399999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.6545 37.0 37.0 37.0 37.0 37.0 85-89 35.57899999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.5783 37.0 37.0 37.0 37.0 37.0 95-99 35.586400000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.6017 37.0 37.0 37.0 37.0 37.0 105-109 35.455999999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.2719 37.0 37.0 37.0 32.2 37.0 115-119 35.3766 37.0 37.0 37.0 37.0 37.0 120-124 35.260000000000005 37.0 37.0 37.0 32.2 37.0 125-129 35.1875 37.0 37.0 37.0 27.4 37.0 130-134 35.285399999999996 37.0 37.0 37.0 32.2 37.0 135-139 35.188100000000006 37.0 37.0 37.0 27.4 37.0 140-144 35.170500000000004 37.0 37.0 37.0 29.8 37.0 145-149 34.9808 37.0 37.0 37.0 25.0 37.0 150-151 34.5795 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 4.0 15 3.0 16 4.0 17 2.0 18 1.0 19 3.0 20 2.0 21 6.0 22 3.0 23 4.0 24 7.0 25 8.0 26 12.0 27 18.0 28 17.0 29 24.0 30 32.0 31 45.0 32 89.0 33 104.0 34 284.0 35 694.0 36 2471.0 37 161.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.494247123561784 19.65982991495748 12.431215607803901 29.41470735367684 2 31.924999999999997 22.1 23.875 22.1 3 23.549999999999997 26.150000000000002 26.55 23.75 4 25.924999999999997 31.55 20.05 22.475 5 28.025 31.6 19.175 21.2 6 24.725 34.025 18.8 22.45 7 21.725 19.1 35.025 24.15 8 25.25 22.75 22.6 29.4 9 24.325 23.125 26.200000000000003 26.35 10-14 26.3 25.290000000000003 23.31 25.1 15-19 26.39 24.62 23.745 25.245 20-24 26.57 24.895 23.585 24.95 25-29 26.085 24.75 23.995 25.169999999999998 30-34 26.169999999999998 25.39 24.625 23.815 35-39 26.279999999999998 24.92 23.395 25.405 40-44 26.534999999999997 24.77 23.990000000000002 24.705 45-49 25.685000000000002 24.82 24.2 25.295 50-54 26.005 24.959999999999997 24.645 24.39 55-59 26.27 25.11 23.419999999999998 25.2 60-64 26.275 25.035 24.295 24.395 65-69 26.905 24.52 24.275 24.3 70-74 26.525 24.91 24.385 24.18 75-79 26.540000000000003 25.31 24.09 24.060000000000002 80-84 27.084999999999997 24.77 23.895 24.25 85-89 27.02 24.805 24.14 24.035 90-94 26.275 24.59 24.45 24.685000000000002 95-99 27.05 25.369999999999997 23.24 24.34 100-104 27.405 25.245 24.12 23.23 105-109 26.840000000000003 25.009999999999998 24.19 23.96 110-114 26.8 25.155 23.87 24.175 115-119 26.779999999999998 25.135 24.38 23.705000000000002 120-124 27.255000000000003 25.055 24.04 23.65 125-129 26.71 24.610000000000003 24.27 24.41 130-134 26.665 25.264999999999997 23.990000000000002 24.08 135-139 26.46 25.14 24.185000000000002 24.215 140-144 26.31 25.979999999999997 23.825 23.885 145-149 27.13 25.330000000000002 24.485 23.055 150-151 26.525 26.237500000000004 23.974999999999998 23.2625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 0.5 16 1.0 17 1.0 18 0.0 19 1.0 20 1.0 21 1.0 22 1.0 23 0.5 24 0.5 25 0.0 26 0.0 27 0.5 28 1.5 29 1.5 30 1.5 31 3.0 32 12.0 33 15.5 34 15.5 35 30.5 36 47.0 37 61.0 38 65.5 39 81.0 40 102.5 41 124.0 42 141.5 43 164.5 44 194.0 45 182.0 46 169.5 47 178.5 48 182.5 49 170.5 50 160.0 51 155.0 52 138.0 53 114.0 54 107.0 55 105.0 56 91.0 57 87.0 58 83.0 59 77.0 60 88.0 61 81.5 62 71.5 63 78.0 64 73.0 65 70.0 66 62.0 67 52.5 68 58.0 69 57.5 70 48.5 71 37.0 72 29.5 73 32.0 74 21.5 75 12.5 76 11.0 77 10.0 78 8.5 79 3.0 80 3.0 81 3.5 82 2.0 83 1.0 84 1.0 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 1.0 95 1.0 96 0.0 97 0.5 98 0.5 99 0.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.0 #Duplication Level Percentage of deduplicated Percentage of total 1 94.17553191489361 88.52499999999999 2 5.425531914893617 10.2 3 0.3191489361702127 0.8999999999999999 4 0.05319148936170213 0.2 5 0.0 0.0 6 0.0 0.0 7 0.026595744680851064 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.275 0.0 0.0 0.0 0.0 120-121 0.3375 0.0 0.0 0.0 0.0 122-123 0.4125 0.0 0.0 0.0 0.0 124-125 0.4625 0.0 0.0 0.0 0.0 126-127 0.525 0.0 0.0 0.0 0.0 128-129 0.675 0.0 0.0 0.0 0.0 130-131 0.7625 0.0 0.0 0.0 0.0 132-133 0.8 0.0 0.0 0.0 0.0 134-135 0.8875 0.0 0.0 0.0 0.0 136-137 0.9624999999999999 0.0 0.0 0.0 0.0 138-139 1.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACAAAA 10 0.006830828 145.0 7 ATCAGTG 10 0.006830828 145.0 6 >>END_MODULE Read 1714022 spots for SRR7804131.sra Written 1714022 spots for SRR7804131.sra Read 1714022 spots for SRR7804131.sra Written 1714022 spots for SRR7804131.sra Read 1714022 spots for SRR7804131.sra Written 1714022 spots for SRR7804131.sra Read 1714022 spots for SRR7804131.sra Written 1714022 spots for SRR7804131.sra Read 1714022 spots for SRR7804131.sra Written 1714022 spots for SRR7804131.sra Read 1714022 spots for SRR7804131.sra Written 1714022 spots for SRR7804131.sra Read 1714022 spots for SRR7804131.sra Written 1714022 spots for SRR7804131.sra Read 1714022 spots for SRR7804131.sra Written 1714022 spots for SRR7804131.sra Read 1714022 spots for SRR7804131.sra Written 1714022 spots for SRR7804131.sra Read 1714022 spots for SRR7804131.sra Written 1714022 spots for SRR7804131.sra Read 1714022 spots for SRR7804131.sra Written 1714022 spots for SRR7804131.sra Read 1714022 spots for SRR7804131.sra Written 1714022 spots for SRR7804131.sra Read 1714038 spots for SRR7804131.sra Written 1714038 spots for SRR7804131.sra Read 1714022 spots for SRR7804131.sra Written 1714022 spots for SRR7804131.sra Read 1714022 spots for SRR7804131.sra Written 1714022 spots for SRR7804131.sra Read 1714022 spots for SRR7804131.sra Written 1714022 spots for SRR7804131.sra Read 1714022 spots for SRR7804131.sra Written 1714022 spots for SRR7804131.sra Read 1714022 spots for SRR7804131.sra Written 1714022 spots for SRR7804131.sra Read 1714022 spots for SRR7804131.sra Written 1714022 spots for SRR7804131.sra Read 1714022 spots for SRR7804131.sra Written 1714022 spots for SRR7804131.sra SRR ids: ['SRR7804131.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xwqcmfd3 SRR7804131.sra spots: 34280456 blocks: [[1, 1714022], [1714023, 3428044], [3428045, 5142066], [5142067, 6856088], [6856089, 8570110], [8570111, 10284132], [10284133, 11998154], [11998155, 13712176], [13712177, 15426198], [15426199, 17140220], [17140221, 18854242], [18854243, 20568264], [20568265, 22282286], [22282287, 23996308], [23996309, 25710330], [25710331, 27424352], [27424353, 29138374], [29138375, 30852396], [30852397, 32566418], [32566419, 34280456]] SRR7804131 file size 11594821 SRR7804131 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804131 SRR7804131_1.fastq SRR7804131_2.fastq Input file: SRR7804131_1.fastq Paired file: SRR7804131_2.fastq trimmed: SRR7804131-trimmed-pair1.fastq, SRR7804131-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:21:24 2024 >> started Tue Dec 10 02:22:05 2024 >> done (41.758s) 34280456 read pairs processed; of these: 95 ( 0.00%) short read pairs filtered out after trimming by size control 438 ( 0.00%) empty read pairs filtered out after trimming by size control 34279923 (100.00%) read pairs available; of these: 662751 ( 1.93%) trimmed read pairs available after processing 33617172 (98.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 15 0.00% 20 12 0.00% 21 15 0.00% 22 18 0.00% 23 24 0.00% 24 25 0.00% 25 37 0.00% 26 35 0.00% 27 28 0.00% 28 37 0.00% 29 24 0.00% 30 30 0.00% 31 46 0.00% 32 49 0.00% 33 50 0.00% 34 35 0.00% 35 54 0.00% 36 43 0.00% 37 52 0.00% 38 59 0.00% 39 65 0.00% 40 54 0.00% 41 56 0.00% 42 80 0.00% 43 56 0.00% 44 53 0.00% 45 74 0.00% 46 66 0.00% 47 70 0.00% 48 56 0.00% 49 89 0.00% 50 72 0.00% 51 72 0.00% 52 86 0.00% 53 73 0.00% 54 65 0.00% 55 94 0.00% 56 73 0.00% 57 94 0.00% 58 110 0.00% 59 100 0.00% 60 103 0.00% 61 87 0.00% 62 104 0.00% 63 107 0.00% 64 133 0.00% 65 123 0.00% 66 129 0.00% 67 102 0.00% 68 132 0.00% 69 160 0.00% 70 150 0.00% 71 151 0.00% 72 193 0.00% 73 222 0.00% 74 198 0.00% 75 256 0.00% 76 237 0.00% 77 267 0.00% 78 288 0.00% 79 345 0.00% 80 323 0.00% 81 344 0.00% 82 410 0.00% 83 483 0.00% 84 503 0.00% 85 555 0.00% 86 685 0.00% 87 687 0.00% 88 735 0.00% 89 827 0.00% 90 933 0.00% 91 1053 0.00% 92 1100 0.00% 93 1277 0.00% 94 1359 0.00% 95 1488 0.00% 96 1608 0.00% 97 1724 0.01% 98 1954 0.01% 99 2028 0.01% 100 2209 0.01% 101 2432 0.01% 102 2536 0.01% 103 2957 0.01% 104 3085 0.01% 105 3346 0.01% 106 3501 0.01% 107 3785 0.01% 108 3944 0.01% 109 4099 0.01% 110 4429 0.01% 111 4641 0.01% 112 5026 0.01% 113 5545 0.02% 114 6099 0.02% 115 6291 0.02% 116 6730 0.02% 117 6967 0.02% 118 7342 0.02% 119 7689 0.02% 120 7955 0.02% 121 8452 0.02% 122 8962 0.03% 123 9546 0.03% 124 10311 0.03% 125 10851 0.03% 126 11479 0.03% 127 11863 0.03% 128 12211 0.04% 129 12471 0.04% 130 13145 0.04% 131 13448 0.04% 132 14465 0.04% 133 15417 0.04% 134 15887 0.05% 135 17291 0.05% 136 17668 0.05% 137 18268 0.05% 138 18768 0.05% 139 19773 0.06% 140 20159 0.06% 141 21072 0.06% 142 21880 0.06% 143 22793 0.07% 144 24389 0.07% 145 25619 0.07% 146 26216 0.08% 147 27522 0.08% 148 28200 0.08% 149 28507 0.08% 150 29693 0.09% 151 33617172 98.07% 34279923 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.97 fanout-score-rank=28 prefix-density=0.28 prefix-fanout=2.6 sequence=CCAGTCTCCCTGTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=91.07 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=20.2 sequence=TTCTCCTCCTTG criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=3.92 fanout-score-rank=20 prefix-density=0.47 prefix-fanout=3.1 sequence=AAGATGTACCCAGA criterion=fanout-score sequence-density=0.10 sequence-density-rank=29 fanout-score=192.22 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=23.3 sequence=CGCCGCCGCCGC SRR7804131 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:22:57 Started mapping on | Dec 10 02:22:57 Finished on | Dec 10 02:27:16 Mapping speed, Million of reads per hour | 476.48 Number of input reads | 34279923 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 31664745 Uniquely mapped reads % | 92.37% Average mapped length | 299.95 Number of splices: Total | 34982999 Number of splices: Annotated (sjdb) | 33084199 Number of splices: GT/AG | 34486558 Number of splices: GC/AG | 396997 Number of splices: AT/AC | 18566 Number of splices: Non-canonical | 80878 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 485245 % of reads mapped to multiple loci | 1.42% Number of reads mapped to too many loci | 25526 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.57% % of reads unmapped: other | 0.57% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2129933 2129933 2129933 N_multimapping 485245 485245 485245 N_noFeature 991247 30784050 1224303 N_ambiguous 775051 5137 128704 UnstrandedReadsAssigned:29898447 PositiveStrandReadsAssigned:875558 NegativeStrandReadsAssigned:30311738 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804131 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804131-trimmed-pair1.fastq SRR7804131-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,279,923 reads, 30,641,976 reads pseudoaligned [quant] estimated average fragment length: 323.748 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,271 rounds 52973 SRR7804131.ke.tsv 35125 SRR7804131.se.tsv 88098 total ==> SRR7804131.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 614.113 0.885973 0.0638137 PNS24247 1044 721.252 103.643 6.35615 PNS24249 1928 1605.25 250.206 6.8944 PNS24246 1044 721.252 103.643 6.35615 PNS24248 1044 721.252 103.643 6.35615 PNS24244 1471 1148.25 194.979 7.5109 PNS24243 293 68.683 0 0 KQK14069 1603 1280.25 245.421 8.47927 KQK14071 474 189.273 0 0 ==> SRR7804131.se.tsv <== BRADI_1g14170v3 261 BRADI_1g53295v3 1664 BRADI_1g59795v3 575 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 5248 BRADI_1g74790v3 3155 BRADI_1g09890v3 0 BRADI_1g77505v3 426 BRADI_1g48960v3 0 SRR7804131 completed mapping pipeline successfully