Starting /dee2/code/volunteer_pipeline.sh SRR7804132 current disk space = 1525360996352 free memory = 1410905612 SRR7804132 SRAfilesize b847f7761d8a8fe427014f5768d03fc9 SRR7804132.sra SRR7804132.sra file validated SRR7804132 is paired end SRR7804132 is conventional basespace SRR7804132 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804132_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.306 37.0 37.0 37.0 37.0 37.0 2 36.21275 37.0 37.0 37.0 37.0 37.0 3 36.447 37.0 37.0 37.0 37.0 37.0 4 36.4015 37.0 37.0 37.0 37.0 37.0 5 36.4855 37.0 37.0 37.0 37.0 37.0 6 36.4975 37.0 37.0 37.0 37.0 37.0 7 36.4785 37.0 37.0 37.0 37.0 37.0 8 36.4705 37.0 37.0 37.0 37.0 37.0 9 36.5285 37.0 37.0 37.0 37.0 37.0 10-14 36.4874 37.0 37.0 37.0 37.0 37.0 15-19 36.4597 37.0 37.0 37.0 37.0 37.0 20-24 36.4474 37.0 37.0 37.0 37.0 37.0 25-29 36.372 37.0 37.0 37.0 37.0 37.0 30-34 36.3782 37.0 37.0 37.0 37.0 37.0 35-39 36.3657 37.0 37.0 37.0 37.0 37.0 40-44 36.3663 37.0 37.0 37.0 37.0 37.0 45-49 36.3744 37.0 37.0 37.0 37.0 37.0 50-54 36.361599999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.32600000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.3455 37.0 37.0 37.0 37.0 37.0 65-69 36.3071 37.0 37.0 37.0 37.0 37.0 70-74 36.251099999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.22240000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.1908 37.0 37.0 37.0 37.0 37.0 85-89 36.1457 37.0 37.0 37.0 37.0 37.0 90-94 36.176500000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.061 37.0 37.0 37.0 37.0 37.0 100-104 36.1482 37.0 37.0 37.0 37.0 37.0 105-109 36.05890000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.0914 37.0 37.0 37.0 37.0 37.0 115-119 36.0563 37.0 37.0 37.0 37.0 37.0 120-124 36.0067 37.0 37.0 37.0 37.0 37.0 125-129 35.908300000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.888999999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.819100000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.8378 37.0 37.0 37.0 37.0 37.0 145-149 35.838 37.0 37.0 37.0 37.0 37.0 150-151 35.243750000000006 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 3.0 24 3.0 25 4.0 26 1.0 27 8.0 28 12.0 29 17.0 30 41.0 31 41.0 32 62.0 33 81.0 34 149.0 35 295.0 36 2860.0 37 422.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.425 12.0 6.625 28.95 2 27.120340255191394 12.43432574430823 31.998999249437077 28.446334751063297 3 24.224999999999998 18.325 25.324999999999996 32.125 4 28.749999999999996 23.9 21.525 25.825 5 28.925 27.0 21.349999999999998 22.725 6 24.6 28.325 23.0 24.075 7 20.974999999999998 22.400000000000002 36.525 20.1 8 21.6 22.225 28.599999999999998 27.575 9 23.825 19.025 29.95 27.200000000000003 10-14 25.430000000000003 23.325000000000003 23.905 27.339999999999996 15-19 25.509999999999998 23.419999999999998 24.325 26.745 20-24 24.845 23.54 24.5 27.115000000000002 25-29 25.465 23.655 24.23 26.650000000000002 30-34 25.53 23.189999999999998 24.27 27.01 35-39 25.44 22.770000000000003 24.72 27.07 40-44 25.635 23.635 23.86 26.87 45-49 26.105 22.665 23.79 27.439999999999998 50-54 26.090000000000003 23.1 23.53 27.279999999999998 55-59 25.979999999999997 23.265 23.665 27.089999999999996 60-64 25.765 23.27 23.599999999999998 27.365000000000002 65-69 26.534999999999997 23.28 23.275000000000002 26.91 70-74 25.924999999999997 22.915 23.65 27.51 75-79 26.08 23.425 23.445 27.05 80-84 26.005 22.88 23.674999999999997 27.439999999999998 85-89 26.25 22.38 23.595 27.775 90-94 27.0 22.63 23.565 26.805 95-99 26.35 22.720000000000002 23.425 27.505000000000003 100-104 26.655 22.675 23.43 27.24 105-109 27.189999999999998 22.735 23.64 26.435 110-114 26.334999999999997 23.555 22.99 27.12 115-119 26.685 22.17 23.34 27.805000000000003 120-124 27.095000000000002 22.925 23.0 26.979999999999997 125-129 26.75 22.775000000000002 22.81 27.665 130-134 26.985 23.06 22.650000000000002 27.305 135-139 27.05 22.384999999999998 23.105 27.46 140-144 27.065 22.53 22.86 27.544999999999998 145-149 27.325 22.650000000000002 22.895 27.13 150-151 26.724999999999998 22.8625 23.3125 27.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 0.5 26 1.5 27 2.0 28 1.5 29 2.0 30 3.5 31 7.5 32 10.0 33 12.5 34 16.0 35 22.0 36 25.0 37 39.5 38 56.5 39 60.0 40 77.5 41 103.0 42 123.0 43 130.0 44 136.5 45 148.5 46 155.5 47 167.0 48 168.5 49 144.5 50 132.5 51 135.0 52 122.5 53 113.0 54 110.5 55 104.5 56 105.0 57 102.5 58 100.5 59 105.5 60 111.5 61 104.0 62 92.5 63 108.0 64 113.0 65 100.5 66 89.5 67 80.5 68 77.5 69 66.0 70 59.0 71 56.0 72 44.0 73 38.0 74 30.5 75 20.0 76 19.0 77 15.5 78 10.0 79 6.5 80 4.0 81 2.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.05 #Duplication Level Percentage of deduplicated Percentage of total 1 91.29599121361889 83.125 2 7.825370675453048 14.249999999999998 3 0.7138934651290499 1.95 4 0.10982976386600769 0.4 5 0.027457440966501923 0.125 6 0.027457440966501923 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGG 6 0.15 No Hit GTGCTCTAGCCTCTCACACGCTGACGAGCTTCTTGCCGAGGATCATGTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.025 120-121 0.925 0.0 0.0 0.0 0.025 122-123 1.0499999999999998 0.0 0.0 0.0 0.025 124-125 1.2374999999999998 0.0 0.0 0.0 0.025 126-127 1.375 0.0 0.0 0.0 0.025 128-129 1.5 0.0 0.0 0.0 0.025 130-131 1.675 0.0 0.0 0.0 0.025 132-133 1.7875 0.0 0.0 0.0 0.025 134-135 1.8875 0.0 0.0 0.0 0.025 136-137 2.0 0.0 0.0 0.0 0.025 138-139 2.3375 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804132 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804132_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.295 37.0 37.0 37.0 37.0 37.0 2 35.9995 37.0 37.0 37.0 37.0 37.0 3 36.0985 37.0 37.0 37.0 37.0 37.0 4 36.159 37.0 37.0 37.0 37.0 37.0 5 36.1875 37.0 37.0 37.0 37.0 37.0 6 36.167 37.0 37.0 37.0 37.0 37.0 7 36.01 37.0 37.0 37.0 37.0 37.0 8 36.2435 37.0 37.0 37.0 37.0 37.0 9 36.037 37.0 37.0 37.0 37.0 37.0 10-14 36.046800000000005 37.0 37.0 37.0 37.0 37.0 15-19 35.9753 37.0 37.0 37.0 37.0 37.0 20-24 36.0138 37.0 37.0 37.0 37.0 37.0 25-29 35.9319 37.0 37.0 37.0 37.0 37.0 30-34 35.8506 37.0 37.0 37.0 37.0 37.0 35-39 35.8207 37.0 37.0 37.0 37.0 37.0 40-44 35.821 37.0 37.0 37.0 37.0 37.0 45-49 35.7504 37.0 37.0 37.0 37.0 37.0 50-54 35.743 37.0 37.0 37.0 37.0 37.0 55-59 35.7145 37.0 37.0 37.0 37.0 37.0 60-64 35.7074 37.0 37.0 37.0 37.0 37.0 65-69 35.6316 37.0 37.0 37.0 37.0 37.0 70-74 35.625800000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.6385 37.0 37.0 37.0 37.0 37.0 80-84 35.6425 37.0 37.0 37.0 37.0 37.0 85-89 35.648 37.0 37.0 37.0 37.0 37.0 90-94 35.61189999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.5513 37.0 37.0 37.0 37.0 37.0 100-104 35.503099999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.539699999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.373000000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.4354 37.0 37.0 37.0 37.0 37.0 120-124 35.369699999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.2921 37.0 37.0 37.0 37.0 37.0 130-134 35.3737 37.0 37.0 37.0 37.0 37.0 135-139 35.242399999999996 37.0 37.0 37.0 32.2 37.0 140-144 35.1571 37.0 37.0 37.0 29.8 37.0 145-149 35.092 37.0 37.0 37.0 27.4 37.0 150-151 34.537 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 4.0 14 13.0 15 11.0 16 2.0 17 7.0 18 5.0 19 6.0 20 8.0 21 9.0 22 17.0 23 11.0 24 13.0 25 6.0 26 9.0 27 10.0 28 18.0 29 22.0 30 24.0 31 32.0 32 56.0 33 100.0 34 156.0 35 486.0 36 2700.0 37 273.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.34817408704352 17.958979489744873 7.728864432216108 27.963981990995496 2 30.2 21.625 23.775 24.4 3 26.75 23.925 25.124999999999996 24.2 4 28.849999999999998 29.875 15.925 25.35 5 29.475 31.85 17.025000000000002 21.65 6 26.05 33.475 17.474999999999998 23.0 7 25.85 20.025000000000002 28.225 25.900000000000002 8 24.25 22.2 21.825 31.724999999999998 9 25.4 22.375 23.25 28.975 10-14 28.139999999999997 23.990000000000002 20.19 27.68 15-19 27.62 23.765 21.92 26.695 20-24 27.095000000000002 23.91 21.834999999999997 27.16 25-29 27.37 23.595 21.735 27.3 30-34 27.38 23.905 21.845 26.87 35-39 26.815 24.07 21.66 27.455000000000002 40-44 27.474999999999998 23.605 21.490000000000002 27.43 45-49 27.515 23.54 21.29 27.655 50-54 27.860000000000003 23.945 21.29 26.905 55-59 28.13 23.415 21.105 27.35 60-64 26.87 23.735 21.395 28.000000000000004 65-69 27.139999999999997 23.885 21.015 27.96 70-74 26.995 23.23 21.215 28.560000000000002 75-79 27.0 23.22 21.645 28.134999999999998 80-84 27.82 23.335 21.545 27.3 85-89 27.26 23.305 21.3 28.134999999999998 90-94 27.744999999999997 22.85 21.26 28.144999999999996 95-99 27.439999999999998 23.865 21.625 27.07 100-104 27.415 23.9 21.32 27.365000000000002 105-109 27.445000000000004 23.880000000000003 21.25 27.425 110-114 27.744999999999997 23.25 21.18 27.825 115-119 27.744999999999997 23.435 21.705 27.115000000000002 120-124 27.82 23.95 21.325 26.905 125-129 28.23 23.75 21.485000000000003 26.534999999999997 130-134 27.71 24.104999999999997 20.935000000000002 27.250000000000004 135-139 27.57 24.740000000000002 21.535 26.155 140-144 28.055000000000003 24.82 21.154999999999998 25.97 145-149 27.095000000000002 24.47 21.72 26.715 150-151 29.512500000000003 23.375 20.5375 26.575 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.5 14 1.0 15 1.0 16 1.0 17 0.5 18 0.5 19 1.5 20 1.5 21 1.5 22 2.5 23 2.5 24 1.0 25 0.5 26 2.5 27 3.0 28 2.0 29 3.5 30 4.5 31 4.5 32 5.0 33 8.0 34 8.5 35 12.5 36 21.5 37 28.5 38 38.5 39 57.0 40 83.0 41 99.5 42 113.5 43 127.0 44 125.0 45 126.0 46 125.0 47 130.5 48 129.5 49 117.0 50 115.0 51 115.0 52 106.0 53 97.5 54 109.0 55 113.5 56 94.5 57 85.5 58 95.5 59 107.0 60 124.0 61 125.5 62 120.5 63 118.0 64 103.5 65 103.0 66 102.0 67 95.0 68 105.0 69 94.0 70 81.5 71 76.0 72 65.0 73 60.0 74 49.5 75 37.5 76 28.5 77 20.0 78 14.0 79 10.0 80 5.0 81 3.0 82 2.5 83 1.5 84 0.0 85 0.0 86 0.5 87 1.0 88 1.0 89 0.5 90 0.0 91 0.5 92 0.5 93 1.0 94 1.0 95 0.0 96 0.0 97 0.5 98 1.0 99 1.5 100 6.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.625 #Duplication Level Percentage of deduplicated Percentage of total 1 91.66896551724138 83.075 2 7.227586206896552 13.100000000000001 3 0.7448275862068966 2.025 4 0.13793103448275862 0.5 5 0.13793103448275862 0.625 6 0.05517241379310345 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027586206896551724 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 15 0.375 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 6 0.15 No Hit CTTCAGTTCTCACTCCACAGCTCAGAGTCAAGAGCTACTAGCAATGGCAG 6 0.15 No Hit GAGCACCACTGCTGCAGAGAGAGAGATCGAGATGGCAGCGTCCATGATCA 5 0.125 No Hit CGGCCAACTGGTGCTACGCAACCGTCGCGCCCCGCGCTAAGAGCGTCGTC 5 0.125 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit CTGCACTTTCCTCATCTCCCCGAGAGCAGGAGCTAGAGGAGGAGGAGCTT 5 0.125 No Hit CTTCCCCTTCAGAGACCAGCATTTCTTCGCGTCAGTGGAGAAGGCCAGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.45 0.0 0.0 0.0 0.0 110-111 0.4875 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.925 0.0 0.0 0.0 0.0 122-123 1.0499999999999998 0.0 0.0 0.0 0.0 124-125 1.2374999999999998 0.0 0.0 0.0 0.0 126-127 1.375 0.0 0.0 0.0 0.0 128-129 1.5 0.0 0.0 0.0 0.0 130-131 1.675 0.0 0.0 0.0 0.0 132-133 1.7875 0.0 0.0 0.0 0.0 134-135 1.8875 0.0 0.0 0.0 0.0 136-137 2.0125 0.0 0.0 0.0 0.0 138-139 2.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAAAAG 10 0.006830828 145.0 145 GGTGCTA 10 0.006830828 145.0 9 >>END_MODULE Read 1890088 spots for SRR7804132.sra Written 1890088 spots for SRR7804132.sra Read 1890088 spots for SRR7804132.sra Written 1890088 spots for SRR7804132.sra Read 1890088 spots for SRR7804132.sra Written 1890088 spots for SRR7804132.sra Read 1890088 spots for SRR7804132.sra Written 1890088 spots for SRR7804132.sra Read 1890088 spots for SRR7804132.sra Written 1890088 spots for SRR7804132.sra Read 1890088 spots for SRR7804132.sra Written 1890088 spots for SRR7804132.sra Read 1890088 spots for SRR7804132.sra Written 1890088 spots for SRR7804132.sra Read 1890088 spots for SRR7804132.sra Written 1890088 spots for SRR7804132.sra Read 1890088 spots for SRR7804132.sra Written 1890088 spots for SRR7804132.sra Read 1890088 spots for SRR7804132.sra Written 1890088 spots for SRR7804132.sra Read 1890088 spots for SRR7804132.sra Written 1890088 spots for SRR7804132.sra Read 1890088 spots for SRR7804132.sra Written 1890088 spots for SRR7804132.sra Read 1890088 spots for SRR7804132.sra Written 1890088 spots for SRR7804132.sra Read 1890103 spots for SRR7804132.sra Written 1890103 spots for SRR7804132.sra Read 1890088 spots for SRR7804132.sra Written 1890088 spots for SRR7804132.sra Read 1890088 spots for SRR7804132.sra Written 1890088 spots for SRR7804132.sra Read 1890088 spots for SRR7804132.sra Written 1890088 spots for SRR7804132.sra Read 1890088 spots for SRR7804132.sra Written 1890088 spots for SRR7804132.sra Read 1890088 spots for SRR7804132.sra Written 1890088 spots for SRR7804132.sra Read 1890088 spots for SRR7804132.sra Written 1890088 spots for SRR7804132.sra SRR ids: ['SRR7804132.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1hf1yumy SRR7804132.sra spots: 37801775 blocks: [[1, 1890088], [1890089, 3780176], [3780177, 5670264], [5670265, 7560352], [7560353, 9450440], [9450441, 11340528], [11340529, 13230616], [13230617, 15120704], [15120705, 17010792], [17010793, 18900880], [18900881, 20790968], [20790969, 22681056], [22681057, 24571144], [24571145, 26461232], [26461233, 28351320], [28351321, 30241408], [30241409, 32131496], [32131497, 34021584], [34021585, 35911672], [35911673, 37801775]] SRR7804132 file size 12788080 SRR7804132 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804132 SRR7804132_1.fastq SRR7804132_2.fastq Input file: SRR7804132_1.fastq Paired file: SRR7804132_2.fastq trimmed: SRR7804132-trimmed-pair1.fastq, SRR7804132-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:21:55 2024 >> started Tue Dec 10 02:23:07 2024 >> done (71.953s) 37801775 read pairs processed; of these: 181 ( 0.00%) short read pairs filtered out after trimming by size control 1729 ( 0.00%) empty read pairs filtered out after trimming by size control 37799865 (99.99%) read pairs available; of these: 1420987 ( 3.76%) trimmed read pairs available after processing 36378878 (96.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 18 0.00% 20 20 0.00% 21 21 0.00% 22 26 0.00% 23 23 0.00% 24 16 0.00% 25 12 0.00% 26 14 0.00% 27 30 0.00% 28 33 0.00% 29 31 0.00% 30 25 0.00% 31 31 0.00% 32 33 0.00% 33 32 0.00% 34 34 0.00% 35 25 0.00% 36 31 0.00% 37 32 0.00% 38 27 0.00% 39 33 0.00% 40 30 0.00% 41 45 0.00% 42 40 0.00% 43 43 0.00% 44 45 0.00% 45 51 0.00% 46 57 0.00% 47 44 0.00% 48 44 0.00% 49 51 0.00% 50 52 0.00% 51 70 0.00% 52 60 0.00% 53 65 0.00% 54 56 0.00% 55 80 0.00% 56 81 0.00% 57 94 0.00% 58 86 0.00% 59 109 0.00% 60 124 0.00% 61 123 0.00% 62 138 0.00% 63 158 0.00% 64 145 0.00% 65 164 0.00% 66 174 0.00% 67 214 0.00% 68 226 0.00% 69 280 0.00% 70 258 0.00% 71 300 0.00% 72 410 0.00% 73 418 0.00% 74 484 0.00% 75 552 0.00% 76 573 0.00% 77 648 0.00% 78 689 0.00% 79 849 0.00% 80 957 0.00% 81 1030 0.00% 82 1202 0.00% 83 1385 0.00% 84 1492 0.00% 85 1685 0.00% 86 1760 0.00% 87 1995 0.01% 88 2180 0.01% 89 2333 0.01% 90 2628 0.01% 91 3144 0.01% 92 3328 0.01% 93 3584 0.01% 94 4033 0.01% 95 4233 0.01% 96 4648 0.01% 97 4780 0.01% 98 5059 0.01% 99 5719 0.02% 100 5960 0.02% 101 6425 0.02% 102 7126 0.02% 103 7866 0.02% 104 8377 0.02% 105 8680 0.02% 106 9554 0.03% 107 9573 0.03% 108 10356 0.03% 109 10910 0.03% 110 11334 0.03% 111 12000 0.03% 112 13092 0.03% 113 13656 0.04% 114 15057 0.04% 115 15911 0.04% 116 16435 0.04% 117 16641 0.04% 118 17290 0.05% 119 17739 0.05% 120 18585 0.05% 121 19619 0.05% 122 20454 0.05% 123 21882 0.06% 124 23181 0.06% 125 24360 0.06% 126 25470 0.07% 127 26283 0.07% 128 26659 0.07% 129 27618 0.07% 130 28664 0.08% 131 29297 0.08% 132 30724 0.08% 133 32484 0.09% 134 34727 0.09% 135 36585 0.10% 136 36719 0.10% 137 37804 0.10% 138 38839 0.10% 139 39817 0.11% 140 40280 0.11% 141 41962 0.11% 142 44631 0.12% 143 45725 0.12% 144 48248 0.13% 145 50292 0.13% 146 51299 0.14% 147 53273 0.14% 148 53712 0.14% 149 55245 0.15% 150 56695 0.15% 151 36378878 96.24% 37799865 reads passed initial QC criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=4.87 fanout-score-rank=13 prefix-density=1.03 prefix-fanout=3.8 sequence=AGGTTCTCGAGGG criterion=fanout-score sequence-density=0.23 sequence-density-rank=30 fanout-score=26.83 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=7.4 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGCGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=1.01 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=22 prefix-density=1.06 prefix-fanout=2.6 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCGGGCAGCCCGTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=108.79 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=3.6 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR7804132 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:24:24 Started mapping on | Dec 10 02:24:25 Finished on | Dec 10 02:29:39 Mapping speed, Million of reads per hour | 433.37 Number of input reads | 37799865 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 34904188 Uniquely mapped reads % | 92.34% Average mapped length | 299.33 Number of splices: Total | 36899292 Number of splices: Annotated (sjdb) | 35026630 Number of splices: GT/AG | 36362408 Number of splices: GC/AG | 452140 Number of splices: AT/AC | 11041 Number of splices: Non-canonical | 73703 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 417650 % of reads mapped to multiple loci | 1.10% Number of reads mapped to too many loci | 36986 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.74% % of reads unmapped: other | 0.71% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2478027 2478027 2478027 N_multimapping 417650 417650 417650 N_noFeature 860377 33952947 1062018 N_ambiguous 956913 5439 208849 UnstrandedReadsAssigned:33086898 PositiveStrandReadsAssigned:945802 NegativeStrandReadsAssigned:33633321 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804132 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804132-trimmed-pair1.fastq SRR7804132-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,799,865 reads, 33,857,369 reads pseudoaligned [quant] estimated average fragment length: 296.843 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,199 rounds 52973 SRR7804132.ke.tsv 35125 SRR7804132.se.tsv 88098 total ==> SRR7804132.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 640.834 0 0 PNS24247 1044 748.157 95.9877 4.72701 PNS24249 1928 1632.16 186.503 4.21006 PNS24246 1044 748.157 95.9877 4.72701 PNS24248 1044 748.157 95.9877 4.72701 PNS24244 1471 1175.16 67.5334 2.11732 PNS24243 293 77.7362 0 0 KQK14069 1603 1307.16 2426.71 68.3996 KQK14071 474 206.24 35.5829 6.3567 ==> SRR7804132.se.tsv <== BRADI_1g14170v3 2577 BRADI_1g53295v3 724 BRADI_1g59795v3 657 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 338 BRADI_1g74790v3 254 BRADI_1g09890v3 0 BRADI_1g77505v3 557 BRADI_1g48960v3 0 SRR7804132 completed mapping pipeline successfully