Starting /dee2/code/volunteer_pipeline.sh SRR7804133 current disk space = 1525362319360 free memory = 1560269356 SRR7804133 SRAfilesize 44a0eae29f3ad80139eb6adeb6f3c2ae SRR7804133.sra SRR7804133.sra file validated SRR7804133 is paired end SRR7804133 is conventional basespace SRR7804133 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804133_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3 37.0 37.0 37.0 37.0 37.0 2 36.30375 37.0 37.0 37.0 37.0 37.0 3 36.3705 37.0 37.0 37.0 37.0 37.0 4 36.5005 37.0 37.0 37.0 37.0 37.0 5 36.5825 37.0 37.0 37.0 37.0 37.0 6 36.4005 37.0 37.0 37.0 37.0 37.0 7 36.463 37.0 37.0 37.0 37.0 37.0 8 36.4305 37.0 37.0 37.0 37.0 37.0 9 36.539 37.0 37.0 37.0 37.0 37.0 10-14 36.5065 37.0 37.0 37.0 37.0 37.0 15-19 36.472500000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.444399999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.4279 37.0 37.0 37.0 37.0 37.0 30-34 36.4082 37.0 37.0 37.0 37.0 37.0 35-39 36.4089 37.0 37.0 37.0 37.0 37.0 40-44 36.397400000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.3831 37.0 37.0 37.0 37.0 37.0 50-54 36.3447 37.0 37.0 37.0 37.0 37.0 55-59 36.3452 37.0 37.0 37.0 37.0 37.0 60-64 36.3162 37.0 37.0 37.0 37.0 37.0 65-69 36.33669999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.2863 37.0 37.0 37.0 37.0 37.0 75-79 36.3008 37.0 37.0 37.0 37.0 37.0 80-84 36.2286 37.0 37.0 37.0 37.0 37.0 85-89 36.214200000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.20100000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.175 37.0 37.0 37.0 37.0 37.0 100-104 36.124 37.0 37.0 37.0 37.0 37.0 105-109 36.070899999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.0664 37.0 37.0 37.0 37.0 37.0 115-119 36.0466 37.0 37.0 37.0 37.0 37.0 120-124 36.0324 37.0 37.0 37.0 37.0 37.0 125-129 35.9088 37.0 37.0 37.0 37.0 37.0 130-134 35.7856 37.0 37.0 37.0 37.0 37.0 135-139 35.8666 37.0 37.0 37.0 37.0 37.0 140-144 35.797399999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.752700000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.1455 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 3.0 25 4.0 26 4.0 27 7.0 28 14.0 29 14.0 30 23.0 31 48.0 32 51.0 33 99.0 34 143.0 35 327.0 36 2894.0 37 368.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.8 12.6 8.725 34.875 2 25.63140785196299 13.828457114278569 31.032758189547387 29.507376844211052 3 22.075 19.075 24.55 34.300000000000004 4 25.0 26.700000000000003 22.1 26.200000000000003 5 25.825 28.799999999999997 21.875 23.5 6 22.675 32.1 23.625 21.6 7 18.675 23.474999999999998 37.125 20.724999999999998 8 22.775000000000002 23.45 27.1 26.674999999999997 9 19.625 22.325 31.55 26.5 10-14 23.494999999999997 25.929999999999996 24.66 25.915 15-19 23.225 25.124999999999996 25.39 26.26 20-24 23.405 25.61 25.1 25.885 25-29 23.005 25.64 24.81 26.545 30-34 23.64 26.27 24.87 25.22 35-39 23.849999999999998 25.36 25.040000000000003 25.75 40-44 23.665 25.19 24.695 26.450000000000003 45-49 23.119999999999997 25.95 24.87 26.06 50-54 23.255 25.645 24.795 26.305 55-59 24.240000000000002 24.925 24.615000000000002 26.22 60-64 23.405 25.595000000000002 24.72 26.279999999999998 65-69 23.64 25.230000000000004 24.685000000000002 26.445 70-74 23.87 25.174999999999997 24.62 26.334999999999997 75-79 23.995 25.130000000000003 24.4 26.474999999999998 80-84 23.64 24.595 25.385 26.38 85-89 23.915 25.1 24.77 26.215 90-94 23.93 25.224999999999998 24.85 25.995 95-99 23.355 25.285000000000004 24.45 26.91 100-104 24.169999999999998 24.955 24.715 26.16 105-109 24.275 24.395 25.03 26.3 110-114 23.625 24.72 25.330000000000002 26.325 115-119 24.490000000000002 24.5 24.715 26.295 120-124 24.43 24.5 24.445 26.625 125-129 24.65 24.32 24.73 26.3 130-134 24.505 24.855 24.065 26.575 135-139 24.645 24.81 24.23 26.314999999999998 140-144 24.5 24.759999999999998 24.395 26.345000000000002 145-149 24.32 24.58 24.7 26.400000000000002 150-151 23.7375 23.7875 25.7 26.775 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.5 28 2.5 29 3.0 30 5.5 31 8.0 32 8.5 33 12.0 34 22.0 35 32.0 36 38.0 37 51.0 38 72.5 39 91.5 40 111.0 41 142.0 42 156.5 43 169.5 44 184.5 45 196.0 46 197.0 47 178.0 48 189.5 49 201.5 50 191.5 51 173.5 52 146.5 53 120.5 54 111.5 55 101.5 56 100.5 57 101.0 58 86.5 59 90.0 60 81.0 61 67.5 62 70.0 63 62.0 64 57.0 65 51.0 66 38.5 67 46.5 68 47.5 69 35.0 70 32.0 71 26.5 72 23.5 73 16.5 74 10.5 75 11.0 76 7.0 77 5.5 78 3.0 79 3.0 80 3.0 81 1.0 82 1.0 83 1.5 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.15 #Duplication Level Percentage of deduplicated Percentage of total 1 93.50509930220076 87.1 2 5.770263016639828 10.75 3 0.6172839506172839 1.725 4 0.08051529790660225 0.3 5 0.026838432635534086 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.1875 0.0 0.0 0.0 0.0 114-115 0.21250000000000002 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.3 0.0 0.0 0.0 0.0 120-121 0.325 0.0 0.0 0.0 0.0 122-123 0.3875 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.525 0.0 0.0 0.0 0.0 128-129 0.5625 0.0 0.0 0.0 0.0 130-131 0.6125 0.0 0.0 0.0 0.0 132-133 0.75 0.0 0.0 0.0 0.0 134-135 0.8875 0.0 0.0 0.0 0.0 136-137 0.9875 0.0 0.0 0.0 0.0 138-139 1.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804133 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804133_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.261 37.0 37.0 37.0 37.0 37.0 2 36.0245 37.0 37.0 37.0 37.0 37.0 3 36.02 37.0 37.0 37.0 37.0 37.0 4 36.205 37.0 37.0 37.0 37.0 37.0 5 36.101 37.0 37.0 37.0 37.0 37.0 6 36.1575 37.0 37.0 37.0 37.0 37.0 7 35.897 37.0 37.0 37.0 37.0 37.0 8 36.204 37.0 37.0 37.0 37.0 37.0 9 36.064 37.0 37.0 37.0 37.0 37.0 10-14 36.093599999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.006899999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.04880000000001 37.0 37.0 37.0 37.0 37.0 25-29 35.9748 37.0 37.0 37.0 37.0 37.0 30-34 36.0116 37.0 37.0 37.0 37.0 37.0 35-39 35.9226 37.0 37.0 37.0 37.0 37.0 40-44 35.823699999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.8054 37.0 37.0 37.0 37.0 37.0 50-54 35.8283 37.0 37.0 37.0 37.0 37.0 55-59 35.730599999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.7602 37.0 37.0 37.0 37.0 37.0 65-69 35.6824 37.0 37.0 37.0 37.0 37.0 70-74 35.7225 37.0 37.0 37.0 37.0 37.0 75-79 35.6872 37.0 37.0 37.0 37.0 37.0 80-84 35.681 37.0 37.0 37.0 37.0 37.0 85-89 35.630700000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.5977 37.0 37.0 37.0 37.0 37.0 95-99 35.5432 37.0 37.0 37.0 37.0 37.0 100-104 35.494699999999995 37.0 37.0 37.0 34.6 37.0 105-109 35.4356 37.0 37.0 37.0 37.0 37.0 110-114 35.3042 37.0 37.0 37.0 32.2 37.0 115-119 35.345299999999995 37.0 37.0 37.0 34.6 37.0 120-124 35.32000000000001 37.0 37.0 37.0 32.2 37.0 125-129 35.163 37.0 37.0 37.0 25.0 37.0 130-134 35.306799999999996 37.0 37.0 37.0 34.6 37.0 135-139 35.156499999999994 37.0 37.0 37.0 27.4 37.0 140-144 35.1352 37.0 37.0 37.0 27.4 37.0 145-149 35.006299999999996 37.0 37.0 37.0 25.0 37.0 150-151 34.58425 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 4.0 14 12.0 15 2.0 16 4.0 17 2.0 18 1.0 19 3.0 20 5.0 21 3.0 22 9.0 23 7.0 24 4.0 25 12.0 26 11.0 27 14.0 28 20.0 29 25.0 30 35.0 31 53.0 32 68.0 33 123.0 34 203.0 35 609.0 36 2566.0 37 203.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.643321660830416 20.135067533766886 11.605802901450724 31.615807903951975 2 32.300000000000004 22.075 25.624999999999996 20.0 3 25.7 24.349999999999998 26.724999999999998 23.225 4 26.75 29.5 19.525000000000002 24.224999999999998 5 29.5 31.2 17.549999999999997 21.75 6 22.625 34.699999999999996 18.175 24.5 7 23.225 20.025000000000002 31.825 24.925 8 25.5 23.05 21.925 29.525000000000002 9 24.025 22.825 25.324999999999996 27.825 10-14 27.01 24.685000000000002 21.875 26.43 15-19 26.479999999999997 24.11 23.21 26.200000000000003 20-24 26.02 24.545 23.59 25.845000000000002 25-29 26.39 24.385 23.1 26.125 30-34 26.305 24.765 23.13 25.8 35-39 26.640000000000004 24.95 23.155 25.255 40-44 26.875 24.565 23.080000000000002 25.480000000000004 45-49 26.52 24.73 23.5 25.25 50-54 26.965 24.654999999999998 23.355 25.025 55-59 26.979999999999997 24.705 22.395 25.919999999999998 60-64 26.229999999999997 24.645 23.535 25.590000000000003 65-69 26.895000000000003 25.259999999999998 22.5 25.345000000000002 70-74 27.26 24.46 23.200000000000003 25.080000000000002 75-79 27.21 24.6 23.345 24.845 80-84 26.745 24.88 23.189999999999998 25.185000000000002 85-89 27.18 24.395 23.325000000000003 25.1 90-94 26.200000000000003 24.675 23.91 25.215 95-99 27.49 24.79 23.25 24.47 100-104 27.215 24.79 23.29 24.705 105-109 26.165 24.54 24.54 24.755 110-114 26.935 24.825 23.400000000000002 24.84 115-119 27.195000000000004 24.72 23.555 24.529999999999998 120-124 26.669999999999998 24.77 24.04 24.52 125-129 26.58 25.0 23.89 24.529999999999998 130-134 26.655 25.374999999999996 24.025 23.945 135-139 26.650000000000002 24.97 23.9 24.48 140-144 26.61 25.22 24.315 23.855 145-149 27.265 24.725 24.15 23.86 150-151 26.875 24.837500000000002 23.925 24.3625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 1.0 10 0.5 11 0.5 12 1.0 13 1.0 14 0.5 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 1.5 25 0.0 26 0.5 27 1.5 28 1.0 29 2.0 30 3.5 31 2.5 32 3.5 33 7.5 34 11.0 35 15.0 36 25.5 37 44.0 38 48.0 39 59.5 40 93.0 41 112.0 42 129.5 43 144.5 44 151.0 45 174.5 46 200.0 47 189.0 48 181.0 49 172.5 50 153.5 51 155.0 52 146.5 53 137.5 54 128.0 55 100.0 56 87.0 57 96.5 58 101.5 59 92.5 60 87.0 61 84.0 62 72.5 63 70.5 64 72.0 65 78.0 66 76.5 67 62.5 68 58.5 69 61.5 70 57.5 71 46.0 72 39.0 73 38.0 74 32.0 75 22.0 76 18.5 77 12.5 78 4.5 79 3.0 80 2.5 81 1.5 82 1.0 83 0.5 84 1.0 85 0.5 86 0.5 87 1.5 88 1.0 89 0.0 90 0.0 91 0.0 92 1.0 93 2.0 94 1.0 95 0.0 96 0.0 97 0.5 98 1.0 99 1.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.075 #Duplication Level Percentage of deduplicated Percentage of total 1 93.49986569970454 87.02499999999999 2 5.748052645715821 10.7 3 0.6446414182111201 1.7999999999999998 4 0.08058017727639001 0.3 5 0.0 0.0 6 0.0 0.0 7 0.026860059092130004 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.1875 0.0 0.0 0.0 0.0 114-115 0.21250000000000002 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.3 0.0 0.0 0.0 0.0 120-121 0.325 0.0 0.0 0.0 0.0 122-123 0.3875 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.525 0.0 0.0 0.0 0.0 128-129 0.5625 0.0 0.0 0.0 0.0 130-131 0.6125 0.0 0.0 0.0 0.0 132-133 0.75 0.0 0.0 0.0 0.0 134-135 0.8875 0.0 0.0 0.0 0.0 136-137 0.9875 0.0 0.0 0.0 0.0 138-139 1.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGCCG 10 0.006830828 145.0 7 AAAAAAT 10 0.006830828 145.0 1 CCGCCGC 20 3.5877043E-4 108.75 6 >>END_MODULE Read 1584977 spots for SRR7804133.sra Written 1584977 spots for SRR7804133.sra Read 1584977 spots for SRR7804133.sra Written 1584977 spots for SRR7804133.sra Read 1584977 spots for SRR7804133.sra Written 1584977 spots for SRR7804133.sra Read 1584977 spots for SRR7804133.sra Written 1584977 spots for SRR7804133.sra Read 1584977 spots for SRR7804133.sra Written 1584977 spots for SRR7804133.sra Read 1584977 spots for SRR7804133.sra Written 1584977 spots for SRR7804133.sra Read 1584977 spots for SRR7804133.sra Written 1584977 spots for SRR7804133.sra Read 1584977 spots for SRR7804133.sra Written 1584977 spots for SRR7804133.sra Read 1584977 spots for SRR7804133.sra Written 1584977 spots for SRR7804133.sra Read 1584977 spots for SRR7804133.sra Written 1584977 spots for SRR7804133.sra Read 1584977 spots for SRR7804133.sra Written 1584977 spots for SRR7804133.sra Read 1584977 spots for SRR7804133.sra Written 1584977 spots for SRR7804133.sra Read 1584977 spots for SRR7804133.sra Written 1584977 spots for SRR7804133.sra Read 1584977 spots for SRR7804133.sra Written 1584977 spots for SRR7804133.sra Read 1584977 spots for SRR7804133.sra Written 1584977 spots for SRR7804133.sra Read 1584978 spots for SRR7804133.sra Written 1584978 spots for SRR7804133.sra Read 1584977 spots for SRR7804133.sra Written 1584977 spots for SRR7804133.sra Read 1584977 spots for SRR7804133.sra Written 1584977 spots for SRR7804133.sra Read 1584977 spots for SRR7804133.sra Written 1584977 spots for SRR7804133.sra Read 1584977 spots for SRR7804133.sra Written 1584977 spots for SRR7804133.sra SRR ids: ['SRR7804133.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u0nkd4uo SRR7804133.sra spots: 31699541 blocks: [[1, 1584977], [1584978, 3169954], [3169955, 4754931], [4754932, 6339908], [6339909, 7924885], [7924886, 9509862], [9509863, 11094839], [11094840, 12679816], [12679817, 14264793], [14264794, 15849770], [15849771, 17434747], [17434748, 19019724], [19019725, 20604701], [20604702, 22189678], [22189679, 23774655], [23774656, 25359632], [25359633, 26944609], [26944610, 28529586], [28529587, 30114563], [30114564, 31699541]] SRR7804133 file size 10720233 SRR7804133 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804133 SRR7804133_1.fastq SRR7804133_2.fastq Input file: SRR7804133_1.fastq Paired file: SRR7804133_2.fastq trimmed: SRR7804133-trimmed-pair1.fastq, SRR7804133-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:23:03 2024 >> started Tue Dec 10 02:23:37 2024 >> done (33.918s) 31699541 read pairs processed; of these: 126 ( 0.00%) short read pairs filtered out after trimming by size control 464 ( 0.00%) empty read pairs filtered out after trimming by size control 31698951 (100.00%) read pairs available; of these: 751375 ( 2.37%) trimmed read pairs available after processing 30947576 (97.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 8 0.00% 20 19 0.00% 21 18 0.00% 22 21 0.00% 23 14 0.00% 24 17 0.00% 25 15 0.00% 26 21 0.00% 27 21 0.00% 28 27 0.00% 29 34 0.00% 30 15 0.00% 31 28 0.00% 32 44 0.00% 33 27 0.00% 34 26 0.00% 35 35 0.00% 36 26 0.00% 37 32 0.00% 38 43 0.00% 39 40 0.00% 40 38 0.00% 41 30 0.00% 42 55 0.00% 43 43 0.00% 44 40 0.00% 45 32 0.00% 46 40 0.00% 47 47 0.00% 48 52 0.00% 49 44 0.00% 50 42 0.00% 51 49 0.00% 52 51 0.00% 53 45 0.00% 54 50 0.00% 55 55 0.00% 56 74 0.00% 57 69 0.00% 58 64 0.00% 59 63 0.00% 60 66 0.00% 61 67 0.00% 62 63 0.00% 63 69 0.00% 64 92 0.00% 65 69 0.00% 66 94 0.00% 67 78 0.00% 68 113 0.00% 69 105 0.00% 70 114 0.00% 71 134 0.00% 72 139 0.00% 73 159 0.00% 74 163 0.00% 75 156 0.00% 76 192 0.00% 77 181 0.00% 78 190 0.00% 79 229 0.00% 80 239 0.00% 81 334 0.00% 82 372 0.00% 83 411 0.00% 84 418 0.00% 85 522 0.00% 86 551 0.00% 87 620 0.00% 88 682 0.00% 89 738 0.00% 90 778 0.00% 91 870 0.00% 92 1001 0.00% 93 1068 0.00% 94 1221 0.00% 95 1374 0.00% 96 1498 0.00% 97 1561 0.00% 98 1742 0.01% 99 1950 0.01% 100 2143 0.01% 101 2322 0.01% 102 2692 0.01% 103 2725 0.01% 104 3055 0.01% 105 3325 0.01% 106 3693 0.01% 107 3771 0.01% 108 3891 0.01% 109 4302 0.01% 110 4514 0.01% 111 5063 0.02% 112 5466 0.02% 113 5808 0.02% 114 6267 0.02% 115 6619 0.02% 116 7151 0.02% 117 7472 0.02% 118 7829 0.02% 119 8236 0.03% 120 8702 0.03% 121 9181 0.03% 122 9971 0.03% 123 10750 0.03% 124 11329 0.04% 125 12012 0.04% 126 12730 0.04% 127 13308 0.04% 128 13612 0.04% 129 14355 0.05% 130 14919 0.05% 131 15302 0.05% 132 16528 0.05% 133 17489 0.06% 134 18627 0.06% 135 19804 0.06% 136 20468 0.06% 137 21293 0.07% 138 22065 0.07% 139 22948 0.07% 140 23701 0.07% 141 24741 0.08% 142 26185 0.08% 143 26997 0.09% 144 28180 0.09% 145 29825 0.09% 146 31351 0.10% 147 33057 0.10% 148 33128 0.10% 149 34805 0.11% 150 35718 0.11% 151 30947576 97.63% 31698951 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=32 prefix-density=0.44 prefix-fanout=2.8 sequence=TGCCGCACTTGCAG criterion=fanout-score sequence-density=0.10 sequence-density-rank=9 fanout-score=323.17 fanout-score-rank=1 prefix-density=1.07 prefix-fanout=30.1 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=31 prefix-density=1.22 prefix-fanout=1.2 sequence=CAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAGTGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=816.41 fanout-score-rank=1 prefix-density=1.07 prefix-fanout=19.1 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR7804133 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:24:27 Started mapping on | Dec 10 02:24:28 Finished on | Dec 10 02:30:05 Mapping speed, Million of reads per hour | 338.62 Number of input reads | 31698951 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 28822782 Uniquely mapped reads % | 90.93% Average mapped length | 299.85 Number of splices: Total | 29703188 Number of splices: Annotated (sjdb) | 27882334 Number of splices: GT/AG | 29266458 Number of splices: GC/AG | 338786 Number of splices: AT/AC | 25169 Number of splices: Non-canonical | 72775 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.97 Insertion rate per base | 0.02% Insertion average length | 2.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 496777 % of reads mapped to multiple loci | 1.57% Number of reads mapped to too many loci | 30346 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.70% % of reads unmapped: other | 0.71% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2379392 2379392 2379392 N_multimapping 496777 496777 496777 N_noFeature 729868 28075074 961769 N_ambiguous 615578 5035 103836 UnstrandedReadsAssigned:27477336 PositiveStrandReadsAssigned:742673 NegativeStrandReadsAssigned:27757177 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804133 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804133-trimmed-pair1.fastq SRR7804133-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,698,951 reads, 28,199,878 reads pseudoaligned [quant] estimated average fragment length: 302.537 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52973 SRR7804133.ke.tsv 35125 SRR7804133.se.tsv 88098 total ==> SRR7804133.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 635.035 5.32242e-08 3.79944e-09 PNS24247 1044 742.463 158.118 9.65417 PNS24249 1928 1626.46 297.386 8.28866 PNS24246 1044 742.463 158.118 9.65417 PNS24248 1044 742.463 158.118 9.65417 PNS24244 1471 1169.46 210.26 8.15037 PNS24243 293 71.6145 0 0 KQK14069 1603 1301.46 3526.18 122.823 KQK14071 474 199.817 19.2349 4.36381 ==> SRR7804133.se.tsv <== BRADI_1g14170v3 3602 BRADI_1g53295v3 1425 BRADI_1g59795v3 333 BRADI_1g07683v3 0 BRADI_1g00485v3 181 BRADI_1g20270v3 2963 BRADI_1g74790v3 70 BRADI_1g09890v3 0 BRADI_1g77505v3 416 BRADI_1g48960v3 0 SRR7804133 completed mapping pipeline successfully