Starting /dee2/code/volunteer_pipeline.sh SRR7804134 current disk space = 1525362319360 free memory = 1560270432 SRR7804134 SRAfilesize 667ef982ee3d61faa2d3eaf11a006934 SRR7804134.sra SRR7804134.sra file validated SRR7804134 is paired end SRR7804134 is conventional basespace SRR7804134 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804134_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.29 37.0 37.0 37.0 37.0 37.0 2 36.232 37.0 37.0 37.0 37.0 37.0 3 36.377 37.0 37.0 37.0 37.0 37.0 4 36.5055 37.0 37.0 37.0 37.0 37.0 5 36.495 37.0 37.0 37.0 37.0 37.0 6 36.432 37.0 37.0 37.0 37.0 37.0 7 36.425 37.0 37.0 37.0 37.0 37.0 8 36.467 37.0 37.0 37.0 37.0 37.0 9 36.4355 37.0 37.0 37.0 37.0 37.0 10-14 36.51370000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.4625 37.0 37.0 37.0 37.0 37.0 20-24 36.4759 37.0 37.0 37.0 37.0 37.0 25-29 36.445800000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.4357 37.0 37.0 37.0 37.0 37.0 35-39 36.4002 37.0 37.0 37.0 37.0 37.0 40-44 36.3949 37.0 37.0 37.0 37.0 37.0 45-49 36.353899999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.3413 37.0 37.0 37.0 37.0 37.0 55-59 36.336200000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.269999999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.2491 37.0 37.0 37.0 37.0 37.0 70-74 36.2145 37.0 37.0 37.0 37.0 37.0 75-79 36.232299999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.136900000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.154399999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.1158 37.0 37.0 37.0 37.0 37.0 95-99 36.103500000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.10020000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.013 37.0 37.0 37.0 37.0 37.0 110-114 35.9444 37.0 37.0 37.0 37.0 37.0 115-119 35.9816 37.0 37.0 37.0 37.0 37.0 120-124 35.961400000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.8328 37.0 37.0 37.0 37.0 37.0 130-134 35.773 37.0 37.0 37.0 37.0 37.0 135-139 35.813 37.0 37.0 37.0 37.0 37.0 140-144 35.6734 37.0 37.0 37.0 37.0 37.0 145-149 35.7322 37.0 37.0 37.0 37.0 37.0 150-151 35.12425 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 3.0 24 0.0 25 4.0 26 6.0 27 7.0 28 14.0 29 22.0 30 32.0 31 39.0 32 69.0 33 107.0 34 130.0 35 309.0 36 2865.0 37 392.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.099999999999994 13.200000000000001 9.575 30.125 2 26.71507260891337 13.795693540310467 28.567851777666498 30.921382073109665 3 22.375 19.0 23.9 34.725 4 25.6 23.7 21.975 28.725 5 26.55 25.025 22.95 25.474999999999998 6 24.375 29.599999999999998 22.900000000000002 23.125 7 19.400000000000002 25.75 36.175000000000004 18.675 8 21.15 25.674999999999997 27.450000000000003 25.724999999999998 9 20.225 23.775 31.6 24.4 10-14 23.14 26.275 24.935 25.650000000000002 15-19 23.25 25.259999999999998 25.46 26.029999999999998 20-24 23.9 25.765 25.124999999999996 25.21 25-29 22.96 25.645 24.965 26.43 30-34 23.62 25.945 24.625 25.81 35-39 23.48 25.69 25.185000000000002 25.645 40-44 24.095 25.165 25.145 25.595000000000002 45-49 24.05 24.985 24.77 26.195 50-54 23.935000000000002 24.89 25.395 25.779999999999998 55-59 24.21 25.25 25.005 25.535000000000004 60-64 23.5 24.995 25.06 26.445 65-69 23.625 25.245 25.0 26.13 70-74 23.585 24.98 25.185000000000002 26.25 75-79 23.95 25.285000000000004 24.435000000000002 26.33 80-84 24.26 24.925 24.48 26.334999999999997 85-89 23.78 24.985 25.21 26.025 90-94 23.955000000000002 25.130000000000003 23.73 27.185 95-99 23.775 24.455 24.654999999999998 27.115000000000002 100-104 24.240000000000002 25.09 24.445 26.224999999999998 105-109 24.11 24.19 24.52 27.18 110-114 24.005000000000003 25.03 24.755 26.21 115-119 24.195 24.635 24.654999999999998 26.515 120-124 24.94 24.834999999999997 24.375 25.85 125-129 24.42 24.625 24.965 25.990000000000002 130-134 24.755 24.555 24.535 26.155 135-139 24.834999999999997 24.035 23.84 27.29 140-144 24.665 23.69 24.965 26.68 145-149 25.230000000000004 24.505 24.305 25.96 150-151 24.0 23.9375 24.6 27.462500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 1.0 27 2.0 28 4.0 29 4.0 30 5.0 31 9.0 32 15.5 33 20.0 34 27.5 35 41.0 36 48.0 37 60.0 38 75.5 39 93.0 40 119.5 41 137.0 42 148.0 43 153.0 44 171.5 45 180.5 46 181.5 47 186.5 48 180.5 49 188.5 50 197.0 51 175.5 52 137.5 53 129.0 54 127.0 55 103.0 56 93.5 57 90.0 58 73.5 59 78.0 60 78.0 61 62.5 62 56.0 63 52.5 64 54.5 65 48.0 66 45.0 67 53.0 68 46.5 69 39.5 70 40.5 71 36.0 72 25.5 73 22.5 74 19.0 75 15.5 76 15.5 77 11.0 78 6.5 79 3.5 80 2.0 81 2.0 82 1.5 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.15 #Duplication Level Percentage of deduplicated Percentage of total 1 92.34943027672273 85.1 2 6.94519804666305 12.8 3 0.5697232772653282 1.575 4 0.10851871947911015 0.4 5 0.02712967986977754 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAAATAAGGGCCTAGCTTGTGCAGCTAGCCTTGGATCGGTTCATGGTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.7875000000000001 0.0 0.0 0.0 0.0 128-129 0.9 0.0 0.0 0.0 0.0 130-131 0.9624999999999999 0.0 0.0 0.0 0.0 132-133 1.0 0.0 0.0 0.0 0.0 134-135 1.125 0.0 0.0 0.0 0.0 136-137 1.2999999999999998 0.0 0.0 0.0 0.0 138-139 1.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804134 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804134_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.267 37.0 37.0 37.0 37.0 37.0 2 35.988 37.0 37.0 37.0 37.0 37.0 3 36.025 37.0 37.0 37.0 37.0 37.0 4 36.0265 37.0 37.0 37.0 37.0 37.0 5 35.955 37.0 37.0 37.0 37.0 37.0 6 36.025 37.0 37.0 37.0 37.0 37.0 7 35.9475 37.0 37.0 37.0 37.0 37.0 8 36.113 37.0 37.0 37.0 37.0 37.0 9 36.016 37.0 37.0 37.0 37.0 37.0 10-14 35.980599999999995 37.0 37.0 37.0 37.0 37.0 15-19 35.903999999999996 37.0 37.0 37.0 37.0 37.0 20-24 35.8608 37.0 37.0 37.0 37.0 37.0 25-29 35.8516 37.0 37.0 37.0 37.0 37.0 30-34 35.852199999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.827999999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.7779 37.0 37.0 37.0 37.0 37.0 45-49 35.6734 37.0 37.0 37.0 37.0 37.0 50-54 35.6448 37.0 37.0 37.0 37.0 37.0 55-59 35.6192 37.0 37.0 37.0 37.0 37.0 60-64 35.5715 37.0 37.0 37.0 37.0 37.0 65-69 35.534000000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.5839 37.0 37.0 37.0 37.0 37.0 75-79 35.5724 37.0 37.0 37.0 37.0 37.0 80-84 35.521100000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.5527 37.0 37.0 37.0 37.0 37.0 90-94 35.516799999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.4127 37.0 37.0 37.0 37.0 37.0 100-104 35.3762 37.0 37.0 37.0 37.0 37.0 105-109 35.359399999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.269 37.0 37.0 37.0 32.2 37.0 115-119 35.2735 37.0 37.0 37.0 32.2 37.0 120-124 35.2218 37.0 37.0 37.0 32.2 37.0 125-129 35.0234 37.0 37.0 37.0 25.0 37.0 130-134 35.1496 37.0 37.0 37.0 32.2 37.0 135-139 35.054500000000004 37.0 37.0 37.0 25.0 37.0 140-144 35.074099999999994 37.0 37.0 37.0 25.0 37.0 145-149 34.9094 37.0 37.0 37.0 25.0 37.0 150-151 34.356750000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 6.0 14 6.0 15 10.0 16 2.0 17 6.0 18 6.0 19 6.0 20 8.0 21 13.0 22 13.0 23 16.0 24 10.0 25 8.0 26 9.0 27 17.0 28 15.0 29 26.0 30 25.0 31 48.0 32 71.0 33 107.0 34 206.0 35 530.0 36 2626.0 37 207.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.025 21.0 10.8 28.175 2 32.15 24.224999999999998 22.125 21.5 3 25.35 26.025 25.275 23.35 4 27.05 30.175 19.625 23.150000000000002 5 28.375 32.05 17.825 21.75 6 25.8 33.45 18.575 22.175 7 25.525 17.925 31.35 25.2 8 25.525 23.200000000000003 21.075 30.2 9 24.2 24.0 24.3 27.500000000000004 10-14 27.165 25.7 21.855 25.28 15-19 26.419999999999998 24.905 22.67 26.005 20-24 26.19 25.28 22.64 25.89 25-29 26.384999999999998 25.0 22.5 26.115 30-34 26.169999999999998 25.71 23.244999999999997 24.875 35-39 26.955000000000002 24.755 23.244999999999997 25.045 40-44 26.36 24.77 23.03 25.840000000000003 45-49 27.389999999999997 25.685000000000002 22.6 24.325 50-54 26.75 25.445 22.735 25.069999999999997 55-59 27.805000000000003 25.06 22.515 24.62 60-64 26.38 25.745 23.125 24.75 65-69 26.96 24.865000000000002 23.105 25.069999999999997 70-74 26.840000000000003 25.195 23.11 24.855 75-79 26.21 24.85 23.445 25.495 80-84 26.645000000000003 25.1 23.445 24.81 85-89 27.084999999999997 25.31 22.79 24.815 90-94 26.555 25.645 22.795 25.005 95-99 26.224999999999998 25.480000000000004 23.45 24.845 100-104 26.745 24.895 23.294999999999998 25.064999999999998 105-109 27.0 25.290000000000003 22.830000000000002 24.88 110-114 27.02 25.0 23.39 24.59 115-119 26.93 25.509999999999998 22.905 24.654999999999998 120-124 26.979999999999997 26.029999999999998 22.509999999999998 24.48 125-129 26.495 26.235000000000003 22.884999999999998 24.385 130-134 26.905 25.53 23.405 24.16 135-139 27.065 25.485000000000003 23.315 24.135 140-144 27.0 25.835 23.45 23.715 145-149 26.605 25.345000000000002 23.64 24.41 150-151 26.6125 24.9875 23.5 24.9 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 1.0 10 1.5 11 0.5 12 1.0 13 1.0 14 1.0 15 1.5 16 1.0 17 1.5 18 2.0 19 2.5 20 1.5 21 0.5 22 1.5 23 1.5 24 1.0 25 1.0 26 3.0 27 5.0 28 5.5 29 4.5 30 4.0 31 8.0 32 12.0 33 13.5 34 17.5 35 20.0 36 30.0 37 44.5 38 55.5 39 64.0 40 84.0 41 105.0 42 119.5 43 139.0 44 158.5 45 167.5 46 178.0 47 192.0 48 178.5 49 165.5 50 155.5 51 136.0 52 135.5 53 141.0 54 137.0 55 116.5 56 100.5 57 97.5 58 93.0 59 94.0 60 82.0 61 76.5 62 80.0 63 81.5 64 77.5 65 74.5 66 68.0 67 63.5 68 66.5 69 55.5 70 45.0 71 46.5 72 45.0 73 33.0 74 22.5 75 16.5 76 14.0 77 8.5 78 4.0 79 3.5 80 2.5 81 2.5 82 3.0 83 1.5 84 0.5 85 1.0 86 1.0 87 1.0 88 0.5 89 0.0 90 0.5 91 0.5 92 0.5 93 1.5 94 1.5 95 1.0 96 1.0 97 0.5 98 0.0 99 0.5 100 6.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.625 #Duplication Level Percentage of deduplicated Percentage of total 1 92.36016371077763 84.625 2 6.8212824010914055 12.5 3 0.6548431105047748 1.7999999999999998 4 0.08185538881309685 0.3 5 0.027285129604365622 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.027285129604365622 0.22499999999999998 >10 0.027285129604365622 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 17 0.42500000000000004 No Hit GAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAA 9 0.22499999999999998 No Hit GAAACATCCTTAACTGAGCTCCTCACTCACTCACTGCAGCTAGCCTCTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.7875000000000001 0.0 0.0 0.0 0.0 128-129 0.9 0.0 0.0 0.0 0.0 130-131 0.975 0.0 0.0 0.0 0.0 132-133 1.025 0.0 0.0 0.0 0.0 134-135 1.15 0.0 0.0 0.0 0.0 136-137 1.3250000000000002 0.0 0.0 0.0 0.0 138-139 1.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1774949 spots for SRR7804134.sra Written 1774949 spots for SRR7804134.sra Read 1774949 spots for SRR7804134.sra Written 1774949 spots for SRR7804134.sra Read 1774949 spots for SRR7804134.sra Written 1774949 spots for SRR7804134.sra Read 1774949 spots for SRR7804134.sra Written 1774949 spots for SRR7804134.sra Read 1774949 spots for SRR7804134.sra Written 1774949 spots for SRR7804134.sra Read 1774949 spots for SRR7804134.sra Written 1774949 spots for SRR7804134.sra Read 1774958 spots for SRR7804134.sra Written 1774958 spots for SRR7804134.sra Read 1774949 spots for SRR7804134.sra Written 1774949 spots for SRR7804134.sra Read 1774949 spots for SRR7804134.sra Written 1774949 spots for SRR7804134.sra Read 1774949 spots for SRR7804134.sra Written 1774949 spots for SRR7804134.sra Read 1774949 spots for SRR7804134.sra Written 1774949 spots for SRR7804134.sra Read 1774949 spots for SRR7804134.sra Written 1774949 spots for SRR7804134.sra Read 1774949 spots for SRR7804134.sra Written 1774949 spots for SRR7804134.sra Read 1774949 spots for SRR7804134.sra Written 1774949 spots for SRR7804134.sra Read 1774949 spots for SRR7804134.sra Written 1774949 spots for SRR7804134.sra Read 1774949 spots for SRR7804134.sra Written 1774949 spots for SRR7804134.sra Read 1774949 spots for SRR7804134.sra Written 1774949 spots for SRR7804134.sra Read 1774949 spots for SRR7804134.sra Written 1774949 spots for SRR7804134.sra Read 1774949 spots for SRR7804134.sra Written 1774949 spots for SRR7804134.sra Read 1774949 spots for SRR7804134.sra Written 1774949 spots for SRR7804134.sra SRR ids: ['SRR7804134.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n1iwznev SRR7804134.sra spots: 35498989 blocks: [[1, 1774949], [1774950, 3549898], [3549899, 5324847], [5324848, 7099796], [7099797, 8874745], [8874746, 10649694], [10649695, 12424643], [12424644, 14199592], [14199593, 15974541], [15974542, 17749490], [17749491, 19524439], [19524440, 21299388], [21299389, 23074337], [23074338, 24849286], [24849287, 26624235], [26624236, 28399184], [28399185, 30174133], [30174134, 31949082], [31949083, 33724031], [33724032, 35498989]] SRR7804134 file size 12007742 SRR7804134 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804134 SRR7804134_1.fastq SRR7804134_2.fastq Input file: SRR7804134_1.fastq Paired file: SRR7804134_2.fastq trimmed: SRR7804134-trimmed-pair1.fastq, SRR7804134-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:26:20 2024 >> started Tue Dec 10 02:27:03 2024 >> done (42.582s) 35498989 read pairs processed; of these: 180 ( 0.00%) short read pairs filtered out after trimming by size control 1355 ( 0.00%) empty read pairs filtered out after trimming by size control 35497454 (100.00%) read pairs available; of these: 964849 ( 2.72%) trimmed read pairs available after processing 34532605 (97.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 17 0.00% 20 14 0.00% 21 17 0.00% 22 28 0.00% 23 38 0.00% 24 27 0.00% 25 18 0.00% 26 22 0.00% 27 23 0.00% 28 30 0.00% 29 28 0.00% 30 38 0.00% 31 28 0.00% 32 32 0.00% 33 33 0.00% 34 23 0.00% 35 50 0.00% 36 27 0.00% 37 47 0.00% 38 65 0.00% 39 35 0.00% 40 33 0.00% 41 50 0.00% 42 55 0.00% 43 53 0.00% 44 54 0.00% 45 54 0.00% 46 50 0.00% 47 55 0.00% 48 53 0.00% 49 48 0.00% 50 46 0.00% 51 66 0.00% 52 54 0.00% 53 67 0.00% 54 60 0.00% 55 74 0.00% 56 65 0.00% 57 89 0.00% 58 86 0.00% 59 74 0.00% 60 83 0.00% 61 79 0.00% 62 76 0.00% 63 71 0.00% 64 90 0.00% 65 104 0.00% 66 121 0.00% 67 122 0.00% 68 135 0.00% 69 152 0.00% 70 150 0.00% 71 161 0.00% 72 206 0.00% 73 183 0.00% 74 216 0.00% 75 229 0.00% 76 280 0.00% 77 311 0.00% 78 340 0.00% 79 395 0.00% 80 394 0.00% 81 444 0.00% 82 545 0.00% 83 587 0.00% 84 661 0.00% 85 690 0.00% 86 828 0.00% 87 914 0.00% 88 985 0.00% 89 1057 0.00% 90 1288 0.00% 91 1290 0.00% 92 1526 0.00% 93 1740 0.00% 94 1921 0.01% 95 2095 0.01% 96 2292 0.01% 97 2528 0.01% 98 2701 0.01% 99 2926 0.01% 100 3221 0.01% 101 3484 0.01% 102 3796 0.01% 103 4186 0.01% 104 4562 0.01% 105 4815 0.01% 106 5197 0.01% 107 5418 0.02% 108 5851 0.02% 109 6389 0.02% 110 6796 0.02% 111 6961 0.02% 112 7591 0.02% 113 8095 0.02% 114 9002 0.03% 115 9460 0.03% 116 9717 0.03% 117 10431 0.03% 118 10870 0.03% 119 11443 0.03% 120 12140 0.03% 121 12635 0.04% 122 13406 0.04% 123 14175 0.04% 124 15189 0.04% 125 15818 0.04% 126 16693 0.05% 127 17558 0.05% 128 17739 0.05% 129 18907 0.05% 130 19437 0.05% 131 20103 0.06% 132 21607 0.06% 133 22684 0.06% 134 23364 0.07% 135 24824 0.07% 136 26157 0.07% 137 26696 0.08% 138 27414 0.08% 139 28628 0.08% 140 29333 0.08% 141 30720 0.09% 142 32130 0.09% 143 33272 0.09% 144 35018 0.10% 145 36724 0.10% 146 38024 0.11% 147 39953 0.11% 148 39893 0.11% 149 41780 0.12% 150 42793 0.12% 151 34532605 97.28% 35497454 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.22 fanout-score-rank=32 prefix-density=0.49 prefix-fanout=2.9 sequence=TGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCTTCGGTCGAGTGCTCGAACTTGCTTAGGAAGAAGATTAAGCTGAAGGCTTCTAGGCTTGTGTGTGCTTCT criterion=fanout-score sequence-density=0.08 sequence-density-rank=16 fanout-score=105.87 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=16.0 sequence=GGCGGCGGCGGCCTCGAAGCCTGACTTGGTCGCCGGCGGCGCAACGCCCATGAC criterion=sequence-density sequence-density=1.27 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=27 prefix-density=1.36 prefix-fanout=2.5 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=984.99 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=20.2 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAA SRR7804134 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:27:56 Started mapping on | Dec 10 02:27:56 Finished on | Dec 10 02:36:32 Mapping speed, Million of reads per hour | 247.66 Number of input reads | 35497454 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 31337465 Uniquely mapped reads % | 88.28% Average mapped length | 299.61 Number of splices: Total | 31490784 Number of splices: Annotated (sjdb) | 29533383 Number of splices: GT/AG | 31026900 Number of splices: GC/AG | 356615 Number of splices: AT/AC | 26929 Number of splices: Non-canonical | 80340 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 3.05 Insertion rate per base | 0.02% Insertion average length | 2.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 512279 % of reads mapped to multiple loci | 1.44% Number of reads mapped to too many loci | 29802 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.54% % of reads unmapped: other | 0.65% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3647710 3647710 3647710 N_multimapping 512279 512279 512279 N_noFeature 863008 30490681 1147059 N_ambiguous 670535 6038 111676 UnstrandedReadsAssigned:29803922 PositiveStrandReadsAssigned:840746 NegativeStrandReadsAssigned:30078730 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804134 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804134-trimmed-pair1.fastq SRR7804134-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,497,454 reads, 30,775,676 reads pseudoaligned [quant] estimated average fragment length: 304.668 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,239 rounds 52973 SRR7804134.ke.tsv 35125 SRR7804134.se.tsv 88098 total ==> SRR7804134.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 632.964 0 0 PNS24247 1044 740.332 139.017 7.81567 PNS24249 1928 1624.33 353.744 9.06442 PNS24246 1044 740.332 139.017 7.81567 PNS24248 1044 740.332 139.017 7.81567 PNS24244 1471 1167.33 217.206 7.74468 PNS24243 293 73.0858 0 0 KQK14069 1603 1299.33 2518 80.6607 KQK14071 474 197.456 12.6739 2.67157 ==> SRR7804134.se.tsv <== BRADI_1g14170v3 2541 BRADI_1g53295v3 1862 BRADI_1g59795v3 470 BRADI_1g07683v3 0 BRADI_1g00485v3 212 BRADI_1g20270v3 3323 BRADI_1g74790v3 93 BRADI_1g09890v3 0 BRADI_1g77505v3 468 BRADI_1g48960v3 0 SRR7804134 completed mapping pipeline successfully