Starting /dee2/code/volunteer_pipeline.sh SRR7804135 current disk space = 1525559586816 free memory = 1599137504 SRR7804135 SRAfilesize dda7e5948233bd93757c700b28ac53fa SRR7804135.sra SRR7804135.sra file validated SRR7804135 is paired end SRR7804135 is conventional basespace SRR7804135 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804135_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.271 37.0 37.0 37.0 37.0 37.0 2 36.33975 37.0 37.0 37.0 37.0 37.0 3 36.3975 37.0 37.0 37.0 37.0 37.0 4 36.489 37.0 37.0 37.0 37.0 37.0 5 36.5865 37.0 37.0 37.0 37.0 37.0 6 36.478 37.0 37.0 37.0 37.0 37.0 7 36.4625 37.0 37.0 37.0 37.0 37.0 8 36.546 37.0 37.0 37.0 37.0 37.0 9 36.513 37.0 37.0 37.0 37.0 37.0 10-14 36.5042 37.0 37.0 37.0 37.0 37.0 15-19 36.510400000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.4605 37.0 37.0 37.0 37.0 37.0 25-29 36.467 37.0 37.0 37.0 37.0 37.0 30-34 36.4221 37.0 37.0 37.0 37.0 37.0 35-39 36.4006 37.0 37.0 37.0 37.0 37.0 40-44 36.4022 37.0 37.0 37.0 37.0 37.0 45-49 36.403800000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.3704 37.0 37.0 37.0 37.0 37.0 55-59 36.3492 37.0 37.0 37.0 37.0 37.0 60-64 36.3682 37.0 37.0 37.0 37.0 37.0 65-69 36.3524 37.0 37.0 37.0 37.0 37.0 70-74 36.288599999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.2909 37.0 37.0 37.0 37.0 37.0 80-84 36.2214 37.0 37.0 37.0 37.0 37.0 85-89 36.196 37.0 37.0 37.0 37.0 37.0 90-94 36.1954 37.0 37.0 37.0 37.0 37.0 95-99 36.1314 37.0 37.0 37.0 37.0 37.0 100-104 36.1342 37.0 37.0 37.0 37.0 37.0 105-109 36.13869999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.113299999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.0884 37.0 37.0 37.0 37.0 37.0 120-124 36.020900000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.9452 37.0 37.0 37.0 37.0 37.0 130-134 35.91160000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.88629999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.7705 37.0 37.0 37.0 37.0 37.0 145-149 35.782 37.0 37.0 37.0 37.0 37.0 150-151 35.27175 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 3.0 25 1.0 26 1.0 27 10.0 28 14.0 29 14.0 30 27.0 31 45.0 32 58.0 33 91.0 34 142.0 35 285.0 36 2894.0 37 412.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.0 12.174999999999999 9.45 34.375 2 26.231557889472366 12.55313828457114 30.457614403600903 30.75768942235559 3 22.725 16.5 22.75 38.025 4 26.200000000000003 22.3 22.0 29.5 5 26.875 25.7 23.05 24.375 6 25.074999999999996 29.725 21.725 23.474999999999998 7 18.575 24.6 36.425000000000004 20.4 8 21.675 25.0 27.474999999999998 25.85 9 20.25 22.225 30.65 26.875 10-14 23.16 25.44 25.835 25.564999999999998 15-19 23.31 24.654999999999998 25.545 26.490000000000002 20-24 23.95 24.85 24.89 26.31 25-29 23.835 25.035 25.025 26.105 30-34 24.44 24.33 24.865000000000002 26.365 35-39 23.76 24.205 25.240000000000002 26.795 40-44 23.865 24.44 24.91 26.784999999999997 45-49 23.735 24.825 24.55 26.889999999999997 50-54 24.560000000000002 24.85 24.27 26.32 55-59 24.69 24.345 24.755 26.21 60-64 23.555 24.895 24.45 27.1 65-69 24.41 24.16 24.565 26.865 70-74 24.795 24.73 24.09 26.384999999999998 75-79 25.040000000000003 24.279999999999998 24.224999999999998 26.455000000000002 80-84 23.905 24.759999999999998 24.625 26.71 85-89 24.545 24.83 24.43 26.195 90-94 24.099999999999998 23.79 24.79 27.32 95-99 24.43 23.365 25.074999999999996 27.13 100-104 24.310000000000002 24.279999999999998 24.595 26.815 105-109 24.26 23.71 24.625 27.405 110-114 24.955 23.905 24.785 26.355 115-119 25.155 23.615 24.7 26.529999999999998 120-124 25.21 24.115000000000002 23.849999999999998 26.825 125-129 24.865000000000002 23.875 24.095 27.165 130-134 25.085 23.18 24.67 27.065 135-139 25.424999999999997 24.11 23.865 26.6 140-144 24.685000000000002 23.915 24.175 27.224999999999998 145-149 25.319999999999997 23.76 23.765 27.155 150-151 25.0125 23.6875 23.9125 27.3875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 1.0 27 1.0 28 2.5 29 4.0 30 5.5 31 8.5 32 13.0 33 20.0 34 23.5 35 27.5 36 42.5 37 56.5 38 73.5 39 91.5 40 98.0 41 120.5 42 143.5 43 148.5 44 165.0 45 183.5 46 187.0 47 181.0 48 181.0 49 184.5 50 164.5 51 138.5 52 125.0 53 131.0 54 136.0 55 113.5 56 101.0 57 97.5 58 85.5 59 83.0 60 74.5 61 66.0 62 61.5 63 67.0 64 76.0 65 62.5 66 54.5 67 56.5 68 52.5 69 57.5 70 49.0 71 29.5 72 31.0 73 27.5 74 17.5 75 16.5 76 20.0 77 18.5 78 10.5 79 3.0 80 2.5 81 2.5 82 1.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.0 #Duplication Level Percentage of deduplicated Percentage of total 1 92.95698924731182 86.45 2 6.586021505376344 12.25 3 0.43010752688172044 1.2 4 0.026881720430107527 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.725 0.0 0.0 0.0 0.0 124-125 0.8 0.0 0.0 0.0 0.0 126-127 0.8875 0.0 0.0 0.0 0.0 128-129 1.1375000000000002 0.0 0.0 0.0 0.0 130-131 1.45 0.0 0.0 0.0 0.0 132-133 1.5875 0.0 0.0 0.0 0.0 134-135 1.775 0.0 0.0 0.0 0.0 136-137 1.9874999999999998 0.0 0.0 0.0 0.0 138-139 2.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804135 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804135_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.19 37.0 37.0 37.0 37.0 37.0 2 35.86 37.0 37.0 37.0 37.0 37.0 3 35.911 37.0 37.0 37.0 37.0 37.0 4 36.0605 37.0 37.0 37.0 37.0 37.0 5 35.8855 37.0 37.0 37.0 37.0 37.0 6 36.058 37.0 37.0 37.0 37.0 37.0 7 35.8415 37.0 37.0 37.0 37.0 37.0 8 36.0335 37.0 37.0 37.0 37.0 37.0 9 35.997 37.0 37.0 37.0 37.0 37.0 10-14 36.0209 37.0 37.0 37.0 37.0 37.0 15-19 35.94799999999999 37.0 37.0 37.0 37.0 37.0 20-24 35.979699999999994 37.0 37.0 37.0 37.0 37.0 25-29 35.9376 37.0 37.0 37.0 37.0 37.0 30-34 35.8846 37.0 37.0 37.0 37.0 37.0 35-39 35.897999999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.8494 37.0 37.0 37.0 37.0 37.0 45-49 35.7688 37.0 37.0 37.0 37.0 37.0 50-54 35.6981 37.0 37.0 37.0 37.0 37.0 55-59 35.6946 37.0 37.0 37.0 37.0 37.0 60-64 35.691199999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.587 37.0 37.0 37.0 37.0 37.0 70-74 35.6278 37.0 37.0 37.0 37.0 37.0 75-79 35.6049 37.0 37.0 37.0 37.0 37.0 80-84 35.5441 37.0 37.0 37.0 37.0 37.0 85-89 35.5653 37.0 37.0 37.0 37.0 37.0 90-94 35.6077 37.0 37.0 37.0 37.0 37.0 95-99 35.4795 37.0 37.0 37.0 37.0 37.0 100-104 35.50189999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.3505 37.0 37.0 37.0 37.0 37.0 110-114 35.287400000000005 37.0 37.0 37.0 34.6 37.0 115-119 35.328799999999994 37.0 37.0 37.0 34.6 37.0 120-124 35.261399999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.152 37.0 37.0 37.0 29.8 37.0 130-134 35.23610000000001 37.0 37.0 37.0 32.2 37.0 135-139 35.0987 37.0 37.0 37.0 25.0 37.0 140-144 35.151399999999995 37.0 37.0 37.0 27.4 37.0 145-149 34.927499999999995 37.0 37.0 37.0 25.0 37.0 150-151 34.369 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 6.0 14 6.0 15 8.0 16 4.0 17 2.0 18 4.0 19 8.0 20 4.0 21 8.0 22 15.0 23 4.0 24 12.0 25 8.0 26 13.0 27 13.0 28 18.0 29 21.0 30 30.0 31 46.0 32 70.0 33 111.0 34 217.0 35 612.0 36 2547.0 37 211.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.643321660830416 18.534267133566786 12.056028014007003 32.7663831915958 2 30.349999999999998 23.375 23.7 22.575 3 24.525 25.2 25.825 24.45 4 27.900000000000002 29.549999999999997 18.4 24.15 5 30.775000000000002 29.099999999999998 18.175 21.95 6 26.400000000000002 34.849999999999994 16.900000000000002 21.85 7 24.7 20.175 31.525 23.599999999999998 8 26.0 22.5 22.95 28.549999999999997 9 25.224999999999998 21.175 26.35 27.250000000000004 10-14 26.56 25.31 21.54 26.590000000000003 15-19 26.69 24.215 22.745 26.35 20-24 26.205000000000002 25.040000000000003 22.655 26.1 25-29 26.36 24.93 22.515 26.195 30-34 26.3 24.375 23.135 26.19 35-39 26.565 25.380000000000003 22.48 25.575 40-44 27.26 24.29 22.365 26.085 45-49 26.33 24.779999999999998 23.119999999999997 25.77 50-54 26.419999999999998 24.81 23.32 25.45 55-59 26.900000000000002 24.33 22.71 26.06 60-64 26.735 24.385 23.43 25.45 65-69 27.43 24.84 22.955000000000002 24.775 70-74 26.51 24.87 23.674999999999997 24.945 75-79 27.12 24.535 22.765 25.580000000000002 80-84 26.61 24.66 23.595 25.135 85-89 27.425 24.395 22.62 25.56 90-94 27.47 24.740000000000002 22.555 25.235000000000003 95-99 26.97 25.36 22.755 24.915000000000003 100-104 27.325 24.55 22.545 25.580000000000002 105-109 27.355 24.615000000000002 22.89 25.14 110-114 27.245 24.805 22.89 25.06 115-119 27.495000000000005 24.4 22.939999999999998 25.165 120-124 26.3 25.11 23.605 24.985 125-129 27.375 24.92 23.055 24.65 130-134 26.384999999999998 24.94 22.655 26.02 135-139 27.3 25.16 23.34 24.2 140-144 27.0 25.330000000000002 23.04 24.63 145-149 27.794999999999998 24.48 23.125 24.6 150-151 26.3125 24.625 23.9875 25.074999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 1.0 9 1.0 10 0.5 11 0.5 12 1.0 13 1.0 14 1.0 15 2.0 16 2.0 17 0.5 18 0.5 19 1.0 20 1.5 21 2.0 22 1.5 23 0.5 24 1.5 25 1.5 26 1.0 27 2.5 28 2.0 29 1.5 30 4.0 31 6.5 32 5.0 33 6.0 34 10.5 35 14.0 36 29.0 37 39.5 38 51.5 39 73.5 40 94.5 41 105.5 42 125.0 43 148.5 44 156.5 45 161.0 46 168.0 47 170.0 48 170.0 49 165.0 50 152.5 51 144.0 52 130.0 53 128.5 54 128.0 55 110.5 56 89.5 57 87.0 58 99.5 59 96.5 60 87.5 61 79.5 62 74.5 63 89.5 64 90.0 65 72.5 66 70.5 67 73.0 68 72.0 69 72.5 70 64.0 71 50.0 72 40.5 73 36.5 74 33.0 75 28.0 76 21.0 77 14.5 78 10.0 79 5.0 80 3.0 81 2.5 82 1.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.5 91 1.0 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.075 #Duplication Level Percentage of deduplicated Percentage of total 1 93.07010475423046 86.625 2 6.5001343002954615 12.1 3 0.37604082728982 1.05 4 0.026860059092130004 0.1 5 0.026860059092130004 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.48750000000000004 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.625 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.825 0.0 0.0 0.0 0.0 126-127 0.9125000000000001 0.0 0.0 0.0 0.0 128-129 1.15 0.0 0.0 0.0 0.0 130-131 1.45 0.0 0.0 0.0 0.0 132-133 1.5875 0.0 0.0 0.0 0.0 134-135 1.775 0.0 0.0 0.0 0.0 136-137 1.9874999999999998 0.0 0.0 0.0 0.0 138-139 2.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACGGAG 10 0.006830828 145.0 2 TCCAGAA 10 0.006830828 145.0 9 AATGCTC 10 0.006830828 145.0 5 >>END_MODULE Read 1759310 spots for SRR7804135.sra Written 1759310 spots for SRR7804135.sra Read 1759310 spots for SRR7804135.sra Written 1759310 spots for SRR7804135.sra Read 1759310 spots for SRR7804135.sra Written 1759310 spots for SRR7804135.sra Read 1759310 spots for SRR7804135.sra Written 1759310 spots for SRR7804135.sra Read 1759310 spots for SRR7804135.sra Written 1759310 spots for SRR7804135.sra Read 1759310 spots for SRR7804135.sra Written 1759310 spots for SRR7804135.sra Read 1759310 spots for SRR7804135.sra Written 1759310 spots for SRR7804135.sra Read 1759310 spots for SRR7804135.sra Written 1759310 spots for SRR7804135.sra Read 1759310 spots for SRR7804135.sra Written 1759310 spots for SRR7804135.sra Read 1759310 spots for SRR7804135.sra Written 1759310 spots for SRR7804135.sra Read 1759310 spots for SRR7804135.sra Written 1759310 spots for SRR7804135.sra Read 1759310 spots for SRR7804135.sra Written 1759310 spots for SRR7804135.sra Read 1759310 spots for SRR7804135.sra Written 1759310 spots for SRR7804135.sra Read 1759310 spots for SRR7804135.sra Written 1759310 spots for SRR7804135.sra Read 1759310 spots for SRR7804135.sra Written 1759310 spots for SRR7804135.sra Read 1759310 spots for SRR7804135.sra Written 1759310 spots for SRR7804135.sra Read 1759310 spots for SRR7804135.sra Written 1759310 spots for SRR7804135.sra Read 1759317 spots for SRR7804135.sra Written 1759317 spots for SRR7804135.sra Read 1759310 spots for SRR7804135.sra Written 1759310 spots for SRR7804135.sra Read 1759310 spots for SRR7804135.sra Written 1759310 spots for SRR7804135.sra SRR ids: ['SRR7804135.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t1duy82p SRR7804135.sra spots: 35186207 blocks: [[1, 1759310], [1759311, 3518620], [3518621, 5277930], [5277931, 7037240], [7037241, 8796550], [8796551, 10555860], [10555861, 12315170], [12315171, 14074480], [14074481, 15833790], [15833791, 17593100], [17593101, 19352410], [19352411, 21111720], [21111721, 22871030], [22871031, 24630340], [24630341, 26389650], [26389651, 28148960], [28148961, 29908270], [29908271, 31667580], [31667581, 33426890], [33426891, 35186207]] SRR7804135 file size 11901750 SRR7804135 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804135 SRR7804135_1.fastq SRR7804135_2.fastq Input file: SRR7804135_1.fastq Paired file: SRR7804135_2.fastq trimmed: SRR7804135-trimmed-pair1.fastq, SRR7804135-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:34:39 2024 >> started Tue Dec 10 02:35:28 2024 >> done (48.463s) 35186207 read pairs processed; of these: 116 ( 0.00%) short read pairs filtered out after trimming by size control 885 ( 0.00%) empty read pairs filtered out after trimming by size control 35185206 (100.00%) read pairs available; of these: 1429603 ( 4.06%) trimmed read pairs available after processing 33755603 (95.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 10 0.00% 20 12 0.00% 21 18 0.00% 22 13 0.00% 23 17 0.00% 24 21 0.00% 25 29 0.00% 26 22 0.00% 27 19 0.00% 28 19 0.00% 29 22 0.00% 30 27 0.00% 31 34 0.00% 32 30 0.00% 33 36 0.00% 34 34 0.00% 35 31 0.00% 36 42 0.00% 37 33 0.00% 38 58 0.00% 39 36 0.00% 40 42 0.00% 41 43 0.00% 42 50 0.00% 43 53 0.00% 44 46 0.00% 45 54 0.00% 46 57 0.00% 47 42 0.00% 48 45 0.00% 49 50 0.00% 50 58 0.00% 51 57 0.00% 52 52 0.00% 53 66 0.00% 54 62 0.00% 55 68 0.00% 56 74 0.00% 57 62 0.00% 58 74 0.00% 59 83 0.00% 60 116 0.00% 61 94 0.00% 62 83 0.00% 63 108 0.00% 64 78 0.00% 65 85 0.00% 66 121 0.00% 67 107 0.00% 68 126 0.00% 69 123 0.00% 70 137 0.00% 71 161 0.00% 72 178 0.00% 73 212 0.00% 74 207 0.00% 75 243 0.00% 76 255 0.00% 77 276 0.00% 78 333 0.00% 79 378 0.00% 80 403 0.00% 81 471 0.00% 82 535 0.00% 83 633 0.00% 84 660 0.00% 85 756 0.00% 86 929 0.00% 87 972 0.00% 88 1159 0.00% 89 1310 0.00% 90 1450 0.00% 91 1584 0.00% 92 1728 0.00% 93 2027 0.01% 94 2255 0.01% 95 2509 0.01% 96 2909 0.01% 97 3110 0.01% 98 3367 0.01% 99 3700 0.01% 100 4219 0.01% 101 4415 0.01% 102 4932 0.01% 103 5362 0.02% 104 5924 0.02% 105 6511 0.02% 106 7003 0.02% 107 7701 0.02% 108 8164 0.02% 109 8695 0.02% 110 9373 0.03% 111 10231 0.03% 112 11018 0.03% 113 11788 0.03% 114 12777 0.04% 115 13524 0.04% 116 14230 0.04% 117 15150 0.04% 118 16074 0.05% 119 17156 0.05% 120 18173 0.05% 121 18936 0.05% 122 20048 0.06% 123 21081 0.06% 124 22572 0.06% 125 23706 0.07% 126 24987 0.07% 127 26511 0.08% 128 27673 0.08% 129 28733 0.08% 130 30052 0.09% 131 31297 0.09% 132 33021 0.09% 133 34291 0.10% 134 35418 0.10% 135 37465 0.11% 136 38905 0.11% 137 40418 0.11% 138 41814 0.12% 139 43935 0.12% 140 45425 0.13% 141 46881 0.13% 142 49457 0.14% 143 50681 0.14% 144 52550 0.15% 145 53995 0.15% 146 56007 0.16% 147 58232 0.17% 148 60059 0.17% 149 61565 0.17% 150 63868 0.18% 151 33755603 95.94% 35185206 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=30 prefix-density=0.31 prefix-fanout=2.5 sequence=CCAGTCTCCCTGTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=343.98 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=32.9 sequence=CTTCTTCTTGTCCA criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.88 fanout-score-rank=22 prefix-density=0.41 prefix-fanout=3.1 sequence=AAGATGTACCCAGA criterion=fanout-score sequence-density=0.12 sequence-density-rank=19 fanout-score=184.15 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=22.7 sequence=CGCCGCCGCCGC SRR7804135 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:36:17 Started mapping on | Dec 10 02:36:17 Finished on | Dec 10 02:41:16 Mapping speed, Million of reads per hour | 423.63 Number of input reads | 35185206 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 32581343 Uniquely mapped reads % | 92.60% Average mapped length | 299.27 Number of splices: Total | 34315238 Number of splices: Annotated (sjdb) | 32295224 Number of splices: GT/AG | 33831704 Number of splices: GC/AG | 390895 Number of splices: AT/AC | 18887 Number of splices: Non-canonical | 73752 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 3.04 Insertion rate per base | 0.02% Insertion average length | 2.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 515493 % of reads mapped to multiple loci | 1.47% Number of reads mapped to too many loci | 28708 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.23% % of reads unmapped: other | 0.62% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2088370 2088370 2088370 N_multimapping 515493 515493 515493 N_noFeature 930946 31700498 1188541 N_ambiguous 743550 4932 121913 UnstrandedReadsAssigned:30906847 PositiveStrandReadsAssigned:875913 NegativeStrandReadsAssigned:31270889 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804135 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804135-trimmed-pair1.fastq SRR7804135-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,185,206 reads, 31,827,163 reads pseudoaligned [quant] estimated average fragment length: 286.954 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52973 SRR7804135.ke.tsv 35125 SRR7804135.se.tsv 88098 total ==> SRR7804135.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 650.726 2.37079 0.154245 PNS24247 1044 758.046 100.519 5.61395 PNS24249 1928 1642.05 443.104 11.4244 PNS24246 1044 758.046 100.519 5.61395 PNS24248 1044 758.046 100.519 5.61395 PNS24244 1471 1185.05 91.968 3.28562 PNS24243 293 79.0559 0 0 KQK14069 1603 1317.05 367.003 11.7973 KQK14071 474 213.118 0 0 ==> SRR7804135.se.tsv <== BRADI_1g14170v3 379 BRADI_1g53295v3 1427 BRADI_1g59795v3 380 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 4593 BRADI_1g74790v3 3356 BRADI_1g09890v3 0 BRADI_1g77505v3 474 BRADI_1g48960v3 0 SRR7804135 completed mapping pipeline successfully