Starting /dee2/code/volunteer_pipeline.sh SRR7804136 current disk space = 1525554679808 free memory = 1563266884 SRR7804136 SRAfilesize 0597e8b752f03b26c80c974fe73c8619 SRR7804136.sra SRR7804136.sra file validated SRR7804136 is paired end SRR7804136 is conventional basespace SRR7804136 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804136_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.249 37.0 37.0 37.0 37.0 37.0 2 36.28225 37.0 37.0 37.0 37.0 37.0 3 36.446 37.0 37.0 37.0 37.0 37.0 4 36.4725 37.0 37.0 37.0 37.0 37.0 5 36.51 37.0 37.0 37.0 37.0 37.0 6 36.4435 37.0 37.0 37.0 37.0 37.0 7 36.404 37.0 37.0 37.0 37.0 37.0 8 36.478 37.0 37.0 37.0 37.0 37.0 9 36.4635 37.0 37.0 37.0 37.0 37.0 10-14 36.476200000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.4844 37.0 37.0 37.0 37.0 37.0 20-24 36.48350000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.42960000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.401 37.0 37.0 37.0 37.0 37.0 35-39 36.4028 37.0 37.0 37.0 37.0 37.0 40-44 36.4045 37.0 37.0 37.0 37.0 37.0 45-49 36.3784 37.0 37.0 37.0 37.0 37.0 50-54 36.3651 37.0 37.0 37.0 37.0 37.0 55-59 36.365 37.0 37.0 37.0 37.0 37.0 60-64 36.3602 37.0 37.0 37.0 37.0 37.0 65-69 36.3129 37.0 37.0 37.0 37.0 37.0 70-74 36.267399999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.311899999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.2076 37.0 37.0 37.0 37.0 37.0 85-89 36.2183 37.0 37.0 37.0 37.0 37.0 90-94 36.176 37.0 37.0 37.0 37.0 37.0 95-99 36.1884 37.0 37.0 37.0 37.0 37.0 100-104 36.1357 37.0 37.0 37.0 37.0 37.0 105-109 36.101299999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.0504 37.0 37.0 37.0 37.0 37.0 115-119 36.033899999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.0115 37.0 37.0 37.0 37.0 37.0 125-129 35.9023 37.0 37.0 37.0 37.0 37.0 130-134 35.825900000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.905899999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.867 37.0 37.0 37.0 37.0 37.0 145-149 35.8485 37.0 37.0 37.0 37.0 37.0 150-151 35.185249999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 1.0 25 3.0 26 1.0 27 9.0 28 11.0 29 18.0 30 36.0 31 43.0 32 50.0 33 96.0 34 128.0 35 320.0 36 2916.0 37 366.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.6 13.425 8.025 32.95 2 26.831707926981746 14.853713428357091 31.48287071767942 26.831707926981746 3 23.075000000000003 21.45 24.15 31.324999999999996 4 26.5 27.975 20.349999999999998 25.174999999999997 5 25.724999999999998 30.349999999999998 22.25 21.675 6 22.7 31.45 23.35 22.5 7 17.599999999999998 23.400000000000002 38.9 20.1 8 20.925 23.25 28.1 27.725 9 20.349999999999998 20.95 30.825000000000003 27.875 10-14 23.66 26.35 24.375 25.615 15-19 23.395 25.545 25.405 25.655 20-24 24.215 25.119999999999997 25.069999999999997 25.595000000000002 25-29 23.474999999999998 25.674999999999997 24.755 26.095000000000002 30-34 23.34 25.230000000000004 25.385 26.045 35-39 23.169999999999998 25.385 25.435000000000002 26.009999999999998 40-44 23.880000000000003 25.474999999999998 24.25 26.395000000000003 45-49 24.37 25.245 24.67 25.715 50-54 23.62 24.93 24.8 26.650000000000002 55-59 24.04 24.834999999999997 24.89 26.235000000000003 60-64 23.685000000000002 24.925 25.619999999999997 25.77 65-69 24.474999999999998 24.795 24.905 25.825 70-74 23.895 25.25 25.040000000000003 25.814999999999998 75-79 23.57 24.779999999999998 25.15 26.5 80-84 24.245 24.65 24.925 26.179999999999996 85-89 23.785 24.915000000000003 24.815 26.484999999999996 90-94 23.505000000000003 25.275 24.435000000000002 26.784999999999997 95-99 23.919999999999998 24.815 24.925 26.340000000000003 100-104 24.104999999999997 24.94 24.37 26.584999999999997 105-109 24.08 24.62 24.959999999999997 26.340000000000003 110-114 24.21 24.68 24.935 26.174999999999997 115-119 24.46 24.404999999999998 25.255 25.88 120-124 24.3 24.54 24.515 26.645000000000003 125-129 23.705000000000002 24.775 24.759999999999998 26.76 130-134 24.255 24.935 24.81 26.0 135-139 24.404999999999998 24.465 25.369999999999997 25.759999999999998 140-144 24.085 24.645 24.935 26.334999999999997 145-149 24.9 24.585 24.36 26.155 150-151 24.55 23.9125 24.7 26.8375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 1.0 27 1.0 28 1.0 29 2.5 30 6.0 31 8.0 32 10.5 33 16.5 34 23.0 35 26.0 36 34.0 37 52.0 38 75.0 39 99.5 40 122.0 41 159.5 42 167.0 43 153.0 44 164.5 45 180.0 46 187.5 47 198.5 48 202.5 49 182.0 50 163.0 51 151.5 52 145.0 53 136.5 54 129.5 55 117.0 56 96.5 57 95.5 58 87.5 59 75.0 60 73.0 61 76.5 62 72.0 63 61.5 64 61.0 65 56.5 66 48.5 67 43.0 68 46.0 69 43.5 70 32.5 71 30.0 72 25.5 73 17.5 74 15.0 75 12.5 76 8.5 77 3.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.72433306386418 86.02499999999999 2 6.8175693883050394 12.65 3 0.40420371867421184 1.125 4 0.05389382915656157 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0125 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.44999999999999996 0.0 0.0 0.0 0.0 118-119 0.5375000000000001 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.825 0.0 0.0 0.0 0.0 128-129 0.925 0.0 0.0 0.0 0.0 130-131 1.025 0.0 0.0 0.0 0.0 132-133 1.275 0.0 0.0 0.0 0.0 134-135 1.4875 0.0 0.0 0.0 0.0 136-137 1.625 0.0 0.0 0.0 0.0 138-139 1.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGCGGG 10 0.006830828 145.0 145 >>END_MODULE SRR7804136 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804136_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.184 37.0 37.0 37.0 37.0 37.0 2 36.0725 37.0 37.0 37.0 37.0 37.0 3 36.077 37.0 37.0 37.0 37.0 37.0 4 36.2635 37.0 37.0 37.0 37.0 37.0 5 36.0595 37.0 37.0 37.0 37.0 37.0 6 36.249 37.0 37.0 37.0 37.0 37.0 7 36.086 37.0 37.0 37.0 37.0 37.0 8 36.2705 37.0 37.0 37.0 37.0 37.0 9 36.072 37.0 37.0 37.0 37.0 37.0 10-14 36.1565 37.0 37.0 37.0 37.0 37.0 15-19 36.0858 37.0 37.0 37.0 37.0 37.0 20-24 36.0533 37.0 37.0 37.0 37.0 37.0 25-29 36.0176 37.0 37.0 37.0 37.0 37.0 30-34 36.0055 37.0 37.0 37.0 37.0 37.0 35-39 36.010099999999994 37.0 37.0 37.0 37.0 37.0 40-44 35.96169999999999 37.0 37.0 37.0 37.0 37.0 45-49 35.875099999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.8329 37.0 37.0 37.0 37.0 37.0 55-59 35.8251 37.0 37.0 37.0 37.0 37.0 60-64 35.8317 37.0 37.0 37.0 37.0 37.0 65-69 35.7899 37.0 37.0 37.0 37.0 37.0 70-74 35.7231 37.0 37.0 37.0 37.0 37.0 75-79 35.7346 37.0 37.0 37.0 37.0 37.0 80-84 35.7725 37.0 37.0 37.0 37.0 37.0 85-89 35.7267 37.0 37.0 37.0 37.0 37.0 90-94 35.7108 37.0 37.0 37.0 37.0 37.0 95-99 35.6496 37.0 37.0 37.0 37.0 37.0 100-104 35.685900000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.5358 37.0 37.0 37.0 37.0 37.0 110-114 35.4754 37.0 37.0 37.0 34.6 37.0 115-119 35.457100000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.4139 37.0 37.0 37.0 34.6 37.0 125-129 35.3438 37.0 37.0 37.0 37.0 37.0 130-134 35.3642 37.0 37.0 37.0 37.0 37.0 135-139 35.2374 37.0 37.0 37.0 29.8 37.0 140-144 35.224799999999995 37.0 37.0 37.0 29.8 37.0 145-149 35.067400000000006 37.0 37.0 37.0 25.0 37.0 150-151 34.5935 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 6.0 14 10.0 15 3.0 16 6.0 17 2.0 18 1.0 19 2.0 20 2.0 21 5.0 22 3.0 23 6.0 24 2.0 25 9.0 26 15.0 27 13.0 28 15.0 29 17.0 30 25.0 31 40.0 32 66.0 33 112.0 34 222.0 35 589.0 36 2642.0 37 186.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.8 18.45 9.85 28.9 2 29.925 22.075 26.900000000000002 21.099999999999998 3 24.175 25.3 27.775 22.75 4 26.424999999999997 31.55 19.0 23.025000000000002 5 27.750000000000004 32.15 20.05 20.05 6 25.4 33.25 18.85 22.5 7 23.724999999999998 19.025 33.95 23.3 8 23.65 22.525000000000002 22.3 31.525 9 24.725 22.775000000000002 25.124999999999996 27.375 10-14 26.85 24.95 22.189999999999998 26.009999999999998 15-19 26.32 24.22 23.169999999999998 26.290000000000003 20-24 26.424999999999997 24.59 23.14 25.845000000000002 25-29 26.889999999999997 24.955 23.255 24.9 30-34 26.534999999999997 25.165 23.785 24.515 35-39 26.68 24.62 23.365 25.335 40-44 26.43 24.435000000000002 23.65 25.485000000000003 45-49 26.75 24.685000000000002 23.54 25.025 50-54 26.935 24.55 23.69 24.825 55-59 26.529999999999998 24.75 23.835 24.884999999999998 60-64 26.185000000000002 25.52 22.655 25.64 65-69 26.919999999999998 25.085 23.35 24.645 70-74 26.779999999999998 25.074999999999996 23.555 24.59 75-79 26.939999999999998 24.745 23.61 24.705 80-84 26.779999999999998 25.615 23.244999999999997 24.36 85-89 27.375 24.825 23.205000000000002 24.595 90-94 26.745 25.435000000000002 23.395 24.425 95-99 27.279999999999998 25.005 23.74 23.974999999999998 100-104 27.150000000000002 24.65 23.74 24.46 105-109 26.82 24.8 23.565 24.815 110-114 27.42 24.905 23.5 24.175 115-119 26.729999999999997 24.875 23.865 24.529999999999998 120-124 26.889999999999997 25.085 23.29 24.735 125-129 27.045 25.435000000000002 23.555 23.965 130-134 27.025 25.005 23.22 24.75 135-139 26.71 25.919999999999998 23.685000000000002 23.685000000000002 140-144 26.284999999999997 25.585 24.16 23.97 145-149 26.57 25.39 24.099999999999998 23.94 150-151 27.0125 24.837500000000002 23.6875 24.462500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 0.5 23 1.5 24 2.0 25 0.5 26 1.5 27 2.5 28 2.0 29 1.5 30 3.0 31 7.0 32 8.5 33 8.5 34 13.0 35 21.5 36 30.0 37 33.0 38 43.5 39 74.0 40 98.5 41 116.5 42 145.5 43 164.5 44 166.0 45 168.5 46 184.5 47 201.5 48 188.5 49 157.0 50 155.0 51 153.0 52 136.0 53 126.0 54 127.0 55 118.5 56 102.5 57 86.0 58 81.0 59 98.5 60 94.5 61 84.0 62 80.0 63 75.5 64 68.5 65 68.5 66 68.0 67 64.0 68 64.0 69 53.0 70 50.5 71 45.0 72 28.5 73 25.0 74 24.0 75 18.5 76 12.5 77 7.5 78 4.0 79 4.5 80 5.0 81 3.0 82 1.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.5 93 1.0 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.5 100 6.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.30000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.6056338028169 85.475 2 6.8797399783315285 12.7 3 0.37919826652221017 1.05 4 0.08125677139761647 0.3 5 0.027085590465872153 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027085590465872153 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 14 0.35000000000000003 No Hit GCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0125 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0125 108-109 0.2375 0.0 0.0 0.0 0.025 110-111 0.25 0.0 0.0 0.0 0.025 112-113 0.3625 0.0 0.0 0.0 0.025 114-115 0.375 0.0 0.0 0.0 0.025 116-117 0.44999999999999996 0.0 0.0 0.0 0.025 118-119 0.5375000000000001 0.0 0.0 0.0 0.025 120-121 0.5625 0.0 0.0 0.0 0.025 122-123 0.6625000000000001 0.0 0.0 0.0 0.025 124-125 0.7375 0.0 0.0 0.0 0.025 126-127 0.8 0.0 0.0 0.0 0.025 128-129 0.9 0.0 0.0 0.0 0.025 130-131 1.0 0.0 0.0 0.0 0.025 132-133 1.25 0.0 0.0 0.0 0.025 134-135 1.4625 0.0 0.0 0.0 0.025 136-137 1.6 0.0 0.0 0.0 0.025 138-139 1.75 0.0 0.0125 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1811864 spots for SRR7804136.sra Written 1811864 spots for SRR7804136.sra Read 1811864 spots for SRR7804136.sra Written 1811864 spots for SRR7804136.sra Read 1811864 spots for SRR7804136.sra Written 1811864 spots for SRR7804136.sra Read 1811864 spots for SRR7804136.sra Written 1811864 spots for SRR7804136.sra Read 1811883 spots for SRR7804136.sra Written 1811883 spots for SRR7804136.sra Read 1811864 spots for SRR7804136.sra Written 1811864 spots for SRR7804136.sra Read 1811864 spots for SRR7804136.sra Written 1811864 spots for SRR7804136.sra Read 1811864 spots for SRR7804136.sra Written 1811864 spots for SRR7804136.sra Read 1811864 spots for SRR7804136.sra Written 1811864 spots for SRR7804136.sra Read 1811864 spots for SRR7804136.sra Written 1811864 spots for SRR7804136.sra Read 1811864 spots for SRR7804136.sra Written 1811864 spots for SRR7804136.sra Read 1811864 spots for SRR7804136.sra Written 1811864 spots for SRR7804136.sra Read 1811864 spots for SRR7804136.sra Written 1811864 spots for SRR7804136.sra Read 1811864 spots for SRR7804136.sra Written 1811864 spots for SRR7804136.sra Read 1811864 spots for SRR7804136.sra Written 1811864 spots for SRR7804136.sra Read 1811864 spots for SRR7804136.sra Written 1811864 spots for SRR7804136.sra Read 1811864 spots for SRR7804136.sra Written 1811864 spots for SRR7804136.sra Read 1811864 spots for SRR7804136.sra Written 1811864 spots for SRR7804136.sra Read 1811864 spots for SRR7804136.sra Written 1811864 spots for SRR7804136.sra Read 1811864 spots for SRR7804136.sra Written 1811864 spots for SRR7804136.sra SRR ids: ['SRR7804136.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3s_kb3df SRR7804136.sra spots: 36237299 blocks: [[1, 1811864], [1811865, 3623728], [3623729, 5435592], [5435593, 7247456], [7247457, 9059320], [9059321, 10871184], [10871185, 12683048], [12683049, 14494912], [14494913, 16306776], [16306777, 18118640], [18118641, 19930504], [19930505, 21742368], [21742369, 23554232], [23554233, 25366096], [25366097, 27177960], [27177961, 28989824], [28989825, 30801688], [30801689, 32613552], [32613553, 34425416], [34425417, 36237299]] SRR7804136 file size 12257931 SRR7804136 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804136 SRR7804136_1.fastq SRR7804136_2.fastq Input file: SRR7804136_1.fastq Paired file: SRR7804136_2.fastq trimmed: SRR7804136-trimmed-pair1.fastq, SRR7804136-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:31:54 2024 >> started Tue Dec 10 02:32:35 2024 >> done (41.779s) 36237299 read pairs processed; of these: 101 ( 0.00%) short read pairs filtered out after trimming by size control 565 ( 0.00%) empty read pairs filtered out after trimming by size control 36236633 (100.00%) read pairs available; of these: 885866 ( 2.44%) trimmed read pairs available after processing 35350767 (97.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 15 0.00% 20 18 0.00% 21 19 0.00% 22 24 0.00% 23 20 0.00% 24 21 0.00% 25 37 0.00% 26 29 0.00% 27 23 0.00% 28 31 0.00% 29 38 0.00% 30 25 0.00% 31 38 0.00% 32 43 0.00% 33 42 0.00% 34 33 0.00% 35 39 0.00% 36 24 0.00% 37 43 0.00% 38 50 0.00% 39 44 0.00% 40 46 0.00% 41 49 0.00% 42 42 0.00% 43 47 0.00% 44 57 0.00% 45 65 0.00% 46 81 0.00% 47 56 0.00% 48 55 0.00% 49 65 0.00% 50 61 0.00% 51 52 0.00% 52 65 0.00% 53 77 0.00% 54 48 0.00% 55 71 0.00% 56 69 0.00% 57 81 0.00% 58 92 0.00% 59 94 0.00% 60 88 0.00% 61 86 0.00% 62 90 0.00% 63 126 0.00% 64 92 0.00% 65 101 0.00% 66 109 0.00% 67 104 0.00% 68 124 0.00% 69 149 0.00% 70 147 0.00% 71 174 0.00% 72 185 0.00% 73 217 0.00% 74 201 0.00% 75 233 0.00% 76 250 0.00% 77 243 0.00% 78 306 0.00% 79 366 0.00% 80 351 0.00% 81 386 0.00% 82 487 0.00% 83 570 0.00% 84 627 0.00% 85 686 0.00% 86 771 0.00% 87 761 0.00% 88 838 0.00% 89 855 0.00% 90 1044 0.00% 91 1184 0.00% 92 1350 0.00% 93 1546 0.00% 94 1655 0.00% 95 1771 0.00% 96 1905 0.01% 97 2017 0.01% 98 2259 0.01% 99 2358 0.01% 100 2646 0.01% 101 2797 0.01% 102 3195 0.01% 103 3656 0.01% 104 3748 0.01% 105 4275 0.01% 106 4633 0.01% 107 4599 0.01% 108 5056 0.01% 109 5332 0.01% 110 5451 0.02% 111 6025 0.02% 112 6633 0.02% 113 7249 0.02% 114 7911 0.02% 115 8311 0.02% 116 8964 0.02% 117 9259 0.03% 118 9246 0.03% 119 9987 0.03% 120 10384 0.03% 121 11085 0.03% 122 11968 0.03% 123 12734 0.04% 124 13695 0.04% 125 14541 0.04% 126 15202 0.04% 127 15740 0.04% 128 15903 0.04% 129 17003 0.05% 130 17360 0.05% 131 18013 0.05% 132 19525 0.05% 133 20951 0.06% 134 21948 0.06% 135 23489 0.06% 136 23891 0.07% 137 24994 0.07% 138 25686 0.07% 139 26664 0.07% 140 27338 0.08% 141 27809 0.08% 142 30159 0.08% 143 30839 0.09% 144 32996 0.09% 145 35095 0.10% 146 36797 0.10% 147 38437 0.11% 148 38210 0.11% 149 39101 0.11% 150 40590 0.11% 151 35350767 97.56% 36236633 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=29 prefix-density=0.42 prefix-fanout=2.8 sequence=TGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCTTCGGTCGAGTGCTCGAACTTGCTTAGGAAGAAGATTAAGCTGAAGGCTTCTAGGCTTGTGTGTGCTTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=12 fanout-score=305.41 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=30.8 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=33 prefix-density=1.15 prefix-fanout=1.2 sequence=CAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAGTGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=795.85 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=19.2 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR7804136 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:33:28 Started mapping on | Dec 10 02:33:28 Finished on | Dec 10 02:41:23 Mapping speed, Million of reads per hour | 274.64 Number of input reads | 36236633 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 32587633 Uniquely mapped reads % | 89.93% Average mapped length | 299.78 Number of splices: Total | 33941004 Number of splices: Annotated (sjdb) | 31864267 Number of splices: GT/AG | 33447776 Number of splices: GC/AG | 376932 Number of splices: AT/AC | 26528 Number of splices: Non-canonical | 89768 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 537616 % of reads mapped to multiple loci | 1.48% Number of reads mapped to too many loci | 36217 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.73% % of reads unmapped: other | 0.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3111384 3111384 3111384 N_multimapping 537616 537616 537616 N_noFeature 876514 31746670 1149885 N_ambiguous 685223 5987 122476 UnstrandedReadsAssigned:31025896 PositiveStrandReadsAssigned:834976 NegativeStrandReadsAssigned:31315272 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804136 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804136-trimmed-pair1.fastq SRR7804136-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,236,633 reads, 31,835,394 reads pseudoaligned [quant] estimated average fragment length: 312.114 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52973 SRR7804136.ke.tsv 35125 SRR7804136.se.tsv 88098 total ==> SRR7804136.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 625.633 0 0 PNS24247 1044 732.886 148.527 8.50097 PNS24249 1928 1616.89 270.879 7.0274 PNS24246 1044 732.886 148.527 8.50097 PNS24248 1044 732.886 148.527 8.50097 PNS24244 1471 1159.89 219.54 7.9396 PNS24243 293 72.3595 0 0 KQK14069 1603 1291.89 4965.35 161.222 KQK14071 474 197.079 29.6629 6.31355 ==> SRR7804136.se.tsv <== BRADI_1g14170v3 5090 BRADI_1g53295v3 1855 BRADI_1g59795v3 353 BRADI_1g07683v3 0 BRADI_1g00485v3 147 BRADI_1g20270v3 3371 BRADI_1g74790v3 119 BRADI_1g09890v3 0 BRADI_1g77505v3 380 BRADI_1g48960v3 0 SRR7804136 completed mapping pipeline successfully