Starting /dee2/code/volunteer_pipeline.sh SRR7804137 current disk space = 1525553905664 free memory = 1563258236 SRR7804137 SRAfilesize 1b5bf7ec675d1b121352319e834d531a SRR7804137.sra SRR7804137.sra file validated SRR7804137 is paired end SRR7804137 is conventional basespace SRR7804137 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804137_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2575 37.0 37.0 37.0 37.0 37.0 2 36.2885 37.0 37.0 37.0 37.0 37.0 3 36.464 37.0 37.0 37.0 37.0 37.0 4 36.355 37.0 37.0 37.0 37.0 37.0 5 36.5105 37.0 37.0 37.0 37.0 37.0 6 36.4695 37.0 37.0 37.0 37.0 37.0 7 36.4725 37.0 37.0 37.0 37.0 37.0 8 36.382 37.0 37.0 37.0 37.0 37.0 9 36.452 37.0 37.0 37.0 37.0 37.0 10-14 36.4619 37.0 37.0 37.0 37.0 37.0 15-19 36.4595 37.0 37.0 37.0 37.0 37.0 20-24 36.526599999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.455200000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.4226 37.0 37.0 37.0 37.0 37.0 35-39 36.420300000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.4331 37.0 37.0 37.0 37.0 37.0 45-49 36.3697 37.0 37.0 37.0 37.0 37.0 50-54 36.3874 37.0 37.0 37.0 37.0 37.0 55-59 36.34590000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.329100000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.3114 37.0 37.0 37.0 37.0 37.0 70-74 36.25020000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.2163 37.0 37.0 37.0 37.0 37.0 80-84 36.1857 37.0 37.0 37.0 37.0 37.0 85-89 36.1693 37.0 37.0 37.0 37.0 37.0 90-94 36.156600000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.1594 37.0 37.0 37.0 37.0 37.0 100-104 36.1263 37.0 37.0 37.0 37.0 37.0 105-109 36.076800000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.045 37.0 37.0 37.0 37.0 37.0 115-119 36.0043 37.0 37.0 37.0 37.0 37.0 120-124 36.0586 37.0 37.0 37.0 37.0 37.0 125-129 35.8771 37.0 37.0 37.0 37.0 37.0 130-134 35.8215 37.0 37.0 37.0 37.0 37.0 135-139 35.8444 37.0 37.0 37.0 37.0 37.0 140-144 35.748900000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.7043 37.0 37.0 37.0 37.0 37.0 150-151 35.257999999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 0.0 24 2.0 25 6.0 26 8.0 27 9.0 28 19.0 29 11.0 30 25.0 31 36.0 32 61.0 33 83.0 34 149.0 35 321.0 36 2865.0 37 403.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.875 11.125 9.325 35.675000000000004 2 26.163081540770385 12.981490745372687 31.240620310155077 29.61480740370185 3 23.875 16.025 22.3 37.8 4 28.499999999999996 23.65 20.1 27.750000000000004 5 28.425 25.224999999999998 23.150000000000002 23.200000000000003 6 24.275 28.525 22.825 24.375 7 19.725 24.474999999999998 35.75 20.05 8 21.275 23.775 28.349999999999998 26.6 9 21.55 19.650000000000002 32.5 26.3 10-14 24.345 24.75 24.95 25.955000000000002 15-19 24.075 24.545 24.825 26.555 20-24 23.974999999999998 25.380000000000003 24.535 26.11 25-29 24.18 25.045 24.145 26.63 30-34 24.2 25.235000000000003 24.36 26.205000000000002 35-39 24.285 24.73 24.32 26.665 40-44 24.43 24.94 23.69 26.939999999999998 45-49 24.95 23.825 24.965 26.26 50-54 24.85 24.545 23.87 26.735 55-59 23.91 24.57 24.884999999999998 26.634999999999998 60-64 24.51 24.654999999999998 23.735 27.1 65-69 24.435000000000002 24.94 23.69 26.935 70-74 24.779999999999998 23.794999999999998 24.385 27.04 75-79 25.025 24.0 24.465 26.51 80-84 24.845 23.5 24.9 26.755000000000003 85-89 25.045 24.15 24.104999999999997 26.700000000000003 90-94 25.435000000000002 24.135 23.645 26.784999999999997 95-99 24.67 24.025 24.375 26.93 100-104 24.73 23.810000000000002 24.32 27.139999999999997 105-109 25.245 23.46 24.215 27.08 110-114 25.095 24.145 23.87 26.889999999999997 115-119 25.474999999999998 23.695 23.995 26.834999999999997 120-124 25.115 23.845 24.86 26.179999999999996 125-129 25.41 23.71 23.57 27.310000000000002 130-134 25.39 23.669999999999998 23.605 27.334999999999997 135-139 24.425 23.68 24.785 27.11 140-144 25.505 23.3 24.5 26.695 145-149 24.98 23.794999999999998 23.98 27.245 150-151 24.55 23.4375 24.8 27.212500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 2.5 28 2.0 29 1.5 30 3.5 31 6.0 32 8.0 33 13.0 34 17.5 35 26.5 36 39.5 37 42.0 38 50.0 39 65.5 40 86.0 41 113.0 42 143.5 43 159.0 44 162.5 45 170.0 46 174.0 47 192.5 48 190.5 49 172.0 50 165.0 51 156.5 52 145.5 53 136.0 54 138.0 55 137.0 56 120.0 57 99.5 58 92.0 59 85.5 60 79.0 61 71.0 62 66.0 63 63.5 64 67.5 65 71.0 66 59.5 67 56.0 68 55.5 69 51.5 70 47.0 71 41.0 72 35.5 73 31.5 74 25.0 75 18.5 76 14.0 77 10.0 78 6.5 79 4.5 80 2.5 81 1.0 82 1.5 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.30000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.51554126473741 87.25 2 5.814576634512326 10.85 3 0.6430868167202572 1.7999999999999998 4 0.02679528403001072 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.44999999999999996 0.0 0.0 0.0 0.0 116-117 0.4875 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.7124999999999999 0.0 0.0 0.0 0.0 122-123 0.8374999999999999 0.0 0.0 0.0 0.0 124-125 0.975 0.0 0.0 0.0 0.0 126-127 1.0499999999999998 0.0 0.0 0.0 0.0 128-129 1.2000000000000002 0.0 0.0 0.0 0.0 130-131 1.2875 0.0 0.0 0.0 0.0 132-133 1.5375 0.0 0.0 0.0 0.0 134-135 1.7374999999999998 0.0 0.0 0.0 0.0 136-137 1.9249999999999998 0.0 0.0 0.0 0.0 138-139 2.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804137 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804137_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.398 37.0 37.0 37.0 37.0 37.0 2 36.2185 37.0 37.0 37.0 37.0 37.0 3 36.326 37.0 37.0 37.0 37.0 37.0 4 36.286 37.0 37.0 37.0 37.0 37.0 5 36.185 37.0 37.0 37.0 37.0 37.0 6 36.337 37.0 37.0 37.0 37.0 37.0 7 36.253 37.0 37.0 37.0 37.0 37.0 8 36.412 37.0 37.0 37.0 37.0 37.0 9 36.335 37.0 37.0 37.0 37.0 37.0 10-14 36.3363 37.0 37.0 37.0 37.0 37.0 15-19 36.205200000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.238200000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.2535 37.0 37.0 37.0 37.0 37.0 30-34 36.2337 37.0 37.0 37.0 37.0 37.0 35-39 36.1465 37.0 37.0 37.0 37.0 37.0 40-44 36.085300000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.0303 37.0 37.0 37.0 37.0 37.0 50-54 36.0566 37.0 37.0 37.0 37.0 37.0 55-59 35.9862 37.0 37.0 37.0 37.0 37.0 60-64 36.004099999999994 37.0 37.0 37.0 37.0 37.0 65-69 35.945 37.0 37.0 37.0 37.0 37.0 70-74 35.9234 37.0 37.0 37.0 37.0 37.0 75-79 35.9426 37.0 37.0 37.0 37.0 37.0 80-84 35.9143 37.0 37.0 37.0 37.0 37.0 85-89 35.8957 37.0 37.0 37.0 37.0 37.0 90-94 35.8931 37.0 37.0 37.0 37.0 37.0 95-99 35.8435 37.0 37.0 37.0 37.0 37.0 100-104 35.8122 37.0 37.0 37.0 37.0 37.0 105-109 35.7528 37.0 37.0 37.0 37.0 37.0 110-114 35.58710000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.682500000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.5723 37.0 37.0 37.0 37.0 37.0 125-129 35.5724 37.0 37.0 37.0 37.0 37.0 130-134 35.5446 37.0 37.0 37.0 37.0 37.0 135-139 35.438500000000005 37.0 37.0 37.0 34.6 37.0 140-144 35.44109999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.30030000000001 37.0 37.0 37.0 34.6 37.0 150-151 34.775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 1.0 15 3.0 16 3.0 17 1.0 18 1.0 19 2.0 20 3.0 21 3.0 22 4.0 23 4.0 24 4.0 25 11.0 26 8.0 27 11.0 28 19.0 29 25.0 30 30.0 31 38.0 32 43.0 33 88.0 34 191.0 35 533.0 36 2704.0 37 266.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.625 16.425 11.75 34.2 2 30.4 22.125 24.349999999999998 23.125 3 23.525 24.925 25.124999999999996 26.424999999999997 4 26.950000000000003 29.349999999999998 18.875 24.825 5 29.25 31.275 18.05 21.425 6 25.124999999999996 32.9 18.6 23.375 7 24.325 18.175 32.675 24.825 8 24.7 22.375 21.925 31.0 9 24.025 21.975 25.75 28.249999999999996 10-14 26.840000000000003 25.0 21.3 26.86 15-19 26.340000000000003 24.41 22.305 26.945000000000004 20-24 26.595000000000002 24.695 22.065 26.645000000000003 25-29 26.71 24.240000000000002 22.400000000000002 26.650000000000002 30-34 26.135 23.880000000000003 23.3 26.685 35-39 26.200000000000003 24.505 22.73 26.565 40-44 27.139999999999997 24.104999999999997 22.865 25.89 45-49 27.284999999999997 24.665 22.195 25.855 50-54 26.855 24.895 22.485 25.765 55-59 27.284999999999997 24.015 22.605 26.095000000000002 60-64 27.27 24.535 22.564999999999998 25.629999999999995 65-69 27.005000000000003 24.395 23.195 25.405 70-74 27.82 23.655 23.21 25.314999999999998 75-79 27.544999999999998 24.425 22.495 25.535000000000004 80-84 27.0 24.495 22.88 25.624999999999996 85-89 27.310000000000002 23.990000000000002 23.305 25.395 90-94 27.275 24.055 22.925 25.745 95-99 27.045 24.44 23.025000000000002 25.490000000000002 100-104 27.375 24.435000000000002 22.525000000000002 25.665 105-109 27.32 24.8 22.73 25.15 110-114 27.345000000000002 24.235 23.075000000000003 25.345000000000002 115-119 26.91 24.36 22.945 25.785000000000004 120-124 26.93 24.86 22.665 25.545 125-129 27.860000000000003 24.505 22.545 25.09 130-134 27.615000000000002 24.27 22.89 25.224999999999998 135-139 27.894999999999996 24.68 22.985 24.44 140-144 27.235 24.275 23.275000000000002 25.215 145-149 27.465 24.135 23.064999999999998 25.335 150-151 27.725 23.8125 22.725 25.7375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.5 7 1.5 8 0.5 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 1.5 23 1.0 24 1.5 25 1.5 26 0.5 27 0.5 28 1.5 29 3.5 30 4.5 31 3.0 32 3.0 33 7.0 34 11.0 35 13.5 36 23.5 37 35.0 38 46.5 39 51.5 40 71.0 41 98.0 42 112.0 43 134.0 44 150.0 45 159.5 46 159.0 47 159.0 48 157.5 49 159.5 50 169.5 51 162.0 52 147.5 53 141.0 54 132.0 55 119.5 56 116.0 57 111.0 58 98.5 59 86.5 60 86.0 61 97.5 62 87.0 63 82.0 64 84.0 65 71.0 66 76.5 67 77.0 68 74.0 69 82.0 70 71.0 71 57.0 72 47.5 73 37.5 74 35.5 75 25.5 76 14.5 77 10.5 78 6.5 79 3.0 80 2.5 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 1.0 94 0.5 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.85 #Duplication Level Percentage of deduplicated Percentage of total 1 93.16101238556811 86.5 2 6.058158319870759 11.25 3 0.7000538502961766 1.95 4 0.08077544426494346 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.44999999999999996 0.0 0.0 0.0 0.0 116-117 0.4875 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.7124999999999999 0.0 0.0 0.0 0.0 122-123 0.8374999999999999 0.0 0.0 0.0 0.0 124-125 0.975 0.0 0.0 0.0 0.0 126-127 1.0750000000000002 0.0 0.0 0.0 0.0 128-129 1.225 0.0 0.0 0.0 0.0 130-131 1.3125 0.0 0.0 0.0 0.0 132-133 1.5625 0.0 0.0 0.0 0.0 134-135 1.7625000000000002 0.0 0.0 0.0 0.0 136-137 1.925 0.0 0.0 0.0 0.0 138-139 2.2249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1528210 spots for SRR7804137.sra Written 1528210 spots for SRR7804137.sra Read 1528210 spots for SRR7804137.sra Written 1528210 spots for SRR7804137.sra Read 1528210 spots for SRR7804137.sra Written 1528210 spots for SRR7804137.sra Read 1528210 spots for SRR7804137.sra Written 1528210 spots for SRR7804137.sra Read 1528210 spots for SRR7804137.sra Written 1528210 spots for SRR7804137.sra Read 1528210 spots for SRR7804137.sra Written 1528210 spots for SRR7804137.sra Read 1528210 spots for SRR7804137.sra Written 1528210 spots for SRR7804137.sra Read 1528210 spots for SRR7804137.sra Written 1528210 spots for SRR7804137.sra Read 1528210 spots for SRR7804137.sra Written 1528210 spots for SRR7804137.sra Read 1528210 spots for SRR7804137.sra Written 1528210 spots for SRR7804137.sra Read 1528210 spots for SRR7804137.sra Written 1528210 spots for SRR7804137.sra Read 1528220 spots for SRR7804137.sra Written 1528220 spots for SRR7804137.sra Read 1528210 spots for SRR7804137.sra Written 1528210 spots for SRR7804137.sra Read 1528210 spots for SRR7804137.sra Written 1528210 spots for SRR7804137.sra Read 1528210 spots for SRR7804137.sra Written 1528210 spots for SRR7804137.sra Read 1528210 spots for SRR7804137.sra Written 1528210 spots for SRR7804137.sra Read 1528210 spots for SRR7804137.sra Written 1528210 spots for SRR7804137.sra Read 1528210 spots for SRR7804137.sra Written 1528210 spots for SRR7804137.sra Read 1528210 spots for SRR7804137.sra Written 1528210 spots for SRR7804137.sra Read 1528210 spots for SRR7804137.sra Written 1528210 spots for SRR7804137.sra SRR ids: ['SRR7804137.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_efuk_xog SRR7804137.sra spots: 30564210 blocks: [[1, 1528210], [1528211, 3056420], [3056421, 4584630], [4584631, 6112840], [6112841, 7641050], [7641051, 9169260], [9169261, 10697470], [10697471, 12225680], [12225681, 13753890], [13753891, 15282100], [15282101, 16810310], [16810311, 18338520], [18338521, 19866730], [19866731, 21394940], [21394941, 22923150], [22923151, 24451360], [24451361, 25979570], [25979571, 27507780], [27507781, 29035990], [29035991, 30564210]] SRR7804137 file size 10335507 SRR7804137 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804137 SRR7804137_1.fastq SRR7804137_2.fastq Input file: SRR7804137_1.fastq Paired file: SRR7804137_2.fastq trimmed: SRR7804137-trimmed-pair1.fastq, SRR7804137-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:30:02 2024 >> started Tue Dec 10 02:30:37 2024 >> done (34.667s) 30564210 read pairs processed; of these: 102 ( 0.00%) short read pairs filtered out after trimming by size control 976 ( 0.00%) empty read pairs filtered out after trimming by size control 30563132 (100.00%) read pairs available; of these: 1043138 ( 3.41%) trimmed read pairs available after processing 29519994 (96.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 16 0.00% 20 13 0.00% 21 7 0.00% 22 10 0.00% 23 17 0.00% 24 17 0.00% 25 18 0.00% 26 24 0.00% 27 22 0.00% 28 21 0.00% 29 25 0.00% 30 28 0.00% 31 36 0.00% 32 32 0.00% 33 34 0.00% 34 27 0.00% 35 29 0.00% 36 27 0.00% 37 32 0.00% 38 50 0.00% 39 51 0.00% 40 42 0.00% 41 37 0.00% 42 45 0.00% 43 42 0.00% 44 37 0.00% 45 49 0.00% 46 44 0.00% 47 52 0.00% 48 40 0.00% 49 53 0.00% 50 53 0.00% 51 64 0.00% 52 62 0.00% 53 65 0.00% 54 79 0.00% 55 62 0.00% 56 69 0.00% 57 75 0.00% 58 69 0.00% 59 87 0.00% 60 81 0.00% 61 71 0.00% 62 111 0.00% 63 83 0.00% 64 112 0.00% 65 103 0.00% 66 118 0.00% 67 121 0.00% 68 130 0.00% 69 125 0.00% 70 148 0.00% 71 164 0.00% 72 192 0.00% 73 195 0.00% 74 248 0.00% 75 251 0.00% 76 293 0.00% 77 317 0.00% 78 339 0.00% 79 373 0.00% 80 407 0.00% 81 510 0.00% 82 572 0.00% 83 641 0.00% 84 741 0.00% 85 848 0.00% 86 901 0.00% 87 1000 0.00% 88 1076 0.00% 89 1141 0.00% 90 1282 0.00% 91 1537 0.01% 92 1747 0.01% 93 1862 0.01% 94 2120 0.01% 95 2271 0.01% 96 2581 0.01% 97 2794 0.01% 98 3008 0.01% 99 3228 0.01% 100 3575 0.01% 101 3668 0.01% 102 4196 0.01% 103 4625 0.02% 104 4917 0.02% 105 5131 0.02% 106 5585 0.02% 107 6040 0.02% 108 6480 0.02% 109 6740 0.02% 110 7334 0.02% 111 7707 0.03% 112 8375 0.03% 113 8828 0.03% 114 9536 0.03% 115 9979 0.03% 116 10765 0.04% 117 11305 0.04% 118 11715 0.04% 119 12500 0.04% 120 13057 0.04% 121 13915 0.05% 122 14470 0.05% 123 15374 0.05% 124 16321 0.05% 125 17132 0.06% 126 17726 0.06% 127 18644 0.06% 128 19783 0.06% 129 20398 0.07% 130 21235 0.07% 131 22188 0.07% 132 23173 0.08% 133 24429 0.08% 134 25507 0.08% 135 26598 0.09% 136 28086 0.09% 137 29080 0.10% 138 30007 0.10% 139 30974 0.10% 140 32288 0.11% 141 33630 0.11% 142 34982 0.11% 143 36530 0.12% 144 37302 0.12% 145 38986 0.13% 146 40638 0.13% 147 41603 0.14% 148 43558 0.14% 149 44710 0.15% 150 46301 0.15% 151 29519994 96.59% 30563132 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=16.08 fanout-score-rank=11 prefix-density=0.35 prefix-fanout=7.5 sequence=CTTGATGACACCAACAGCAACTGTTTGTCTCATGTCACGCACAGCAAAACGACCAAGAGGAGGGTACATGGCGAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACGATACCAGCATCACCGTTCTTCAAGAACTTGGGCTCCTTCTCCAGCTCCTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=188.59 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=21.0 sequence=CCTTCTTCTTCT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=37 prefix-density=0.31 prefix-fanout=2.3 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=36 fanout-score=756.56 fanout-score-rank=1 prefix-density=1.11 prefix-fanout=20.3 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR7804137 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:31:26 Started mapping on | Dec 10 02:31:27 Finished on | Dec 10 02:38:51 Mapping speed, Million of reads per hour | 247.81 Number of input reads | 30563132 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 27724055 Uniquely mapped reads % | 90.71% Average mapped length | 299.48 Number of splices: Total | 28867734 Number of splices: Annotated (sjdb) | 27058629 Number of splices: GT/AG | 28463419 Number of splices: GC/AG | 316297 Number of splices: AT/AC | 24644 Number of splices: Non-canonical | 63374 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.99 Insertion rate per base | 0.02% Insertion average length | 2.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 432856 % of reads mapped to multiple loci | 1.42% Number of reads mapped to too many loci | 39643 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.80% % of reads unmapped: other | 0.95% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2406221 2406221 2406221 N_multimapping 432856 432856 432856 N_noFeature 585513 27017878 808399 N_ambiguous 561167 4287 80491 UnstrandedReadsAssigned:26577375 PositiveStrandReadsAssigned:701890 NegativeStrandReadsAssigned:26835165 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804137 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804137-trimmed-pair1.fastq SRR7804137-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,563,132 reads, 27,208,141 reads pseudoaligned [quant] estimated average fragment length: 288.756 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52973 SRR7804137.ke.tsv 35125 SRR7804137.se.tsv 88098 total ==> SRR7804137.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 648.847 8.61654e-05 6.4936e-06 PNS24247 1044 756.244 99.5961 6.43985 PNS24249 1928 1640.24 288.332 8.59567 PNS24246 1044 756.244 99.5961 6.43985 PNS24248 1044 756.244 99.5961 6.43985 PNS24244 1471 1183.24 101.879 4.21024 PNS24243 293 75.6475 0 0 KQK14069 1603 1315.24 2740.12 101.873 KQK14071 474 208.955 18.4429 4.3159 ==> SRR7804137.se.tsv <== BRADI_1g14170v3 2812 BRADI_1g53295v3 1414 BRADI_1g59795v3 216 BRADI_1g07683v3 0 BRADI_1g00485v3 105 BRADI_1g20270v3 3118 BRADI_1g74790v3 56 BRADI_1g09890v3 0 BRADI_1g77505v3 278 BRADI_1g48960v3 0 SRR7804137 completed mapping pipeline successfully