Starting /dee2/code/volunteer_pipeline.sh SRR7804138 current disk space = 1525498228736 free memory = 1602159912 SRR7804138 SRAfilesize 88aed9abb17a9705c00879cf62822d9a SRR7804138.sra SRR7804138.sra file validated SRR7804138 is paired end SRR7804138 is conventional basespace SRR7804138 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804138_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.174 37.0 37.0 37.0 37.0 37.0 2 36.2995 37.0 37.0 37.0 37.0 37.0 3 36.429 37.0 37.0 37.0 37.0 37.0 4 36.445 37.0 37.0 37.0 37.0 37.0 5 36.5855 37.0 37.0 37.0 37.0 37.0 6 36.479 37.0 37.0 37.0 37.0 37.0 7 36.382 37.0 37.0 37.0 37.0 37.0 8 36.414 37.0 37.0 37.0 37.0 37.0 9 36.4715 37.0 37.0 37.0 37.0 37.0 10-14 36.500899999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.4889 37.0 37.0 37.0 37.0 37.0 20-24 36.445499999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.3874 37.0 37.0 37.0 37.0 37.0 30-34 36.3698 37.0 37.0 37.0 37.0 37.0 35-39 36.32950000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.41590000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.334199999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.3276 37.0 37.0 37.0 37.0 37.0 55-59 36.3255 37.0 37.0 37.0 37.0 37.0 60-64 36.2774 37.0 37.0 37.0 37.0 37.0 65-69 36.251999999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.205 37.0 37.0 37.0 37.0 37.0 75-79 36.200399999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.142500000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.0878 37.0 37.0 37.0 37.0 37.0 90-94 36.0758 37.0 37.0 37.0 37.0 37.0 95-99 36.1091 37.0 37.0 37.0 37.0 37.0 100-104 36.052499999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.9189 37.0 37.0 37.0 37.0 37.0 110-114 35.965599999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.990899999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.892 37.0 37.0 37.0 37.0 37.0 125-129 35.8374 37.0 37.0 37.0 37.0 37.0 130-134 35.7082 37.0 37.0 37.0 37.0 37.0 135-139 35.7293 37.0 37.0 37.0 37.0 37.0 140-144 35.6745 37.0 37.0 37.0 37.0 37.0 145-149 35.600300000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.1095 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 2.0 21 0.0 22 0.0 23 5.0 24 1.0 25 9.0 26 5.0 27 11.0 28 21.0 29 16.0 30 33.0 31 52.0 32 44.0 33 85.0 34 126.0 35 384.0 36 2825.0 37 380.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.0 15.15 9.925 26.924999999999997 2 27.177177177177175 14.964964964964967 31.256256256256254 26.601601601601605 3 22.425 23.925 25.55 28.1 4 25.674999999999997 28.000000000000004 21.775 24.55 5 26.05 30.525000000000002 21.8 21.625 6 24.125 31.65 22.675 21.55 7 20.075000000000003 23.45 37.175000000000004 19.3 8 20.825 23.599999999999998 27.35 28.225 9 21.0 22.15 31.3 25.55 10-14 23.990000000000002 26.855 24.575 24.58 15-19 23.585 26.090000000000003 25.465 24.86 20-24 23.7 26.229999999999997 24.990000000000002 25.080000000000002 25-29 23.465 25.515 25.025 25.995 30-34 23.544999999999998 25.55 25.264999999999997 25.64 35-39 23.82 25.585 24.98 25.615 40-44 23.080000000000002 26.105 24.51 26.305 45-49 23.955000000000002 26.145000000000003 24.465 25.435000000000002 50-54 24.195 26.395000000000003 24.425 24.985 55-59 23.150000000000002 26.11 24.740000000000002 26.0 60-64 23.815 25.855 24.265 26.064999999999998 65-69 24.12 24.97 25.06 25.85 70-74 24.255 25.19 24.46 26.095000000000002 75-79 24.525 25.785000000000004 24.085 25.605 80-84 24.165 25.645 24.265 25.924999999999997 85-89 23.705000000000002 25.52 24.73 26.045 90-94 24.990000000000002 25.564999999999998 23.86 25.585 95-99 24.505 25.314999999999998 24.51 25.669999999999998 100-104 24.485 24.955 24.16 26.400000000000002 105-109 24.59 25.605 23.97 25.835 110-114 24.295 25.14 24.375 26.19 115-119 24.555 25.305 23.84 26.3 120-124 24.62 24.990000000000002 23.669999999999998 26.72 125-129 24.585 25.650000000000002 23.76 26.005 130-134 24.485 24.959999999999997 24.055 26.5 135-139 24.95 25.074999999999996 24.46 25.515 140-144 24.935 24.845 23.79 26.43 145-149 24.705 24.925 24.349999999999998 26.02 150-151 24.0125 25.1 24.5 26.387500000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 1.0 27 1.0 28 2.5 29 4.5 30 9.5 31 18.0 32 24.0 33 35.5 34 39.5 35 53.5 36 75.5 37 79.0 38 96.0 39 113.5 40 118.0 41 134.5 42 137.0 43 146.0 44 171.5 45 174.5 46 170.5 47 183.0 48 187.0 49 170.5 50 150.0 51 141.0 52 138.5 53 121.5 54 104.5 55 95.5 56 92.0 57 90.5 58 84.0 59 73.5 60 57.0 61 49.5 62 66.5 63 67.0 64 56.0 65 55.0 66 54.5 67 50.0 68 43.5 69 42.5 70 38.5 71 32.5 72 29.5 73 29.0 74 21.0 75 15.5 76 17.0 77 11.5 78 7.5 79 4.5 80 1.5 81 1.0 82 1.0 83 1.5 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.175 #Duplication Level Percentage of deduplicated Percentage of total 1 91.41760350973402 83.35000000000001 2 7.677543186180421 14.000000000000002 3 0.7129147244310392 1.95 4 0.19193857965451055 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.8625 0.0 0.0 0.0 0.0 120-121 0.9125000000000001 0.0 0.0 0.0 0.0 122-123 0.9875 0.0 0.0 0.0 0.0 124-125 1.175 0.0 0.0 0.0 0.0 126-127 1.4 0.0 0.0 0.0 0.0 128-129 1.5 0.0 0.0 0.0 0.0 130-131 1.6124999999999998 0.0 0.0 0.0 0.0 132-133 1.8125 0.0 0.0 0.0 0.0 134-135 2.0125 0.0 0.0 0.0 0.0 136-137 2.325 0.0 0.0 0.0 0.0 138-139 2.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804138 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804138_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.19475 37.0 37.0 37.0 37.0 37.0 2 35.8815 37.0 37.0 37.0 37.0 37.0 3 35.938 37.0 37.0 37.0 37.0 37.0 4 36.0425 37.0 37.0 37.0 37.0 37.0 5 36.045 37.0 37.0 37.0 37.0 37.0 6 36.05 37.0 37.0 37.0 37.0 37.0 7 35.8535 37.0 37.0 37.0 37.0 37.0 8 35.9435 37.0 37.0 37.0 37.0 37.0 9 35.715 37.0 37.0 37.0 37.0 37.0 10-14 35.8873 37.0 37.0 37.0 37.0 37.0 15-19 35.755900000000004 37.0 37.0 37.0 37.0 37.0 20-24 35.6994 37.0 37.0 37.0 37.0 37.0 25-29 35.660399999999996 37.0 37.0 37.0 37.0 37.0 30-34 35.605399999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.5604 37.0 37.0 37.0 37.0 37.0 40-44 35.5201 37.0 37.0 37.0 37.0 37.0 45-49 35.494899999999994 37.0 37.0 37.0 37.0 37.0 50-54 35.464099999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.4106 37.0 37.0 37.0 37.0 37.0 60-64 35.4019 37.0 37.0 37.0 37.0 37.0 65-69 35.3523 37.0 37.0 37.0 37.0 37.0 70-74 35.341300000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.2685 37.0 37.0 37.0 37.0 37.0 80-84 35.2145 37.0 37.0 37.0 37.0 37.0 85-89 35.2733 37.0 37.0 37.0 37.0 37.0 90-94 35.2301 37.0 37.0 37.0 32.2 37.0 95-99 35.1888 37.0 37.0 37.0 37.0 37.0 100-104 35.183499999999995 37.0 37.0 37.0 34.6 37.0 105-109 35.10189999999999 37.0 37.0 37.0 29.8 37.0 110-114 34.951 37.0 37.0 37.0 27.4 37.0 115-119 34.950900000000004 37.0 37.0 37.0 27.4 37.0 120-124 35.0197 37.0 37.0 37.0 29.8 37.0 125-129 34.8641 37.0 37.0 37.0 25.0 37.0 130-134 34.9184 37.0 37.0 37.0 25.0 37.0 135-139 34.787400000000005 37.0 37.0 37.0 25.0 37.0 140-144 34.6725 37.0 37.0 37.0 25.0 37.0 145-149 34.6055 37.0 37.0 37.0 25.0 37.0 150-151 34.12875 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 15.0 14 24.0 15 13.0 16 10.0 17 11.0 18 4.0 19 11.0 20 6.0 21 9.0 22 22.0 23 12.0 24 22.0 25 7.0 26 10.0 27 12.0 28 15.0 29 25.0 30 27.0 31 35.0 32 60.0 33 111.0 34 185.0 35 562.0 36 2584.0 37 207.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.911727931982995 18.404601150287572 10.152538134533634 24.5311327831958 2 32.775 22.275 24.2 20.75 3 26.55 25.324999999999996 26.650000000000002 21.475 4 27.975 29.525000000000002 19.625 22.875 5 30.275000000000002 30.975 18.475 20.275000000000002 6 26.05 33.025 18.775 22.15 7 25.724999999999998 18.2 32.625 23.45 8 26.450000000000003 23.0 21.875 28.675 9 27.125 21.9 24.875 26.1 10-14 28.12 24.65 21.68 25.55 15-19 27.775 24.365000000000002 23.22 24.64 20-24 26.979999999999997 24.72 23.095 25.205 25-29 27.595 25.069999999999997 22.835 24.5 30-34 26.665 25.535000000000004 23.435 24.365000000000002 35-39 26.525 24.975 23.14 25.36 40-44 26.815 24.404999999999998 23.32 25.46 45-49 26.605 25.619999999999997 22.755 25.019999999999996 50-54 26.889999999999997 24.87 23.695 24.545 55-59 26.155 25.085 23.51 25.25 60-64 26.700000000000003 25.495 23.05 24.755 65-69 26.99 25.424999999999997 23.02 24.565 70-74 26.365 25.240000000000002 23.525 24.87 75-79 27.025 24.715 23.7 24.560000000000002 80-84 26.810000000000002 25.575 23.185 24.43 85-89 27.18 24.945 23.515 24.36 90-94 26.255 25.169999999999998 23.365 25.21 95-99 26.69 25.169999999999998 23.645 24.495 100-104 27.015 25.03 23.025000000000002 24.93 105-109 26.6 25.115 23.985 24.3 110-114 26.61 25.305 23.56 24.525 115-119 26.855 25.28 23.405 24.46 120-124 26.345000000000002 26.169999999999998 23.244999999999997 24.240000000000002 125-129 26.355 25.965 23.695 23.985 130-134 26.55 25.580000000000002 23.580000000000002 24.29 135-139 26.58 25.715 24.29 23.415 140-144 26.224999999999998 26.25 23.849999999999998 23.674999999999997 145-149 26.545 25.495 24.175 23.785 150-151 27.187499999999996 25.825 23.45 23.5375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 1.0 9 2.5 10 3.5 11 3.0 12 2.0 13 2.0 14 1.5 15 1.5 16 2.5 17 1.5 18 0.5 19 1.5 20 3.0 21 4.5 22 4.5 23 3.0 24 1.5 25 0.5 26 2.5 27 4.0 28 4.0 29 6.0 30 8.0 31 9.0 32 12.5 33 15.5 34 16.5 35 29.0 36 43.0 37 51.5 38 65.0 39 81.5 40 96.5 41 112.0 42 125.5 43 141.0 44 145.5 45 147.5 46 183.5 47 179.0 48 150.0 49 154.0 50 156.5 51 146.0 52 130.0 53 132.5 54 131.5 55 112.5 56 102.0 57 95.0 58 83.5 59 81.0 60 81.5 61 76.5 62 67.5 63 60.5 64 54.5 65 56.5 66 65.0 67 66.0 68 64.5 69 58.5 70 52.5 71 49.5 72 40.5 73 36.5 74 31.0 75 28.0 76 23.0 77 15.5 78 15.5 79 9.0 80 3.0 81 1.5 82 1.5 83 2.5 84 1.5 85 1.0 86 1.5 87 1.5 88 3.0 89 2.0 90 0.5 91 2.0 92 2.5 93 1.5 94 0.5 95 0.5 96 1.5 97 1.5 98 1.5 99 1.5 100 10.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.025 #Duplication Level Percentage of deduplicated Percentage of total 1 91.30797000833101 82.19999999999999 2 7.664537628436545 13.8 3 0.7220216606498195 1.95 4 0.1666203832268814 0.6 5 0.027770063871146906 0.125 6 0.0 0.0 7 0.05554012774229381 0.35000000000000003 8 0.0 0.0 9 0.027770063871146906 0.22499999999999998 >10 0.027770063871146906 0.75 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 30 0.75 No Hit GAAACATCCTTAACTGAGCTCCTCACTCACTCACTGCAGCTAGCCTCTTC 9 0.22499999999999998 No Hit CCTTAACTGAGCTCCTCACTCACTCACTGCAGCTAGCCTCTTCTTCCTCA 7 0.17500000000000002 No Hit GAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAA 7 0.17500000000000002 No Hit TAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.8625 0.0 0.0 0.0 0.0 120-121 0.9125000000000001 0.0 0.0 0.0 0.0 122-123 0.9875 0.0 0.0 0.0 0.0 124-125 1.175 0.0 0.0 0.0 0.0 126-127 1.4 0.0 0.0 0.0 0.0 128-129 1.5 0.0 0.0 0.0 0.0 130-131 1.6124999999999998 0.0 0.0 0.0 0.0 132-133 1.7875 0.0 0.0 0.0 0.0 134-135 1.9874999999999998 0.0 0.0 0.0 0.0 136-137 2.3125 0.0 0.0 0.0 0.0 138-139 2.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATGTAA 10 0.006830828 145.0 5 >>END_MODULE Read 1038711 spots for SRR7804138.sra Written 1038711 spots for SRR7804138.sra Read 1038711 spots for SRR7804138.sra Written 1038711 spots for SRR7804138.sra Read 1038711 spots for SRR7804138.sra Written 1038711 spots for SRR7804138.sra Read 1038711 spots for SRR7804138.sra Written 1038711 spots for SRR7804138.sra Read 1038711 spots for SRR7804138.sra Written 1038711 spots for SRR7804138.sra Read 1038711 spots for SRR7804138.sra Written 1038711 spots for SRR7804138.sra Read 1038711 spots for SRR7804138.sra Written 1038711 spots for SRR7804138.sra Read 1038711 spots for SRR7804138.sra Written 1038711 spots for SRR7804138.sra Read 1038711 spots for SRR7804138.sra Written 1038711 spots for SRR7804138.sra Read 1038711 spots for SRR7804138.sra Written 1038711 spots for SRR7804138.sra Read 1038711 spots for SRR7804138.sra Written 1038711 spots for SRR7804138.sra Read 1038711 spots for SRR7804138.sra Written 1038711 spots for SRR7804138.sra Read 1038711 spots for SRR7804138.sra Written 1038711 spots for SRR7804138.sra Read 1038730 spots for SRR7804138.sra Written 1038730 spots for SRR7804138.sra Read 1038711 spots for SRR7804138.sra Written 1038711 spots for SRR7804138.sra Read 1038711 spots for SRR7804138.sra Written 1038711 spots for SRR7804138.sra Read 1038711 spots for SRR7804138.sra Written 1038711 spots for SRR7804138.sra Read 1038711 spots for SRR7804138.sra Written 1038711 spots for SRR7804138.sra Read 1038711 spots for SRR7804138.sra Written 1038711 spots for SRR7804138.sra Read 1038711 spots for SRR7804138.sra Written 1038711 spots for SRR7804138.sra SRR ids: ['SRR7804138.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h0a10uba SRR7804138.sra spots: 20774239 blocks: [[1, 1038711], [1038712, 2077422], [2077423, 3116133], [3116134, 4154844], [4154845, 5193555], [5193556, 6232266], [6232267, 7270977], [7270978, 8309688], [8309689, 9348399], [9348400, 10387110], [10387111, 11425821], [11425822, 12464532], [12464533, 13503243], [13503244, 14541954], [14541955, 15580665], [15580666, 16619376], [16619377, 17658087], [17658088, 18696798], [18696799, 19735509], [19735510, 20774239]] SRR7804138 file size 7018007 SRR7804138 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804138 SRR7804138_1.fastq SRR7804138_2.fastq Input file: SRR7804138_1.fastq Paired file: SRR7804138_2.fastq trimmed: SRR7804138-trimmed-pair1.fastq, SRR7804138-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:32:00 2024 >> started Tue Dec 10 02:32:26 2024 >> done (26.057s) 20774239 read pairs processed; of these: 234 ( 0.00%) short read pairs filtered out after trimming by size control 2551 ( 0.01%) empty read pairs filtered out after trimming by size control 20771454 (99.99%) read pairs available; of these: 862782 ( 4.15%) trimmed read pairs available after processing 19908672 (95.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 23 0.00% 19 21 0.00% 20 18 0.00% 21 23 0.00% 22 14 0.00% 23 27 0.00% 24 18 0.00% 25 19 0.00% 26 22 0.00% 27 22 0.00% 28 26 0.00% 29 30 0.00% 30 32 0.00% 31 23 0.00% 32 27 0.00% 33 25 0.00% 34 25 0.00% 35 24 0.00% 36 27 0.00% 37 31 0.00% 38 45 0.00% 39 42 0.00% 40 34 0.00% 41 39 0.00% 42 50 0.00% 43 38 0.00% 44 37 0.00% 45 32 0.00% 46 29 0.00% 47 40 0.00% 48 53 0.00% 49 45 0.00% 50 58 0.00% 51 49 0.00% 52 42 0.00% 53 70 0.00% 54 64 0.00% 55 54 0.00% 56 72 0.00% 57 75 0.00% 58 50 0.00% 59 56 0.00% 60 75 0.00% 61 86 0.00% 62 97 0.00% 63 95 0.00% 64 108 0.00% 65 122 0.00% 66 104 0.00% 67 112 0.00% 68 154 0.00% 69 131 0.00% 70 151 0.00% 71 222 0.00% 72 209 0.00% 73 253 0.00% 74 303 0.00% 75 282 0.00% 76 334 0.00% 77 339 0.00% 78 355 0.00% 79 424 0.00% 80 490 0.00% 81 553 0.00% 82 677 0.00% 83 742 0.00% 84 820 0.00% 85 901 0.00% 86 1014 0.00% 87 1081 0.01% 88 1188 0.01% 89 1249 0.01% 90 1416 0.01% 91 1635 0.01% 92 1838 0.01% 93 1985 0.01% 94 2266 0.01% 95 2408 0.01% 96 2518 0.01% 97 2729 0.01% 98 2764 0.01% 99 3111 0.01% 100 3431 0.02% 101 3663 0.02% 102 4070 0.02% 103 4435 0.02% 104 4922 0.02% 105 5145 0.02% 106 5440 0.03% 107 5567 0.03% 108 5918 0.03% 109 6201 0.03% 110 6747 0.03% 111 6910 0.03% 112 7635 0.04% 113 8349 0.04% 114 9100 0.04% 115 9303 0.04% 116 9725 0.05% 117 10141 0.05% 118 10417 0.05% 119 10879 0.05% 120 11064 0.05% 121 11803 0.06% 122 12119 0.06% 123 13568 0.07% 124 14723 0.07% 125 15309 0.07% 126 15989 0.08% 127 16331 0.08% 128 16138 0.08% 129 17137 0.08% 130 17292 0.08% 131 17852 0.09% 132 18730 0.09% 133 19939 0.10% 134 21010 0.10% 135 22229 0.11% 136 23338 0.11% 137 23383 0.11% 138 24238 0.12% 139 24616 0.12% 140 24722 0.12% 141 25124 0.12% 142 27038 0.13% 143 27847 0.13% 144 29039 0.14% 145 30882 0.15% 146 32206 0.16% 147 33347 0.16% 148 32652 0.16% 149 33760 0.16% 150 34467 0.17% 151 19908672 95.85% 20771454 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=31 prefix-density=0.67 prefix-fanout=2.6 sequence=TGCCGCACTTGCAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=189.77 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=12.6 sequence=TCTTCTTGGCATGTACAAACCGCTAATTATACTTCTGCTTTGCGATTATACTGATTATACCGGCAGCAGTGTAGCCTATAATAACGAAAATAGATTATCTTTTCTGGAGTACACTCCATGCATCAGTCTCTTATTTATATAAATATAAATATTTCGACGATGCAAATATTTCATACTTTCCGATTGGACACTTTTCAGCGCATTCAACCACGACGATTAGAATCAAGGGTTTTCCATTTCCAACCCCTGCAGGCAGGGGAATTTGCTTATTTTGCAGTCATGGTCACCATGGCCACCATCAGATCGCTTCCCGTCAACGACCACCACCGCCATCGCCTGAGTTTCGCCTGTCTGCTGTCCATCATCTCCGGCCAACTTCCTCGCCGGAGCAGCAGAAGCA criterion=sequence-density sequence-density=1.93 sequence-density-rank=1 fanout-score=3.16 fanout-score-rank=24 prefix-density=2.13 prefix-fanout=2.9 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.12 sequence-density-rank=23 fanout-score=148.87 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=20.9 sequence=CGCCGCCGCCGC SRR7804138 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:33:31 Started mapping on | Dec 10 02:33:31 Finished on | Dec 10 02:40:43 Mapping speed, Million of reads per hour | 173.10 Number of input reads | 20771454 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 17518497 Uniquely mapped reads % | 84.34% Average mapped length | 298.80 Number of splices: Total | 15711862 Number of splices: Annotated (sjdb) | 14619164 Number of splices: GT/AG | 15460924 Number of splices: GC/AG | 180379 Number of splices: AT/AC | 10622 Number of splices: Non-canonical | 59937 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 270072 % of reads mapped to multiple loci | 1.30% Number of reads mapped to too many loci | 27294 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.22% % of reads unmapped: other | 1.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2982885 2982885 2982885 N_multimapping 270072 270072 270072 N_noFeature 628237 16908848 875470 N_ambiguous 438058 3399 80147 UnstrandedReadsAssigned:16452202 PositiveStrandReadsAssigned:606250 NegativeStrandReadsAssigned:16562880 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804138 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804138-trimmed-pair1.fastq SRR7804138-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,771,454 reads, 17,176,728 reads pseudoaligned [quant] estimated average fragment length: 300.29 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52973 SRR7804138.ke.tsv 35125 SRR7804138.se.tsv 88098 total ==> SRR7804138.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 637.39 0 0 PNS24247 1044 744.71 77.5211 7.58601 PNS24249 1928 1628.71 255.012 11.4103 PNS24246 1044 744.71 77.5211 7.58601 PNS24248 1044 744.71 77.5211 7.58601 PNS24244 1471 1171.71 114.425 7.11675 PNS24243 293 80.0289 0 0 KQK14069 1603 1303.71 6017.31 336.358 KQK14071 474 203.638 49.5064 17.7167 ==> SRR7804138.se.tsv <== BRADI_1g14170v3 6129 BRADI_1g53295v3 1420 BRADI_1g59795v3 371 BRADI_1g07683v3 0 BRADI_1g00485v3 43 BRADI_1g20270v3 712 BRADI_1g74790v3 80 BRADI_1g09890v3 0 BRADI_1g77505v3 365 BRADI_1g48960v3 0 SRR7804138 completed mapping pipeline successfully