Starting /dee2/code/volunteer_pipeline.sh SRR7804139 current disk space = 1525383733248 free memory = 1419316128 SRR7804139 SRAfilesize eda1d8c599c83f51839e102c10fc8b76 SRR7804139.sra SRR7804139.sra file validated SRR7804139 is paired end SRR7804139 is conventional basespace SRR7804139 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804139_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2445 37.0 37.0 37.0 37.0 37.0 2 36.33975 37.0 37.0 37.0 37.0 37.0 3 36.4695 37.0 37.0 37.0 37.0 37.0 4 36.4665 37.0 37.0 37.0 37.0 37.0 5 36.528 37.0 37.0 37.0 37.0 37.0 6 36.5305 37.0 37.0 37.0 37.0 37.0 7 36.557 37.0 37.0 37.0 37.0 37.0 8 36.569 37.0 37.0 37.0 37.0 37.0 9 36.5665 37.0 37.0 37.0 37.0 37.0 10-14 36.5127 37.0 37.0 37.0 37.0 37.0 15-19 36.5095 37.0 37.0 37.0 37.0 37.0 20-24 36.5022 37.0 37.0 37.0 37.0 37.0 25-29 36.4991 37.0 37.0 37.0 37.0 37.0 30-34 36.4533 37.0 37.0 37.0 37.0 37.0 35-39 36.4183 37.0 37.0 37.0 37.0 37.0 40-44 36.449400000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.3748 37.0 37.0 37.0 37.0 37.0 50-54 36.432500000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.3912 37.0 37.0 37.0 37.0 37.0 60-64 36.3395 37.0 37.0 37.0 37.0 37.0 65-69 36.3312 37.0 37.0 37.0 37.0 37.0 70-74 36.291700000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.282 37.0 37.0 37.0 37.0 37.0 80-84 36.2861 37.0 37.0 37.0 37.0 37.0 85-89 36.2118 37.0 37.0 37.0 37.0 37.0 90-94 36.193 37.0 37.0 37.0 37.0 37.0 95-99 36.1789 37.0 37.0 37.0 37.0 37.0 100-104 36.17479999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.1005 37.0 37.0 37.0 37.0 37.0 110-114 36.087 37.0 37.0 37.0 37.0 37.0 115-119 36.1257 37.0 37.0 37.0 37.0 37.0 120-124 36.0444 37.0 37.0 37.0 37.0 37.0 125-129 35.8972 37.0 37.0 37.0 37.0 37.0 130-134 35.916 37.0 37.0 37.0 37.0 37.0 135-139 35.846599999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.808 37.0 37.0 37.0 37.0 37.0 145-149 35.8158 37.0 37.0 37.0 37.0 37.0 150-151 35.2055 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 3.0 24 1.0 25 2.0 26 5.0 27 7.0 28 15.0 29 16.0 30 30.0 31 31.0 32 61.0 33 80.0 34 129.0 35 295.0 36 2923.0 37 400.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.775 12.625 8.674999999999999 34.925 2 28.271203402551915 13.685263947960971 28.7215411558669 29.321991493620214 3 23.925 16.650000000000002 22.8 36.625 4 27.1 21.224999999999998 21.875 29.799999999999997 5 28.775000000000002 24.975 21.9 24.349999999999998 6 26.625 28.9 20.25 24.224999999999998 7 18.925 26.724999999999998 33.775 20.575 8 21.75 23.775 28.1 26.375 9 22.7 21.7 30.575000000000003 25.025 10-14 24.32 25.41 24.57 25.7 15-19 23.82 25.11 24.33 26.740000000000002 20-24 24.34 25.240000000000002 24.245 26.174999999999997 25-29 24.605 24.495 24.14 26.76 30-34 24.485 24.765 24.310000000000002 26.44 35-39 24.255 24.87 24.275 26.6 40-44 23.919999999999998 24.3 25.095 26.685 45-49 24.775 24.33 24.675 26.22 50-54 24.685000000000002 24.445 24.095 26.775 55-59 24.79 24.695 24.310000000000002 26.205000000000002 60-64 24.474999999999998 24.505 23.925 27.095000000000002 65-69 24.985 24.46 23.985 26.57 70-74 25.135 24.645 23.93 26.290000000000003 75-79 24.84 23.61 24.43 27.12 80-84 25.330000000000002 24.43 23.68 26.56 85-89 24.94 24.33 23.87 26.86 90-94 24.955 24.42 24.08 26.545 95-99 25.135 24.3 24.18 26.384999999999998 100-104 25.180000000000003 23.515 24.245 27.060000000000002 105-109 25.215 23.995 24.11 26.68 110-114 24.975 24.015 24.09 26.919999999999998 115-119 25.435000000000002 24.044999999999998 23.599999999999998 26.919999999999998 120-124 25.169999999999998 23.98 24.425 26.424999999999997 125-129 25.61 23.525 24.195 26.669999999999998 130-134 25.53 24.135 23.585 26.75 135-139 25.245 24.14 23.885 26.729999999999997 140-144 25.05 23.895 24.165 26.889999999999997 145-149 25.0 23.905 23.895 27.200000000000003 150-151 25.825 23.724999999999998 23.525 26.924999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 0.5 26 0.0 27 0.5 28 1.0 29 1.5 30 3.5 31 4.5 32 10.5 33 19.0 34 22.5 35 25.5 36 29.0 37 44.5 38 68.0 39 75.5 40 81.5 41 113.0 42 128.5 43 142.5 44 164.5 45 174.5 46 177.5 47 178.5 48 185.0 49 190.5 50 185.5 51 178.5 52 158.0 53 131.0 54 131.5 55 121.5 56 106.5 57 90.0 58 76.5 59 81.5 60 77.5 61 67.5 62 66.0 63 67.0 64 66.5 65 61.0 66 56.0 67 61.5 68 60.0 69 43.0 70 36.5 71 46.5 72 40.5 73 30.5 74 32.0 75 23.0 76 14.0 77 11.5 78 10.5 79 7.0 80 4.5 81 4.5 82 3.5 83 2.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.025 #Duplication Level Percentage of deduplicated Percentage of total 1 93.0126310131685 86.52499999999999 2 6.584251545283526 12.25 3 0.32249395323837676 0.8999999999999999 4 0.053748992206396125 0.2 5 0.026874496103198062 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAAAAGTCTCTTTTGCCCCTAGCAGCTGGACTAGTAGGTGTAATCATTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.675 0.0 0.0 0.0 0.0 120-121 0.8500000000000001 0.0 0.0 0.0 0.0 122-123 1.0375 0.0 0.0 0.0 0.0 124-125 1.1375000000000002 0.0 0.0 0.0 0.0 126-127 1.25 0.0 0.0 0.0 0.0 128-129 1.4 0.0 0.0 0.0 0.0 130-131 1.525 0.0 0.0 0.0 0.0 132-133 1.6749999999999998 0.0 0.0 0.0 0.0 134-135 1.8624999999999998 0.0 0.0 0.0 0.0 136-137 2.0999999999999996 0.0 0.0 0.0 0.0 138-139 2.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTGAT 10 0.006830828 145.0 3 >>END_MODULE SRR7804139 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804139_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2925 37.0 37.0 37.0 37.0 37.0 2 36.0565 37.0 37.0 37.0 37.0 37.0 3 36.153 37.0 37.0 37.0 37.0 37.0 4 36.2565 37.0 37.0 37.0 37.0 37.0 5 36.221 37.0 37.0 37.0 37.0 37.0 6 36.165 37.0 37.0 37.0 37.0 37.0 7 36.116 37.0 37.0 37.0 37.0 37.0 8 36.2655 37.0 37.0 37.0 37.0 37.0 9 36.211 37.0 37.0 37.0 37.0 37.0 10-14 36.20360000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.1021 37.0 37.0 37.0 37.0 37.0 20-24 36.128 37.0 37.0 37.0 37.0 37.0 25-29 36.1293 37.0 37.0 37.0 37.0 37.0 30-34 36.0901 37.0 37.0 37.0 37.0 37.0 35-39 36.0811 37.0 37.0 37.0 37.0 37.0 40-44 36.0273 37.0 37.0 37.0 37.0 37.0 45-49 35.976 37.0 37.0 37.0 37.0 37.0 50-54 35.975 37.0 37.0 37.0 37.0 37.0 55-59 35.932399999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.9375 37.0 37.0 37.0 37.0 37.0 65-69 35.8876 37.0 37.0 37.0 37.0 37.0 70-74 35.786699999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.7509 37.0 37.0 37.0 37.0 37.0 80-84 35.7852 37.0 37.0 37.0 37.0 37.0 85-89 35.7767 37.0 37.0 37.0 37.0 37.0 90-94 35.799699999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.697500000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.70790000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.636 37.0 37.0 37.0 37.0 37.0 110-114 35.4917 37.0 37.0 37.0 37.0 37.0 115-119 35.508799999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.44870000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.3502 37.0 37.0 37.0 37.0 37.0 130-134 35.468 37.0 37.0 37.0 37.0 37.0 135-139 35.3738 37.0 37.0 37.0 37.0 37.0 140-144 35.2899 37.0 37.0 37.0 29.8 37.0 145-149 35.1072 37.0 37.0 37.0 27.4 37.0 150-151 34.672250000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 3.0 15 1.0 16 1.0 17 0.0 18 2.0 19 5.0 20 4.0 21 2.0 22 10.0 23 6.0 24 3.0 25 7.0 26 11.0 27 6.0 28 27.0 29 26.0 30 23.0 31 42.0 32 58.0 33 110.0 34 207.0 35 586.0 36 2648.0 37 207.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.26913456728364 18.884442221110557 11.28064032016008 31.56578289144572 2 31.0 22.7 24.349999999999998 21.95 3 23.775 24.85 26.125 25.25 4 28.749999999999996 28.825 18.9 23.525 5 28.125 31.7 18.4 21.775 6 23.549999999999997 32.775 18.975 24.7 7 22.675 18.7 32.925 25.7 8 25.5 22.650000000000002 21.7 30.15 9 24.65 22.925 25.1 27.325 10-14 26.555 24.94 21.475 27.029999999999998 15-19 26.47 23.915 22.78 26.834999999999997 20-24 26.325 24.310000000000002 23.24 26.125 25-29 26.490000000000002 23.98 22.7 26.83 30-34 25.979999999999997 25.035 22.235 26.75 35-39 26.939999999999998 24.58 21.875 26.605 40-44 26.840000000000003 24.654999999999998 22.41 26.095000000000002 45-49 26.83 23.89 22.955000000000002 26.325 50-54 26.815 24.884999999999998 22.7 25.6 55-59 27.12 24.335 22.515 26.029999999999998 60-64 27.295 24.065 22.564999999999998 26.075 65-69 26.465 24.615000000000002 23.185 25.735000000000003 70-74 27.279999999999998 24.295 22.275 26.150000000000002 75-79 26.875 24.21 23.28 25.635 80-84 26.46 24.21 23.185 26.145000000000003 85-89 27.26 24.279999999999998 23.005 25.455 90-94 27.245 23.66 23.225 25.869999999999997 95-99 27.534999999999997 24.665 22.67 25.130000000000003 100-104 27.825 24.84 22.650000000000002 24.685000000000002 105-109 27.445000000000004 24.175 22.81 25.569999999999997 110-114 27.11 24.39 22.675 25.825 115-119 27.029999999999998 24.63 22.955000000000002 25.385 120-124 26.674999999999997 24.625 23.49 25.21 125-129 27.339999999999996 24.72 23.055 24.884999999999998 130-134 27.175 24.11 23.535 25.180000000000003 135-139 27.35 24.735 23.13 24.785 140-144 27.584999999999997 24.36 23.415 24.64 145-149 27.73 24.04 23.48 24.75 150-151 26.937499999999996 23.962500000000002 22.8375 26.2625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 2.0 26 2.0 27 0.5 28 0.0 29 1.5 30 3.5 31 4.0 32 6.0 33 7.0 34 7.0 35 14.0 36 22.0 37 36.0 38 48.5 39 56.5 40 66.0 41 87.5 42 124.5 43 153.5 44 169.0 45 167.5 46 161.0 47 174.5 48 173.0 49 151.5 50 155.5 51 155.5 52 133.5 53 129.5 54 128.0 55 105.0 56 88.5 57 93.0 58 107.5 59 100.5 60 95.5 61 102.5 62 101.0 63 89.0 64 80.5 65 81.5 66 86.5 67 80.5 68 81.0 69 73.5 70 55.5 71 54.5 72 40.5 73 28.0 74 25.0 75 24.5 76 21.0 77 15.5 78 7.0 79 2.0 80 3.0 81 1.5 82 0.5 83 1.5 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.80000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.83405172413794 86.15 2 6.68103448275862 12.4 3 0.4040948275862069 1.125 4 0.05387931034482758 0.2 5 0.02693965517241379 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.6375 0.0 0.0 0.0 0.0 120-121 0.8 0.0 0.0 0.0 0.0 122-123 0.9874999999999999 0.0 0.0 0.0 0.0 124-125 1.0750000000000002 0.0 0.0 0.0 0.0 126-127 1.1749999999999998 0.0 0.0 0.0 0.0 128-129 1.3375 0.0 0.0 0.0 0.0 130-131 1.475 0.0 0.0 0.0 0.0 132-133 1.625 0.0 0.0 0.0 0.0 134-135 1.8125 0.0 0.0 0.0 0.0 136-137 2.05 0.0 0.0 0.0 0.0 138-139 2.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGCAAC 10 0.006830828 145.0 6 >>END_MODULE Read 1555127 spots for SRR7804139.sra Written 1555127 spots for SRR7804139.sra Read 1555127 spots for SRR7804139.sra Written 1555127 spots for SRR7804139.sra Read 1555127 spots for SRR7804139.sra Written 1555127 spots for SRR7804139.sra Read 1555127 spots for SRR7804139.sra Written 1555127 spots for SRR7804139.sra Read 1555127 spots for SRR7804139.sra Written 1555127 spots for SRR7804139.sra Read 1555135 spots for SRR7804139.sra Written 1555135 spots for SRR7804139.sra Read 1555127 spots for SRR7804139.sra Written 1555127 spots for SRR7804139.sra Read 1555127 spots for SRR7804139.sra Written 1555127 spots for SRR7804139.sra Read 1555127 spots for SRR7804139.sra Written 1555127 spots for SRR7804139.sra Read 1555127 spots for SRR7804139.sra Written 1555127 spots for SRR7804139.sra Read 1555127 spots for SRR7804139.sra Written 1555127 spots for SRR7804139.sra Read 1555127 spots for SRR7804139.sra Written 1555127 spots for SRR7804139.sra Read 1555127 spots for SRR7804139.sra Written 1555127 spots for SRR7804139.sra Read 1555127 spots for SRR7804139.sra Written 1555127 spots for SRR7804139.sra Read 1555127 spots for SRR7804139.sra Written 1555127 spots for SRR7804139.sra Read 1555127 spots for SRR7804139.sra Written 1555127 spots for SRR7804139.sra Read 1555127 spots for SRR7804139.sra Written 1555127 spots for SRR7804139.sra Read 1555127 spots for SRR7804139.sra Written 1555127 spots for SRR7804139.sra Read 1555127 spots for SRR7804139.sra Written 1555127 spots for SRR7804139.sra Read 1555127 spots for SRR7804139.sra Written 1555127 spots for SRR7804139.sra SRR ids: ['SRR7804139.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lbjwro6t SRR7804139.sra spots: 31102548 blocks: [[1, 1555127], [1555128, 3110254], [3110255, 4665381], [4665382, 6220508], [6220509, 7775635], [7775636, 9330762], [9330763, 10885889], [10885890, 12441016], [12441017, 13996143], [13996144, 15551270], [15551271, 17106397], [17106398, 18661524], [18661525, 20216651], [20216652, 21771778], [21771779, 23326905], [23326906, 24882032], [24882033, 26437159], [26437160, 27992286], [27992287, 29547413], [29547414, 31102548]] SRR7804139 file size 10517932 SRR7804139 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804139 SRR7804139_1.fastq SRR7804139_2.fastq Input file: SRR7804139_1.fastq Paired file: SRR7804139_2.fastq trimmed: SRR7804139-trimmed-pair1.fastq, SRR7804139-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:35:11 2024 >> started Tue Dec 10 02:35:53 2024 >> done (42.137s) 31102548 read pairs processed; of these: 121 ( 0.00%) short read pairs filtered out after trimming by size control 668 ( 0.00%) empty read pairs filtered out after trimming by size control 31101759 (100.00%) read pairs available; of these: 1066363 ( 3.43%) trimmed read pairs available after processing 30035396 (96.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 10 0.00% 20 8 0.00% 21 9 0.00% 22 9 0.00% 23 20 0.00% 24 23 0.00% 25 20 0.00% 26 20 0.00% 27 18 0.00% 28 11 0.00% 29 26 0.00% 30 31 0.00% 31 20 0.00% 32 20 0.00% 33 29 0.00% 34 20 0.00% 35 33 0.00% 36 33 0.00% 37 30 0.00% 38 36 0.00% 39 39 0.00% 40 31 0.00% 41 32 0.00% 42 40 0.00% 43 49 0.00% 44 37 0.00% 45 43 0.00% 46 47 0.00% 47 43 0.00% 48 54 0.00% 49 43 0.00% 50 58 0.00% 51 52 0.00% 52 44 0.00% 53 53 0.00% 54 51 0.00% 55 63 0.00% 56 54 0.00% 57 52 0.00% 58 68 0.00% 59 50 0.00% 60 75 0.00% 61 77 0.00% 62 88 0.00% 63 122 0.00% 64 83 0.00% 65 92 0.00% 66 88 0.00% 67 108 0.00% 68 119 0.00% 69 143 0.00% 70 163 0.00% 71 194 0.00% 72 212 0.00% 73 211 0.00% 74 254 0.00% 75 280 0.00% 76 308 0.00% 77 319 0.00% 78 396 0.00% 79 415 0.00% 80 456 0.00% 81 473 0.00% 82 623 0.00% 83 676 0.00% 84 761 0.00% 85 893 0.00% 86 921 0.00% 87 1133 0.00% 88 1179 0.00% 89 1338 0.00% 90 1478 0.00% 91 1684 0.01% 92 1861 0.01% 93 2113 0.01% 94 2325 0.01% 95 2494 0.01% 96 2760 0.01% 97 2935 0.01% 98 3242 0.01% 99 3485 0.01% 100 3864 0.01% 101 4122 0.01% 102 4472 0.01% 103 4859 0.02% 104 5153 0.02% 105 5627 0.02% 106 6133 0.02% 107 6253 0.02% 108 6697 0.02% 109 7375 0.02% 110 7707 0.02% 111 8161 0.03% 112 8710 0.03% 113 9321 0.03% 114 9927 0.03% 115 10384 0.03% 116 11021 0.04% 117 11676 0.04% 118 12404 0.04% 119 12737 0.04% 120 13306 0.04% 121 14322 0.05% 122 14973 0.05% 123 15873 0.05% 124 16825 0.05% 125 17658 0.06% 126 18545 0.06% 127 19352 0.06% 128 19956 0.06% 129 20955 0.07% 130 21750 0.07% 131 22482 0.07% 132 23907 0.08% 133 25018 0.08% 134 25909 0.08% 135 27250 0.09% 136 28647 0.09% 137 29707 0.10% 138 30725 0.10% 139 31526 0.10% 140 32533 0.10% 141 34240 0.11% 142 35516 0.11% 143 36425 0.12% 144 37892 0.12% 145 39768 0.13% 146 40660 0.13% 147 41720 0.13% 148 43351 0.14% 149 44828 0.14% 150 46123 0.15% 151 30035396 96.57% 31101759 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=13.00 fanout-score-rank=17 prefix-density=0.39 prefix-fanout=7.0 sequence=CTTGATGACACCAACAGCAACTGTTTGTCTCATGTCACGCACAGCAAAACGACCAAGAGGAGGGTACATGGCGAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACGATACCAGCATCACCGTTCTTCAAGAACTTGGGCTCCTTCTCCAGCTCCTTACCAGATCGCCTGTCAATCTTGGTCACCAGCTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=35 fanout-score=540.83 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=23.3 sequence=CAGCAGCAGTCGGACATGGGTTCACGAAACTAAACGATGAGACGACGAAACGGAGGGCATTGACGCCGGCCGAACGAACTCGGAAGCAGAAGCAGCTTGCATCGATCTGCTTAGTAGTCGGTGGTGGGGAGCTGCTCATGG criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=37 prefix-density=0.42 prefix-fanout=2.4 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=36 fanout-score=806.39 fanout-score-rank=1 prefix-density=1.30 prefix-fanout=18.6 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR7804139 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:37:12 Started mapping on | Dec 10 02:37:13 Finished on | Dec 10 02:42:04 Mapping speed, Million of reads per hour | 384.76 Number of input reads | 31101759 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 28841623 Uniquely mapped reads % | 92.73% Average mapped length | 299.53 Number of splices: Total | 31330097 Number of splices: Annotated (sjdb) | 29542150 Number of splices: GT/AG | 30899952 Number of splices: GC/AG | 347542 Number of splices: AT/AC | 28525 Number of splices: Non-canonical | 54078 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 3.12 Insertion rate per base | 0.01% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 488214 % of reads mapped to multiple loci | 1.57% Number of reads mapped to too many loci | 22312 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.09% % of reads unmapped: other | 0.54% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1771922 1771922 1771922 N_multimapping 488214 488214 488214 N_noFeature 500671 28227417 691275 N_ambiguous 493169 4257 71579 UnstrandedReadsAssigned:27847783 PositiveStrandReadsAssigned:609949 NegativeStrandReadsAssigned:28078769 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804139 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804139-trimmed-pair1.fastq SRR7804139-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,101,759 reads, 28,438,790 reads pseudoaligned [quant] estimated average fragment length: 289.477 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,072 rounds 52973 SRR7804139.ke.tsv 35125 SRR7804139.se.tsv 88098 total ==> SRR7804139.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 647.929 0 0 PNS24247 1044 755.523 75.0556 4.60758 PNS24249 1928 1639.52 391.911 11.0868 PNS24246 1044 755.523 75.0556 4.60758 PNS24248 1044 755.523 75.0556 4.60758 PNS24244 1471 1182.52 59.9225 2.35027 PNS24243 293 75.7275 0 0 KQK14069 1603 1314.52 1086.77 38.345 KQK14071 474 208.716 4.81825 1.07071 ==> SRR7804139.se.tsv <== BRADI_1g14170v3 1116 BRADI_1g53295v3 621 BRADI_1g59795v3 150 BRADI_1g07683v3 0 BRADI_1g00485v3 79 BRADI_1g20270v3 4432 BRADI_1g74790v3 9 BRADI_1g09890v3 0 BRADI_1g77505v3 341 BRADI_1g48960v3 0 SRR7804139 completed mapping pipeline successfully