Starting /dee2/code/volunteer_pipeline.sh SRR7804140 current disk space = 1525473730560 free memory = 1562452128 SRR7804140 SRAfilesize 42ce4ee7ad53fe7c31c21e6d465c15bd SRR7804140.sra SRR7804140.sra file validated SRR7804140 is paired end SRR7804140 is conventional basespace SRR7804140 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804140_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2045 37.0 37.0 37.0 37.0 37.0 2 36.2595 37.0 37.0 37.0 37.0 37.0 3 36.311 37.0 37.0 37.0 37.0 37.0 4 36.408 37.0 37.0 37.0 37.0 37.0 5 36.531 37.0 37.0 37.0 37.0 37.0 6 36.4685 37.0 37.0 37.0 37.0 37.0 7 36.496 37.0 37.0 37.0 37.0 37.0 8 36.526 37.0 37.0 37.0 37.0 37.0 9 36.485 37.0 37.0 37.0 37.0 37.0 10-14 36.493399999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.4885 37.0 37.0 37.0 37.0 37.0 20-24 36.437 37.0 37.0 37.0 37.0 37.0 25-29 36.415099999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.3821 37.0 37.0 37.0 37.0 37.0 35-39 36.3763 37.0 37.0 37.0 37.0 37.0 40-44 36.3962 37.0 37.0 37.0 37.0 37.0 45-49 36.3758 37.0 37.0 37.0 37.0 37.0 50-54 36.3755 37.0 37.0 37.0 37.0 37.0 55-59 36.3169 37.0 37.0 37.0 37.0 37.0 60-64 36.327299999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.29440000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.2526 37.0 37.0 37.0 37.0 37.0 75-79 36.2838 37.0 37.0 37.0 37.0 37.0 80-84 36.221500000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.2261 37.0 37.0 37.0 37.0 37.0 90-94 36.1725 37.0 37.0 37.0 37.0 37.0 95-99 36.15069999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.183499999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.988099999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.080999999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.04880000000001 37.0 37.0 37.0 37.0 37.0 120-124 36.0381 37.0 37.0 37.0 37.0 37.0 125-129 35.964600000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.8569 37.0 37.0 37.0 37.0 37.0 135-139 35.8294 37.0 37.0 37.0 37.0 37.0 140-144 35.79299999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.749 37.0 37.0 37.0 37.0 37.0 150-151 35.272 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 4.0 25 0.0 26 4.0 27 5.0 28 12.0 29 17.0 30 39.0 31 42.0 32 64.0 33 91.0 34 143.0 35 315.0 36 2867.0 37 397.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.95 13.55 7.7 32.800000000000004 2 27.150000000000002 13.200000000000001 30.975 28.675 3 23.200000000000003 19.725 23.775 33.300000000000004 4 27.725 24.575 21.85 25.85 5 28.275 26.950000000000003 22.225 22.55 6 25.124999999999996 31.35 21.3 22.225 7 21.075 21.525 37.9 19.5 8 22.275 21.925 26.625 29.175 9 21.025 19.875 32.125 26.974999999999998 10-14 24.759999999999998 24.69 24.085 26.465 15-19 25.124999999999996 24.19 24.740000000000002 25.945 20-24 24.785 24.945 24.545 25.724999999999998 25-29 24.63 24.025 24.605 26.740000000000002 30-34 24.654999999999998 23.990000000000002 24.48 26.875 35-39 25.480000000000004 23.825 24.745 25.95 40-44 25.105 23.91 24.365000000000002 26.619999999999997 45-49 25.045 24.385 23.78 26.790000000000003 50-54 24.965 24.03 24.395 26.61 55-59 24.495 23.995 24.310000000000002 27.200000000000003 60-64 24.87 23.86 24.310000000000002 26.96 65-69 25.130000000000003 23.615 23.925 27.33 70-74 24.8 23.865 24.09 27.245 75-79 26.145000000000003 23.87 23.380000000000003 26.605 80-84 25.335 23.335 23.945 27.384999999999998 85-89 25.135 23.715 23.71 27.439999999999998 90-94 25.31 23.51 23.95 27.229999999999997 95-99 26.055 23.435 23.78 26.729999999999997 100-104 25.335 23.835 23.505000000000003 27.325 105-109 25.715 23.419999999999998 23.745 27.12 110-114 25.330000000000002 24.03 23.605 27.034999999999997 115-119 26.064999999999998 23.49 23.395 27.05 120-124 25.705 23.595 23.974999999999998 26.724999999999998 125-129 26.145000000000003 23.07 23.205000000000002 27.58 130-134 26.455000000000002 23.425 23.27 26.85 135-139 26.245 23.200000000000003 23.62 26.935 140-144 26.165 23.49 23.335 27.01 145-149 26.135 23.275000000000002 23.990000000000002 26.6 150-151 26.337500000000002 23.2375 23.3375 27.0875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.5 24 2.0 25 0.5 26 3.0 27 5.5 28 3.0 29 2.0 30 2.0 31 4.5 32 10.5 33 17.5 34 25.0 35 33.0 36 37.0 37 47.0 38 58.5 39 68.0 40 97.0 41 116.0 42 128.5 43 150.0 44 161.0 45 163.5 46 171.0 47 178.5 48 168.0 49 158.5 50 150.0 51 136.0 52 131.0 53 114.0 54 84.0 55 86.5 56 97.0 57 94.0 58 93.0 59 98.5 60 106.0 61 94.5 62 87.5 63 80.5 64 82.5 65 93.0 66 82.0 67 77.0 68 66.0 69 53.0 70 56.5 71 56.5 72 44.0 73 29.0 74 25.0 75 20.5 76 18.5 77 14.0 78 5.0 79 2.5 80 2.5 81 3.0 82 2.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.85 #Duplication Level Percentage of deduplicated Percentage of total 1 92.16113228089276 84.65 2 6.9406641262928686 12.75 3 0.7621121393576483 2.1 4 0.1360914534567229 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.32499999999999996 0.0 0.0 0.0 0.0 114-115 0.42500000000000004 0.0 0.0 0.0 0.0 116-117 0.5375000000000001 0.0 0.0 0.0 0.0 118-119 0.625 0.0 0.0 0.0 0.0 120-121 0.65 0.0 0.0 0.0 0.0 122-123 0.7375 0.0 0.0 0.0 0.0 124-125 0.8374999999999999 0.0 0.0 0.0 0.0 126-127 0.8875 0.0 0.0 0.0 0.0 128-129 0.975 0.0 0.0 0.0 0.0 130-131 1.075 0.0 0.0 0.0 0.0 132-133 1.15 0.0 0.0 0.0 0.0 134-135 1.325 0.0 0.0 0.0 0.0 136-137 1.525 0.0 0.0 0.0 0.0 138-139 1.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804140 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804140_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.11875 37.0 37.0 37.0 37.0 37.0 2 35.9185 37.0 37.0 37.0 37.0 37.0 3 35.761 37.0 37.0 37.0 37.0 37.0 4 36.149 37.0 37.0 37.0 37.0 37.0 5 35.978 37.0 37.0 37.0 37.0 37.0 6 35.9855 37.0 37.0 37.0 37.0 37.0 7 35.89 37.0 37.0 37.0 37.0 37.0 8 36.0925 37.0 37.0 37.0 37.0 37.0 9 36.032 37.0 37.0 37.0 37.0 37.0 10-14 36.0654 37.0 37.0 37.0 37.0 37.0 15-19 35.976200000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.0159 37.0 37.0 37.0 37.0 37.0 25-29 35.9527 37.0 37.0 37.0 37.0 37.0 30-34 35.9485 37.0 37.0 37.0 37.0 37.0 35-39 35.893899999999995 37.0 37.0 37.0 37.0 37.0 40-44 35.8628 37.0 37.0 37.0 37.0 37.0 45-49 35.7739 37.0 37.0 37.0 37.0 37.0 50-54 35.7684 37.0 37.0 37.0 37.0 37.0 55-59 35.7675 37.0 37.0 37.0 37.0 37.0 60-64 35.7153 37.0 37.0 37.0 37.0 37.0 65-69 35.6534 37.0 37.0 37.0 37.0 37.0 70-74 35.700399999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.6661 37.0 37.0 37.0 37.0 37.0 80-84 35.5727 37.0 37.0 37.0 37.0 37.0 85-89 35.623 37.0 37.0 37.0 37.0 37.0 90-94 35.5774 37.0 37.0 37.0 37.0 37.0 95-99 35.469899999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.5493 37.0 37.0 37.0 37.0 37.0 105-109 35.4666 37.0 37.0 37.0 37.0 37.0 110-114 35.3486 37.0 37.0 37.0 37.0 37.0 115-119 35.3191 37.0 37.0 37.0 34.6 37.0 120-124 35.3137 37.0 37.0 37.0 32.2 37.0 125-129 35.2096 37.0 37.0 37.0 29.8 37.0 130-134 35.313100000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.2023 37.0 37.0 37.0 32.2 37.0 140-144 35.2378 37.0 37.0 37.0 32.2 37.0 145-149 34.9082 37.0 37.0 37.0 25.0 37.0 150-151 34.51975 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 5.0 15 5.0 16 2.0 17 2.0 18 0.0 19 4.0 20 1.0 21 8.0 22 6.0 23 6.0 24 11.0 25 6.0 26 13.0 27 12.0 28 24.0 29 26.0 30 47.0 31 55.0 32 69.0 33 116.0 34 240.0 35 624.0 36 2505.0 37 208.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.98549637409352 18.079519879969993 10.02750687671918 29.9074768692173 2 29.95 22.525000000000002 25.3 22.225 3 25.3 24.425 25.825 24.45 4 27.925 30.125 17.95 24.0 5 28.199999999999996 31.3 17.025000000000002 23.474999999999998 6 25.2 32.550000000000004 18.75 23.5 7 25.074999999999996 19.05 31.324999999999996 24.55 8 25.650000000000002 22.225 21.725 30.4 9 25.1 21.925 25.25 27.725 10-14 27.08 24.279999999999998 21.240000000000002 27.400000000000002 15-19 27.145000000000003 23.630000000000003 22.650000000000002 26.575 20-24 26.72 24.675 22.16 26.445 25-29 27.195000000000004 23.395 22.48 26.93 30-34 27.015 23.494999999999997 22.884999999999998 26.605 35-39 27.455000000000002 24.11 22.06 26.375 40-44 26.445 24.185000000000002 22.23 27.139999999999997 45-49 27.185 24.099999999999998 22.33 26.384999999999998 50-54 27.800000000000004 23.235 22.395 26.57 55-59 26.505000000000003 23.755000000000003 21.915000000000003 27.825 60-64 27.439999999999998 22.955000000000002 22.78 26.825 65-69 27.93 23.185 22.134999999999998 26.75 70-74 27.12 23.105 22.814999999999998 26.96 75-79 26.715 22.925 23.435 26.924999999999997 80-84 27.425 22.775000000000002 23.03 26.77 85-89 26.810000000000002 23.419999999999998 22.52 27.250000000000004 90-94 26.805 23.57 22.89 26.735 95-99 27.189999999999998 23.815 22.395 26.6 100-104 27.595 23.53 21.905 26.97 105-109 27.435 23.615 22.314999999999998 26.634999999999998 110-114 27.1 24.235 22.31 26.355 115-119 27.365000000000002 24.29 21.95 26.395000000000003 120-124 28.185 23.39 21.595 26.83 125-129 27.455000000000002 24.22 22.040000000000003 26.284999999999997 130-134 27.435 23.385 22.64 26.540000000000003 135-139 27.200000000000003 23.965 22.91 25.924999999999997 140-144 28.13 24.235 21.95 25.685000000000002 145-149 27.515 24.36 22.384999999999998 25.740000000000002 150-151 27.737499999999997 24.4 22.475 25.387500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 0.5 25 1.0 26 2.0 27 2.0 28 1.5 29 2.0 30 3.5 31 5.0 32 5.0 33 5.5 34 10.5 35 19.0 36 26.5 37 37.5 38 51.0 39 61.0 40 80.0 41 99.0 42 116.0 43 138.5 44 146.5 45 158.0 46 164.5 47 142.0 48 139.5 49 147.0 50 129.5 51 115.5 52 104.0 53 97.0 54 95.0 55 93.0 56 93.0 57 99.0 58 113.0 59 121.0 60 106.0 61 103.0 62 113.0 63 102.0 64 101.0 65 99.5 66 86.0 67 78.0 68 84.5 69 81.5 70 72.0 71 74.0 72 59.5 73 46.5 74 42.5 75 33.5 76 28.0 77 19.0 78 8.0 79 5.0 80 6.0 81 3.5 82 1.5 83 1.5 84 1.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.5 94 0.5 95 0.5 96 0.5 97 0.5 98 1.0 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.87705817782657 83.7 2 6.915477497255764 12.6 3 0.960482985729967 2.625 4 0.13721185510428102 0.5 5 0.0823271130625686 0.375 6 0.0 0.0 7 0.0 0.0 8 0.027442371020856202 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 5 0.125 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit GTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.5874999999999999 0.0 0.0 0.0 0.0 118-119 0.675 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.7875 0.0 0.0 0.0 0.0 124-125 0.8875 0.0 0.0 0.0 0.0 126-127 0.9375 0.0 0.0 0.0 0.0 128-129 1.025 0.0 0.0 0.0 0.0 130-131 1.125 0.0 0.0 0.0 0.0 132-133 1.2000000000000002 0.0 0.0 0.0 0.0 134-135 1.375 0.0 0.0 0.0 0.0 136-137 1.5499999999999998 0.0 0.0 0.0 0.0 138-139 1.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACCGTG 10 0.006830828 145.0 9 TTAGCAA 10 0.006830828 145.0 145 >>END_MODULE Read 1383681 spots for SRR7804140.sra Written 1383681 spots for SRR7804140.sra Read 1383681 spots for SRR7804140.sra Written 1383681 spots for SRR7804140.sra Read 1383681 spots for SRR7804140.sra Written 1383681 spots for SRR7804140.sra Read 1383681 spots for SRR7804140.sra Written 1383681 spots for SRR7804140.sra Read 1383681 spots for SRR7804140.sra Written 1383681 spots for SRR7804140.sra Read 1383681 spots for SRR7804140.sra Written 1383681 spots for SRR7804140.sra Read 1383681 spots for SRR7804140.sra Written 1383681 spots for SRR7804140.sra Read 1383681 spots for SRR7804140.sra Written 1383681 spots for SRR7804140.sra Read 1383681 spots for SRR7804140.sra Written 1383681 spots for SRR7804140.sra Read 1383681 spots for SRR7804140.sra Written 1383681 spots for SRR7804140.sra Read 1383681 spots for SRR7804140.sra Written 1383681 spots for SRR7804140.sra Read 1383681 spots for SRR7804140.sra Written 1383681 spots for SRR7804140.sra Read 1383681 spots for SRR7804140.sra Written 1383681 spots for SRR7804140.sra Read 1383681 spots for SRR7804140.sra Written 1383681 spots for SRR7804140.sra Read 1383685 spots for SRR7804140.sra Written 1383685 spots for SRR7804140.sra Read 1383681 spots for SRR7804140.sra Written 1383681 spots for SRR7804140.sra Read 1383681 spots for SRR7804140.sra Written 1383681 spots for SRR7804140.sra Read 1383681 spots for SRR7804140.sra Written 1383681 spots for SRR7804140.sra Read 1383681 spots for SRR7804140.sra Written 1383681 spots for SRR7804140.sra Read 1383681 spots for SRR7804140.sra Written 1383681 spots for SRR7804140.sra SRR ids: ['SRR7804140.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r69k0x65 SRR7804140.sra spots: 27673624 blocks: [[1, 1383681], [1383682, 2767362], [2767363, 4151043], [4151044, 5534724], [5534725, 6918405], [6918406, 8302086], [8302087, 9685767], [9685768, 11069448], [11069449, 12453129], [12453130, 13836810], [13836811, 15220491], [15220492, 16604172], [16604173, 17987853], [17987854, 19371534], [19371535, 20755215], [20755216, 22138896], [22138897, 23522577], [23522578, 24906258], [24906259, 26289939], [26289940, 27673624]] SRR7804140 file size 9355982 SRR7804140 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804140 SRR7804140_1.fastq SRR7804140_2.fastq Input file: SRR7804140_1.fastq Paired file: SRR7804140_2.fastq trimmed: SRR7804140-trimmed-pair1.fastq, SRR7804140-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:46:04 2024 >> started Tue Dec 10 02:46:34 2024 >> done (30.284s) 27673624 read pairs processed; of these: 74 ( 0.00%) short read pairs filtered out after trimming by size control 355 ( 0.00%) empty read pairs filtered out after trimming by size control 27673195 (100.00%) read pairs available; of these: 776824 ( 2.81%) trimmed read pairs available after processing 26896371 (97.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 8 0.00% 20 15 0.00% 21 11 0.00% 22 21 0.00% 23 25 0.00% 24 15 0.00% 25 14 0.00% 26 17 0.00% 27 28 0.00% 28 26 0.00% 29 20 0.00% 30 37 0.00% 31 30 0.00% 32 24 0.00% 33 29 0.00% 34 30 0.00% 35 25 0.00% 36 31 0.00% 37 33 0.00% 38 39 0.00% 39 40 0.00% 40 48 0.00% 41 37 0.00% 42 48 0.00% 43 52 0.00% 44 36 0.00% 45 49 0.00% 46 51 0.00% 47 44 0.00% 48 41 0.00% 49 50 0.00% 50 55 0.00% 51 45 0.00% 52 58 0.00% 53 40 0.00% 54 57 0.00% 55 62 0.00% 56 59 0.00% 57 63 0.00% 58 53 0.00% 59 72 0.00% 60 64 0.00% 61 58 0.00% 62 78 0.00% 63 75 0.00% 64 82 0.00% 65 80 0.00% 66 75 0.00% 67 104 0.00% 68 100 0.00% 69 113 0.00% 70 121 0.00% 71 123 0.00% 72 148 0.00% 73 154 0.00% 74 173 0.00% 75 194 0.00% 76 230 0.00% 77 232 0.00% 78 237 0.00% 79 256 0.00% 80 282 0.00% 81 326 0.00% 82 382 0.00% 83 441 0.00% 84 497 0.00% 85 542 0.00% 86 626 0.00% 87 672 0.00% 88 672 0.00% 89 799 0.00% 90 885 0.00% 91 1074 0.00% 92 1167 0.00% 93 1233 0.00% 94 1476 0.01% 95 1631 0.01% 96 1626 0.01% 97 1845 0.01% 98 1939 0.01% 99 2112 0.01% 100 2313 0.01% 101 2551 0.01% 102 2860 0.01% 103 3165 0.01% 104 3456 0.01% 105 3629 0.01% 106 3920 0.01% 107 4111 0.01% 108 4479 0.02% 109 4813 0.02% 110 5026 0.02% 111 5321 0.02% 112 5906 0.02% 113 6419 0.02% 114 7111 0.03% 115 7447 0.03% 116 7764 0.03% 117 8320 0.03% 118 8435 0.03% 119 8710 0.03% 120 9369 0.03% 121 9710 0.04% 122 10424 0.04% 123 11191 0.04% 124 12023 0.04% 125 12752 0.05% 126 13567 0.05% 127 13744 0.05% 128 14250 0.05% 129 15153 0.05% 130 15762 0.06% 131 16266 0.06% 132 17225 0.06% 133 18281 0.07% 134 19449 0.07% 135 20373 0.07% 136 21264 0.08% 137 21796 0.08% 138 22505 0.08% 139 23399 0.08% 140 23965 0.09% 141 24904 0.09% 142 25921 0.09% 143 27284 0.10% 144 29109 0.11% 145 30817 0.11% 146 31294 0.11% 147 32345 0.12% 148 33142 0.12% 149 34181 0.12% 150 35133 0.13% 151 26896371 97.19% 27673195 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=21 prefix-density=0.83 prefix-fanout=2.9 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTACGAGAGGGTCTCGAACTTCTTGATGCCCTCGAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=34 fanout-score=97.36 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=6.7 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=3.58 fanout-score-rank=16 prefix-density=1.01 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGACGGCAGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=49.21 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.9 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804140 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:47:45 Started mapping on | Dec 10 02:47:45 Finished on | Dec 10 02:51:50 Mapping speed, Million of reads per hour | 406.63 Number of input reads | 27673195 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 25426331 Uniquely mapped reads % | 91.88% Average mapped length | 299.72 Number of splices: Total | 26200827 Number of splices: Annotated (sjdb) | 24784270 Number of splices: GT/AG | 25810079 Number of splices: GC/AG | 321171 Number of splices: AT/AC | 9383 Number of splices: Non-canonical | 60194 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 390165 % of reads mapped to multiple loci | 1.41% Number of reads mapped to too many loci | 25397 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.88% % of reads unmapped: other | 0.74% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1856699 1856699 1856699 N_multimapping 390165 390165 390165 N_noFeature 755697 24717274 919973 N_ambiguous 687627 4556 143416 UnstrandedReadsAssigned:23983007 PositiveStrandReadsAssigned:704501 NegativeStrandReadsAssigned:24362942 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804140 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804140-trimmed-pair1.fastq SRR7804140-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,673,195 reads, 24,643,657 reads pseudoaligned [quant] estimated average fragment length: 303.329 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52973 SRR7804140.ke.tsv 35125 SRR7804140.se.tsv 88098 total ==> SRR7804140.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 634.334 0 0 PNS24247 1044 741.671 54.2845 3.67577 PNS24249 1928 1625.67 211.766 6.54195 PNS24246 1044 741.671 54.2845 3.67577 PNS24248 1044 741.671 54.2845 3.67577 PNS24244 1471 1168.67 64.3803 2.76658 PNS24243 293 73.8472 0 0 KQK14069 1603 1300.67 19056.9 735.816 KQK14071 474 201.296 272.273 67.9285 ==> SRR7804140.se.tsv <== BRADI_1g14170v3 20163 BRADI_1g53295v3 799 BRADI_1g59795v3 372 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 890 BRADI_1g74790v3 816 BRADI_1g09890v3 4 BRADI_1g77505v3 290 BRADI_1g48960v3 0 SRR7804140 completed mapping pipeline successfully