Starting /dee2/code/volunteer_pipeline.sh SRR7804141 current disk space = 1525191622656 free memory = 1555393832 SRR7804141 SRAfilesize 3d86f63d8e76e458f4ee0e1e8ecf34b9 SRR7804141.sra SRR7804141.sra file validated SRR7804141 is paired end SRR7804141 is conventional basespace SRR7804141 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804141_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.196 37.0 37.0 37.0 37.0 37.0 2 36.10825 37.0 37.0 37.0 37.0 37.0 3 36.364 37.0 37.0 37.0 37.0 37.0 4 36.4785 37.0 37.0 37.0 37.0 37.0 5 36.5725 37.0 37.0 37.0 37.0 37.0 6 36.3875 37.0 37.0 37.0 37.0 37.0 7 36.4745 37.0 37.0 37.0 37.0 37.0 8 36.49 37.0 37.0 37.0 37.0 37.0 9 36.545 37.0 37.0 37.0 37.0 37.0 10-14 36.481 37.0 37.0 37.0 37.0 37.0 15-19 36.4833 37.0 37.0 37.0 37.0 37.0 20-24 36.50169999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.4376 37.0 37.0 37.0 37.0 37.0 30-34 36.398700000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.366600000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.3928 37.0 37.0 37.0 37.0 37.0 45-49 36.3893 37.0 37.0 37.0 37.0 37.0 50-54 36.3195 37.0 37.0 37.0 37.0 37.0 55-59 36.34349999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.3272 37.0 37.0 37.0 37.0 37.0 65-69 36.3113 37.0 37.0 37.0 37.0 37.0 70-74 36.2361 37.0 37.0 37.0 37.0 37.0 75-79 36.26540000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.2291 37.0 37.0 37.0 37.0 37.0 85-89 36.1859 37.0 37.0 37.0 37.0 37.0 90-94 36.168400000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.1139 37.0 37.0 37.0 37.0 37.0 100-104 36.123900000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.0572 37.0 37.0 37.0 37.0 37.0 110-114 36.028999999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.067099999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.987899999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.8851 37.0 37.0 37.0 37.0 37.0 130-134 35.8324 37.0 37.0 37.0 37.0 37.0 135-139 35.7923 37.0 37.0 37.0 37.0 37.0 140-144 35.7363 37.0 37.0 37.0 37.0 37.0 145-149 35.7609 37.0 37.0 37.0 37.0 37.0 150-151 35.208 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 3.0 24 2.0 25 2.0 26 5.0 27 6.0 28 14.0 29 23.0 30 32.0 31 49.0 32 59.0 33 67.0 34 128.0 35 334.0 36 2920.0 37 353.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.6 13.3 7.75 33.35 2 24.98122653316646 15.319148936170212 32.64080100125156 27.058823529411764 3 21.349999999999998 20.525 25.324999999999996 32.800000000000004 4 25.2 26.174999999999997 22.400000000000002 26.224999999999998 5 26.700000000000003 27.925 21.875 23.5 6 24.099999999999998 31.85 22.3 21.75 7 18.375 24.0 37.075 20.549999999999997 8 21.175 22.725 28.999999999999996 27.1 9 20.325 20.925 32.05 26.700000000000003 10-14 23.22 25.595000000000002 25.31 25.874999999999996 15-19 23.45 24.92 25.585 26.045 20-24 23.064999999999998 25.5 25.52 25.915 25-29 23.595 25.314999999999998 25.52 25.569999999999997 30-34 23.27 25.924999999999997 24.925 25.88 35-39 23.825 24.82 25.005 26.35 40-44 23.59 24.58 25.75 26.08 45-49 23.84 25.465 24.945 25.75 50-54 23.7 24.73 25.245 26.325 55-59 23.925 24.985 25.055 26.035000000000004 60-64 23.43 25.61 24.97 25.990000000000002 65-69 23.79 24.715 25.330000000000002 26.165 70-74 23.91 24.77 25.165 26.155 75-79 23.82 24.83 25.27 26.08 80-84 24.095 24.45 25.16 26.295 85-89 23.72 25.28 24.505 26.495 90-94 24.345 24.279999999999998 24.915000000000003 26.46 95-99 24.285 25.080000000000002 24.745 25.89 100-104 24.77 24.785 24.610000000000003 25.835 105-109 23.955000000000002 24.91 24.72 26.415 110-114 23.95 24.715 25.185000000000002 26.150000000000002 115-119 24.375 24.185000000000002 25.080000000000002 26.36 120-124 24.485 24.785 24.395 26.334999999999997 125-129 24.94 24.255 24.64 26.165 130-134 24.385 24.305 24.755 26.555 135-139 24.55 23.53 25.39 26.529999999999998 140-144 24.915000000000003 24.205 24.785 26.095000000000002 145-149 24.745 24.215 24.88 26.16 150-151 24.1625 23.962500000000002 24.725 27.150000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.0 28 3.5 29 4.5 30 4.5 31 7.0 32 10.0 33 14.5 34 23.5 35 33.5 36 46.5 37 65.5 38 78.0 39 104.0 40 128.5 41 134.5 42 156.5 43 184.0 44 198.0 45 190.0 46 197.5 47 187.5 48 166.5 49 184.5 50 160.5 51 145.0 52 147.0 53 119.5 54 112.5 55 100.5 56 91.5 57 90.5 58 79.5 59 77.0 60 78.0 61 67.0 62 58.0 63 56.0 64 54.5 65 63.5 66 63.0 67 54.5 68 50.5 69 40.0 70 26.0 71 22.5 72 24.0 73 23.5 74 20.0 75 12.0 76 8.0 77 7.5 78 8.0 79 5.0 80 3.0 81 3.0 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.025 #Duplication Level Percentage of deduplicated Percentage of total 1 94.17708056367987 88.55 2 5.317734645041212 10.0 3 0.47859611805370916 1.35 4 0.026588673225206066 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.1625 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.3125 0.0 0.0 0.0 0.0 118-119 0.36250000000000004 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.4375 0.0 0.0 0.0 0.0 124-125 0.4875 0.0 0.0 0.0 0.0 126-127 0.625 0.0 0.0 0.0 0.0 128-129 0.675 0.0 0.0 0.0 0.0 130-131 0.75 0.0 0.0 0.0 0.0 132-133 0.775 0.0 0.0 0.0 0.0 134-135 0.8625 0.0 0.0 0.0 0.0 136-137 1.025 0.0 0.0 0.0 0.0 138-139 1.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAAA 10 0.006830828 145.0 2 ATAGCCT 10 0.006830828 145.0 7 AGACTTC 10 0.006830828 145.0 145 GATAGCC 10 0.006830828 145.0 6 >>END_MODULE SRR7804141 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804141_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4295 37.0 37.0 37.0 37.0 37.0 2 36.2855 37.0 37.0 37.0 37.0 37.0 3 36.1355 37.0 37.0 37.0 37.0 37.0 4 36.326 37.0 37.0 37.0 37.0 37.0 5 36.2705 37.0 37.0 37.0 37.0 37.0 6 36.305 37.0 37.0 37.0 37.0 37.0 7 36.1855 37.0 37.0 37.0 37.0 37.0 8 36.338 37.0 37.0 37.0 37.0 37.0 9 36.2925 37.0 37.0 37.0 37.0 37.0 10-14 36.3462 37.0 37.0 37.0 37.0 37.0 15-19 36.221000000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.276599999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.2461 37.0 37.0 37.0 37.0 37.0 30-34 36.181200000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.147400000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.070299999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.075700000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.0871 37.0 37.0 37.0 37.0 37.0 55-59 36.0361 37.0 37.0 37.0 37.0 37.0 60-64 36.024300000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.009800000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.9772 37.0 37.0 37.0 37.0 37.0 75-79 35.9437 37.0 37.0 37.0 37.0 37.0 80-84 35.8878 37.0 37.0 37.0 37.0 37.0 85-89 35.9143 37.0 37.0 37.0 37.0 37.0 90-94 35.9172 37.0 37.0 37.0 37.0 37.0 95-99 35.8679 37.0 37.0 37.0 37.0 37.0 100-104 35.757000000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.8523 37.0 37.0 37.0 37.0 37.0 110-114 35.6309 37.0 37.0 37.0 37.0 37.0 115-119 35.713499999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.7006 37.0 37.0 37.0 37.0 37.0 125-129 35.5539 37.0 37.0 37.0 37.0 37.0 130-134 35.66330000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.5075 37.0 37.0 37.0 37.0 37.0 140-144 35.5077 37.0 37.0 37.0 37.0 37.0 145-149 35.2916 37.0 37.0 37.0 34.6 37.0 150-151 34.97775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 5.0 15 4.0 16 4.0 17 0.0 18 2.0 19 1.0 20 0.0 21 2.0 22 6.0 23 8.0 24 6.0 25 8.0 26 11.0 27 5.0 28 12.0 29 17.0 30 29.0 31 47.0 32 51.0 33 81.0 34 163.0 35 504.0 36 2739.0 37 292.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.15 19.975 9.25 28.625 2 30.125 23.175 26.125 20.575 3 23.9 26.025 27.075 23.0 4 26.974999999999998 30.599999999999998 18.625 23.799999999999997 5 29.275000000000002 31.175000000000004 18.025 21.525 6 24.575 34.725 18.825 21.875 7 22.625 20.424999999999997 33.4 23.549999999999997 8 25.05 23.275000000000002 23.025000000000002 28.65 9 24.2 22.425 26.450000000000003 26.924999999999997 10-14 26.44 24.959999999999997 22.605 25.995 15-19 26.345000000000002 25.224999999999998 22.86 25.569999999999997 20-24 26.63 25.095 23.205000000000002 25.069999999999997 25-29 26.645000000000003 24.77 23.150000000000002 25.435000000000002 30-34 26.135 25.124999999999996 23.015 25.724999999999998 35-39 26.515 25.35 23.119999999999997 25.014999999999997 40-44 26.465 24.325 23.35 25.86 45-49 26.6 24.975 23.200000000000003 25.224999999999998 50-54 26.029999999999998 25.255 22.805 25.91 55-59 26.82 24.595 23.28 25.305 60-64 26.095000000000002 24.8 23.544999999999998 25.56 65-69 26.07 24.81 23.32 25.8 70-74 26.325 25.259999999999998 23.06 25.355 75-79 26.650000000000002 24.705 23.25 25.395 80-84 26.450000000000003 24.77 23.36 25.419999999999998 85-89 26.174999999999997 25.69 23.505000000000003 24.63 90-94 26.450000000000003 25.0 23.28 25.27 95-99 26.46 25.124999999999996 23.51 24.905 100-104 26.995 24.560000000000002 23.125 25.319999999999997 105-109 27.150000000000002 25.25 22.634999999999998 24.965 110-114 26.51 25.15 23.765 24.575 115-119 26.590000000000003 25.46 23.445 24.505 120-124 26.57 25.495 23.365 24.57 125-129 26.3 24.834999999999997 24.19 24.675 130-134 26.534999999999997 25.34 23.669999999999998 24.455 135-139 26.615 24.82 24.075 24.490000000000002 140-144 26.939999999999998 25.474999999999998 23.5 24.085 145-149 27.150000000000002 25.34 23.24 24.27 150-151 26.950000000000003 25.4 23.7 23.95 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 1.0 12 1.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 1.5 27 3.0 28 3.0 29 3.5 30 5.0 31 6.5 32 10.0 33 13.5 34 15.5 35 21.5 36 32.0 37 50.0 38 65.0 39 76.5 40 97.0 41 120.0 42 145.0 43 169.0 44 170.5 45 167.0 46 175.5 47 174.5 48 157.5 49 157.5 50 145.5 51 123.0 52 139.0 53 135.5 54 118.5 55 106.0 56 91.5 57 82.5 58 85.5 59 86.5 60 89.5 61 88.5 62 77.0 63 83.0 64 87.0 65 78.0 66 66.5 67 59.5 68 61.5 69 54.0 70 50.0 71 53.5 72 42.5 73 35.0 74 27.5 75 19.0 76 16.0 77 16.0 78 12.5 79 6.0 80 2.0 81 1.5 82 1.0 83 0.5 84 1.0 85 0.5 86 0.5 87 1.5 88 1.5 89 0.5 90 0.0 91 1.0 92 1.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.0 #Duplication Level Percentage of deduplicated Percentage of total 1 94.09574468085107 88.44999999999999 2 5.452127659574469 10.25 3 0.425531914893617 1.2 4 0.026595744680851064 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.38749999999999996 0.0 0.0 0.0 0.0 120-121 0.45 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.5125 0.0 0.0 0.0 0.0 126-127 0.65 0.0 0.0 0.0 0.0 128-129 0.7 0.0 0.0 0.0 0.0 130-131 0.775 0.0 0.0 0.0 0.0 132-133 0.8 0.0 0.0 0.0 0.0 134-135 0.8875 0.0 0.0 0.0 0.0 136-137 1.0499999999999998 0.0 0.0 0.0 0.0 138-139 1.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 35 0.0035366106 20.714287 70-74 >>END_MODULE Read 1402078 spots for SRR7804141.sra Written 1402078 spots for SRR7804141.sra Read 1402078 spots for SRR7804141.sra Written 1402078 spots for SRR7804141.sra Read 1402078 spots for SRR7804141.sra Written 1402078 spots for SRR7804141.sra Read 1402078 spots for SRR7804141.sra Written 1402078 spots for SRR7804141.sra Read 1402078 spots for SRR7804141.sra Written 1402078 spots for SRR7804141.sra Read 1402078 spots for SRR7804141.sra Written 1402078 spots for SRR7804141.sra Read 1402078 spots for SRR7804141.sra Written 1402078 spots for SRR7804141.sra Read 1402078 spots for SRR7804141.sra Written 1402078 spots for SRR7804141.sra Read 1402078 spots for SRR7804141.sra Written 1402078 spots for SRR7804141.sra Read 1402078 spots for SRR7804141.sra Written 1402078 spots for SRR7804141.sra Read 1402078 spots for SRR7804141.sra Written 1402078 spots for SRR7804141.sra Read 1402078 spots for SRR7804141.sra Written 1402078 spots for SRR7804141.sra Read 1402078 spots for SRR7804141.sra Written 1402078 spots for SRR7804141.sra Read 1402078 spots for SRR7804141.sra Written 1402078 spots for SRR7804141.sra Read 1402078 spots for SRR7804141.sra Written 1402078 spots for SRR7804141.sra Read 1402078 spots for SRR7804141.sra Written 1402078 spots for SRR7804141.sra Read 1402078 spots for SRR7804141.sra Written 1402078 spots for SRR7804141.sra Read 1402078 spots for SRR7804141.sra Written 1402078 spots for SRR7804141.sra Read 1402092 spots for SRR7804141.sra Written 1402092 spots for SRR7804141.sra Read 1402078 spots for SRR7804141.sra Written 1402078 spots for SRR7804141.sra SRR ids: ['SRR7804141.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__qe7yy69 SRR7804141.sra spots: 28041574 blocks: [[1, 1402078], [1402079, 2804156], [2804157, 4206234], [4206235, 5608312], [5608313, 7010390], [7010391, 8412468], [8412469, 9814546], [9814547, 11216624], [11216625, 12618702], [12618703, 14020780], [14020781, 15422858], [15422859, 16824936], [16824937, 18227014], [18227015, 19629092], [19629093, 21031170], [21031171, 22433248], [22433249, 23835326], [23835327, 25237404], [25237405, 26639482], [26639483, 28041574]] SRR7804141 file size 9480668 SRR7804141 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804141 SRR7804141_1.fastq SRR7804141_2.fastq Input file: SRR7804141_1.fastq Paired file: SRR7804141_2.fastq trimmed: SRR7804141-trimmed-pair1.fastq, SRR7804141-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:41:23 2024 >> started Tue Dec 10 02:41:55 2024 >> done (32.340s) 28041574 read pairs processed; of these: 84 ( 0.00%) short read pairs filtered out after trimming by size control 451 ( 0.00%) empty read pairs filtered out after trimming by size control 28041039 (100.00%) read pairs available; of these: 639189 ( 2.28%) trimmed read pairs available after processing 27401850 (97.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 12 0.00% 20 10 0.00% 21 16 0.00% 22 22 0.00% 23 13 0.00% 24 14 0.00% 25 19 0.00% 26 19 0.00% 27 21 0.00% 28 14 0.00% 29 11 0.00% 30 26 0.00% 31 20 0.00% 32 32 0.00% 33 18 0.00% 34 28 0.00% 35 38 0.00% 36 22 0.00% 37 25 0.00% 38 37 0.00% 39 33 0.00% 40 39 0.00% 41 35 0.00% 42 38 0.00% 43 30 0.00% 44 46 0.00% 45 40 0.00% 46 53 0.00% 47 42 0.00% 48 40 0.00% 49 54 0.00% 50 47 0.00% 51 36 0.00% 52 52 0.00% 53 35 0.00% 54 50 0.00% 55 54 0.00% 56 44 0.00% 57 63 0.00% 58 60 0.00% 59 56 0.00% 60 76 0.00% 61 70 0.00% 62 80 0.00% 63 74 0.00% 64 66 0.00% 65 73 0.00% 66 90 0.00% 67 96 0.00% 68 81 0.00% 69 100 0.00% 70 93 0.00% 71 115 0.00% 72 126 0.00% 73 158 0.00% 74 182 0.00% 75 182 0.00% 76 207 0.00% 77 190 0.00% 78 236 0.00% 79 243 0.00% 80 241 0.00% 81 298 0.00% 82 367 0.00% 83 414 0.00% 84 432 0.00% 85 483 0.00% 86 529 0.00% 87 596 0.00% 88 609 0.00% 89 695 0.00% 90 757 0.00% 91 884 0.00% 92 965 0.00% 93 1048 0.00% 94 1246 0.00% 95 1365 0.00% 96 1451 0.01% 97 1525 0.01% 98 1635 0.01% 99 1827 0.01% 100 1980 0.01% 101 2070 0.01% 102 2276 0.01% 103 2505 0.01% 104 2863 0.01% 105 3027 0.01% 106 3157 0.01% 107 3465 0.01% 108 3636 0.01% 109 3907 0.01% 110 4129 0.01% 111 4341 0.02% 112 4795 0.02% 113 5253 0.02% 114 5572 0.02% 115 6158 0.02% 116 6328 0.02% 117 6507 0.02% 118 6890 0.02% 119 7094 0.03% 120 7551 0.03% 121 7827 0.03% 122 8438 0.03% 123 9200 0.03% 124 9842 0.04% 125 10487 0.04% 126 10796 0.04% 127 11119 0.04% 128 11807 0.04% 129 12105 0.04% 130 12750 0.05% 131 13169 0.05% 132 13777 0.05% 133 15017 0.05% 134 15873 0.06% 135 16811 0.06% 136 17657 0.06% 137 17882 0.06% 138 18728 0.07% 139 19498 0.07% 140 19578 0.07% 141 20459 0.07% 142 21478 0.08% 143 22507 0.08% 144 23997 0.09% 145 24964 0.09% 146 26121 0.09% 147 27120 0.10% 148 27750 0.10% 149 28465 0.10% 150 29187 0.10% 151 27401850 97.72% 28041039 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=23 prefix-density=0.51 prefix-fanout=2.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=31.32 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.4 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=26 prefix-density=0.32 prefix-fanout=2.4 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=115.62 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=9.9 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR7804141 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:42:51 Started mapping on | Dec 10 02:42:52 Finished on | Dec 10 02:47:23 Mapping speed, Million of reads per hour | 372.50 Number of input reads | 28041039 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 25885552 Uniquely mapped reads % | 92.31% Average mapped length | 299.96 Number of splices: Total | 27448319 Number of splices: Annotated (sjdb) | 25810401 Number of splices: GT/AG | 27037115 Number of splices: GC/AG | 331019 Number of splices: AT/AC | 15896 Number of splices: Non-canonical | 64289 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 381635 % of reads mapped to multiple loci | 1.36% Number of reads mapped to too many loci | 28121 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.50% % of reads unmapped: other | 0.73% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1773852 1773852 1773852 N_multimapping 381635 381635 381635 N_noFeature 865510 25140534 1065784 N_ambiguous 667427 5141 122638 UnstrandedReadsAssigned:24352615 PositiveStrandReadsAssigned:739877 NegativeStrandReadsAssigned:24697130 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804141 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804141-trimmed-pair1.fastq SRR7804141-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,041,039 reads, 24,921,068 reads pseudoaligned [quant] estimated average fragment length: 309.813 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52973 SRR7804141.ke.tsv 35125 SRR7804141.se.tsv 88098 total ==> SRR7804141.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 627.85 0 0 PNS24247 1044 735.187 130.863 9.58808 PNS24249 1928 1619.19 184.579 6.14041 PNS24246 1044 735.187 130.863 9.58808 PNS24248 1044 735.187 130.863 9.58808 PNS24244 1471 1162.19 229.833 10.6524 PNS24243 293 70.7946 0 0 KQK14069 1603 1294.19 1385.06 57.6479 KQK14071 474 196.859 19.8208 5.42349 ==> SRR7804141.se.tsv <== BRADI_1g14170v3 1462 BRADI_1g53295v3 1863 BRADI_1g59795v3 646 BRADI_1g07683v3 0 BRADI_1g00485v3 36 BRADI_1g20270v3 2510 BRADI_1g74790v3 965 BRADI_1g09890v3 6 BRADI_1g77505v3 537 BRADI_1g48960v3 0 SRR7804141 completed mapping pipeline successfully