Starting /dee2/code/volunteer_pipeline.sh SRR7804142 current disk space = 1541357158400 free memory = 1418181648 SRR7804142 SRAfilesize ef27a0e44cb7f549c6c91fe2fb7806d2 SRR7804142.sra SRR7804142.sra file validated SRR7804142 is paired end SRR7804142 is conventional basespace SRR7804142 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804142_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.298 37.0 37.0 37.0 37.0 37.0 2 36.3205 37.0 37.0 37.0 37.0 37.0 3 36.352 37.0 37.0 37.0 37.0 37.0 4 36.3965 37.0 37.0 37.0 37.0 37.0 5 36.5805 37.0 37.0 37.0 37.0 37.0 6 36.5045 37.0 37.0 37.0 37.0 37.0 7 36.492 37.0 37.0 37.0 37.0 37.0 8 36.4775 37.0 37.0 37.0 37.0 37.0 9 36.508 37.0 37.0 37.0 37.0 37.0 10-14 36.56 37.0 37.0 37.0 37.0 37.0 15-19 36.5259 37.0 37.0 37.0 37.0 37.0 20-24 36.4868 37.0 37.0 37.0 37.0 37.0 25-29 36.4679 37.0 37.0 37.0 37.0 37.0 30-34 36.4316 37.0 37.0 37.0 37.0 37.0 35-39 36.4231 37.0 37.0 37.0 37.0 37.0 40-44 36.3942 37.0 37.0 37.0 37.0 37.0 45-49 36.3706 37.0 37.0 37.0 37.0 37.0 50-54 36.3095 37.0 37.0 37.0 37.0 37.0 55-59 36.35 37.0 37.0 37.0 37.0 37.0 60-64 36.2859 37.0 37.0 37.0 37.0 37.0 65-69 36.25019999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.2025 37.0 37.0 37.0 37.0 37.0 75-79 36.232099999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.1933 37.0 37.0 37.0 37.0 37.0 85-89 36.206100000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.130700000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.1323 37.0 37.0 37.0 37.0 37.0 100-104 36.156 37.0 37.0 37.0 37.0 37.0 105-109 36.016099999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.038799999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.051100000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.9571 37.0 37.0 37.0 37.0 37.0 125-129 35.9257 37.0 37.0 37.0 37.0 37.0 130-134 35.8782 37.0 37.0 37.0 37.0 37.0 135-139 35.858000000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.7731 37.0 37.0 37.0 37.0 37.0 145-149 35.8069 37.0 37.0 37.0 37.0 37.0 150-151 35.306250000000006 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 0.0 24 3.0 25 3.0 26 6.0 27 12.0 28 14.0 29 22.0 30 30.0 31 48.0 32 52.0 33 82.0 34 138.0 35 286.0 36 2873.0 37 429.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.3 13.55 10.8 32.35 2 28.064032016008007 13.75687843921961 29.264632316158078 28.91445722861431 3 22.5 19.0 25.674999999999997 32.824999999999996 4 26.025 24.175 22.650000000000002 27.150000000000002 5 25.924999999999997 27.325 23.375 23.375 6 25.324999999999996 30.325000000000003 22.1 22.25 7 19.5 23.225 37.7 19.575 8 20.599999999999998 24.625 26.950000000000003 27.825 9 21.2 21.775 30.875000000000004 26.150000000000002 10-14 24.125 25.224999999999998 24.85 25.8 15-19 23.775 24.825 25.025 26.375 20-24 23.535 25.855 24.66 25.95 25-29 24.044999999999998 25.3 24.32 26.334999999999997 30-34 23.36 25.385 24.490000000000002 26.765 35-39 23.974999999999998 24.834999999999997 25.025 26.165 40-44 23.985 24.495 24.585 26.935 45-49 24.325 25.1 24.04 26.534999999999997 50-54 24.39 24.36 24.82 26.43 55-59 24.505 25.165 23.805 26.525 60-64 24.035 24.709999999999997 24.490000000000002 26.765 65-69 23.97 25.085 24.154999999999998 26.790000000000003 70-74 24.12 24.89 24.275 26.715 75-79 24.2 24.935 24.404999999999998 26.46 80-84 23.97 24.355 24.4 27.275 85-89 24.83 24.745 23.84 26.584999999999997 90-94 24.525 24.22 24.665 26.590000000000003 95-99 24.709999999999997 24.015 24.51 26.765 100-104 25.124999999999996 24.825 23.705000000000002 26.345000000000002 105-109 24.740000000000002 24.654999999999998 24.21 26.395000000000003 110-114 24.725 24.7 24.15 26.424999999999997 115-119 24.44 25.069999999999997 24.125 26.365 120-124 24.785 24.265 24.224999999999998 26.724999999999998 125-129 25.345000000000002 23.68 24.165 26.810000000000002 130-134 24.855 24.47 24.445 26.229999999999997 135-139 25.165 24.23 24.085 26.52 140-144 24.95 24.29 24.055 26.705000000000002 145-149 25.224999999999998 24.08 23.775 26.919999999999998 150-151 25.9875 23.7625 23.9 26.35 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.5 25 2.0 26 1.0 27 2.0 28 3.0 29 5.5 30 9.0 31 13.5 32 19.5 33 22.0 34 35.0 35 43.5 36 43.0 37 64.0 38 83.5 39 88.0 40 110.5 41 141.5 42 150.0 43 159.0 44 162.0 45 151.5 46 158.5 47 163.5 48 162.0 49 169.5 50 166.5 51 137.5 52 112.5 53 111.0 54 109.5 55 107.0 56 108.0 57 104.5 58 95.0 59 88.0 60 79.5 61 68.0 62 66.0 63 65.0 64 61.5 65 68.5 66 69.5 67 59.5 68 56.0 69 52.0 70 46.5 71 40.0 72 34.0 73 27.0 74 19.0 75 16.5 76 16.0 77 15.0 78 10.5 79 8.5 80 7.5 81 4.5 82 2.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.925 #Duplication Level Percentage of deduplicated Percentage of total 1 92.9513048157116 86.375 2 6.5106268496099 12.1 3 0.511164917944579 1.425 4 0.026903416733925208 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.325 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.38749999999999996 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.6 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.7875000000000001 0.0 0.0 0.0 0.0 122-123 0.85 0.0 0.0 0.0 0.0 124-125 0.9375 0.0 0.0 0.0 0.0 126-127 1.175 0.0 0.0 0.0 0.0 128-129 1.325 0.0 0.0 0.0 0.0 130-131 1.475 0.0 0.0 0.0 0.0 132-133 1.5750000000000002 0.0 0.0 0.0 0.0 134-135 1.8375 0.0 0.0 0.0 0.0 136-137 2.0250000000000004 0.0 0.0 0.0 0.0 138-139 2.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804142 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804142_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3365 37.0 37.0 37.0 37.0 37.0 2 36.1165 37.0 37.0 37.0 37.0 37.0 3 36.0365 37.0 37.0 37.0 37.0 37.0 4 36.278 37.0 37.0 37.0 37.0 37.0 5 36.122 37.0 37.0 37.0 37.0 37.0 6 36.2035 37.0 37.0 37.0 37.0 37.0 7 36.1245 37.0 37.0 37.0 37.0 37.0 8 36.293 37.0 37.0 37.0 37.0 37.0 9 36.1205 37.0 37.0 37.0 37.0 37.0 10-14 36.1489 37.0 37.0 37.0 37.0 37.0 15-19 36.0851 37.0 37.0 37.0 37.0 37.0 20-24 36.0795 37.0 37.0 37.0 37.0 37.0 25-29 36.0191 37.0 37.0 37.0 37.0 37.0 30-34 35.97539999999999 37.0 37.0 37.0 37.0 37.0 35-39 35.9611 37.0 37.0 37.0 37.0 37.0 40-44 35.887 37.0 37.0 37.0 37.0 37.0 45-49 35.8277 37.0 37.0 37.0 37.0 37.0 50-54 35.8067 37.0 37.0 37.0 37.0 37.0 55-59 35.736599999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.7614 37.0 37.0 37.0 37.0 37.0 65-69 35.757999999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.7139 37.0 37.0 37.0 37.0 37.0 75-79 35.71169999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.6351 37.0 37.0 37.0 37.0 37.0 85-89 35.6922 37.0 37.0 37.0 37.0 37.0 90-94 35.6974 37.0 37.0 37.0 37.0 37.0 95-99 35.5894 37.0 37.0 37.0 37.0 37.0 100-104 35.6106 37.0 37.0 37.0 37.0 37.0 105-109 35.5909 37.0 37.0 37.0 37.0 37.0 110-114 35.454899999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.419799999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.38889999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.2727 37.0 37.0 37.0 32.2 37.0 130-134 35.4231 37.0 37.0 37.0 37.0 37.0 135-139 35.253099999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.223600000000005 37.0 37.0 37.0 29.8 37.0 145-149 35.040800000000004 37.0 37.0 37.0 25.0 37.0 150-151 34.510999999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 10.0 14 7.0 15 12.0 16 3.0 17 2.0 18 8.0 19 2.0 20 5.0 21 9.0 22 8.0 23 6.0 24 8.0 25 11.0 26 16.0 27 14.0 28 10.0 29 14.0 30 23.0 31 34.0 32 55.0 33 71.0 34 194.0 35 544.0 36 2697.0 37 236.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.925 20.175 11.774999999999999 29.125 2 32.5 22.1 24.6 20.8 3 26.8 24.25 26.275 22.675 4 27.525 30.3 19.400000000000002 22.775000000000002 5 29.075 31.374999999999996 18.575 20.974999999999998 6 26.950000000000003 33.300000000000004 17.424999999999997 22.325 7 26.150000000000002 18.575 31.35 23.925 8 27.275 22.025 20.424999999999997 30.275000000000002 9 26.224999999999998 23.1 23.925 26.75 10-14 27.084999999999997 24.959999999999997 21.5 26.455000000000002 15-19 27.55 24.29 22.415 25.745 20-24 27.474999999999998 24.995 22.38 25.15 25-29 27.245 24.84 22.515 25.4 30-34 27.295 25.130000000000003 22.12 25.455 35-39 27.125 24.59 22.75 25.535000000000004 40-44 26.855 25.040000000000003 22.7 25.405 45-49 27.055 24.58 22.545 25.82 50-54 27.42 24.67 22.605 25.305 55-59 26.834999999999997 24.445 23.34 25.380000000000003 60-64 27.400000000000002 23.965 22.775000000000002 25.86 65-69 27.800000000000004 23.830000000000002 23.165 25.205 70-74 27.3 24.86 22.8 25.040000000000003 75-79 26.775 24.36 23.255 25.61 80-84 27.24 24.32 23.35 25.09 85-89 27.37 24.415 22.79 25.424999999999997 90-94 26.939999999999998 24.68 22.765 25.615 95-99 27.500000000000004 24.215 23.13 25.155 100-104 27.37 23.849999999999998 23.669999999999998 25.11 105-109 26.779999999999998 24.325 23.544999999999998 25.35 110-114 26.974999999999998 24.91 23.085 25.03 115-119 27.13 24.985 22.884999999999998 25.0 120-124 27.355 24.87 23.53 24.245 125-129 27.435 24.654999999999998 22.96 24.95 130-134 27.075 24.685000000000002 23.27 24.97 135-139 26.950000000000003 25.365 23.395 24.29 140-144 27.284999999999997 25.405 23.155 24.154999999999998 145-149 28.32 25.005 22.82 23.855 150-151 26.8 25.7625 23.825 23.6125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 1.0 11 0.5 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 2.5 27 4.0 28 2.0 29 2.0 30 3.5 31 6.5 32 11.5 33 12.5 34 19.5 35 27.5 36 32.5 37 46.0 38 53.0 39 63.0 40 85.5 41 105.0 42 122.0 43 135.0 44 150.0 45 162.5 46 178.0 47 167.5 48 149.5 49 137.5 50 127.0 51 136.0 52 139.5 53 138.5 54 114.5 55 103.0 56 105.0 57 99.5 58 100.5 59 103.5 60 90.0 61 80.5 62 98.0 63 92.5 64 84.5 65 86.0 66 73.0 67 73.5 68 73.5 69 56.5 70 54.5 71 53.0 72 46.5 73 40.5 74 29.5 75 21.5 76 18.5 77 17.0 78 12.5 79 8.0 80 3.5 81 3.5 82 2.5 83 0.0 84 0.5 85 0.5 86 0.5 87 1.5 88 1.0 89 0.0 90 0.0 91 0.0 92 1.5 93 2.5 94 2.0 95 1.0 96 0.5 97 1.0 98 0.5 99 0.0 100 5.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.04394715556754 86.275 2 6.36290105149636 11.799999999999999 3 0.5392289026691831 1.5 4 0.026961445133459154 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026961445133459154 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.325 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.38749999999999996 0.0 0.0 0.0 0.0 114-115 0.5375000000000001 0.0 0.0 0.0 0.0 116-117 0.625 0.0 0.0 0.0 0.0 118-119 0.65 0.0 0.0 0.0 0.0 120-121 0.8374999999999999 0.0 0.0 0.0 0.0 122-123 0.9 0.0 0.0 0.0 0.0 124-125 0.9875 0.0 0.0 0.0 0.0 126-127 1.225 0.0 0.0 0.0 0.0 128-129 1.375 0.0 0.0 0.0 0.0 130-131 1.525 0.0 0.0 0.0 0.0 132-133 1.625 0.0 0.0 0.0 0.0 134-135 1.8875 0.0 0.0 0.0 0.0 136-137 2.0625 0.0 0.0 0.0 0.0 138-139 2.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1165830 spots for SRR7804142.sra Written 1165830 spots for SRR7804142.sra Read 1165830 spots for SRR7804142.sra Written 1165830 spots for SRR7804142.sra Read 1165830 spots for SRR7804142.sra Written 1165830 spots for SRR7804142.sra Read 1165830 spots for SRR7804142.sra Written 1165830 spots for SRR7804142.sra Read 1165830 spots for SRR7804142.sra Written 1165830 spots for SRR7804142.sra Read 1165830 spots for SRR7804142.sra Written 1165830 spots for SRR7804142.sra Read 1165830 spots for SRR7804142.sra Written 1165830 spots for SRR7804142.sra Read 1165830 spots for SRR7804142.sra Written 1165830 spots for SRR7804142.sra Read 1165830 spots for SRR7804142.sra Written 1165830 spots for SRR7804142.sra Read 1165830 spots for SRR7804142.sra Written 1165830 spots for SRR7804142.sra Read 1165830 spots for SRR7804142.sra Written 1165830 spots for SRR7804142.sra Read 1165832 spots for SRR7804142.sra Written 1165832 spots for SRR7804142.sra Read 1165830 spots for SRR7804142.sra Written 1165830 spots for SRR7804142.sra Read 1165830 spots for SRR7804142.sra Written 1165830 spots for SRR7804142.sra Read 1165830 spots for SRR7804142.sra Written 1165830 spots for SRR7804142.sra Read 1165830 spots for SRR7804142.sra Written 1165830 spots for SRR7804142.sra Read 1165830 spots for SRR7804142.sra Written 1165830 spots for SRR7804142.sra Read 1165830 spots for SRR7804142.sra Written 1165830 spots for SRR7804142.sra Read 1165830 spots for SRR7804142.sra Written 1165830 spots for SRR7804142.sra Read 1165830 spots for SRR7804142.sra Written 1165830 spots for SRR7804142.sra SRR ids: ['SRR7804142.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3m6guzie SRR7804142.sra spots: 23316602 blocks: [[1, 1165830], [1165831, 2331660], [2331661, 3497490], [3497491, 4663320], [4663321, 5829150], [5829151, 6994980], [6994981, 8160810], [8160811, 9326640], [9326641, 10492470], [10492471, 11658300], [11658301, 12824130], [12824131, 13989960], [13989961, 15155790], [15155791, 16321620], [16321621, 17487450], [17487451, 18653280], [18653281, 19819110], [19819111, 20984940], [20984941, 22150770], [22150771, 23316602]] SRR7804142 file size 7879530 SRR7804142 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804142 SRR7804142_1.fastq SRR7804142_2.fastq Input file: SRR7804142_1.fastq Paired file: SRR7804142_2.fastq trimmed: SRR7804142-trimmed-pair1.fastq, SRR7804142-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:16:10 2024 >> started Sat Dec 7 17:16:39 2024 >> done (29.447s) 23316602 read pairs processed; of these: 90 ( 0.00%) short read pairs filtered out after trimming by size control 691 ( 0.00%) empty read pairs filtered out after trimming by size control 23315821 (100.00%) read pairs available; of these: 999877 ( 4.29%) trimmed read pairs available after processing 22315944 (95.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 6 0.00% 20 13 0.00% 21 11 0.00% 22 16 0.00% 23 18 0.00% 24 14 0.00% 25 18 0.00% 26 15 0.00% 27 18 0.00% 28 28 0.00% 29 19 0.00% 30 28 0.00% 31 24 0.00% 32 28 0.00% 33 25 0.00% 34 14 0.00% 35 34 0.00% 36 29 0.00% 37 30 0.00% 38 36 0.00% 39 41 0.00% 40 37 0.00% 41 31 0.00% 42 35 0.00% 43 34 0.00% 44 28 0.00% 45 34 0.00% 46 46 0.00% 47 40 0.00% 48 41 0.00% 49 37 0.00% 50 42 0.00% 51 51 0.00% 52 56 0.00% 53 54 0.00% 54 65 0.00% 55 40 0.00% 56 53 0.00% 57 71 0.00% 58 43 0.00% 59 65 0.00% 60 60 0.00% 61 73 0.00% 62 93 0.00% 63 58 0.00% 64 96 0.00% 65 71 0.00% 66 89 0.00% 67 119 0.00% 68 103 0.00% 69 107 0.00% 70 126 0.00% 71 155 0.00% 72 183 0.00% 73 191 0.00% 74 200 0.00% 75 249 0.00% 76 250 0.00% 77 279 0.00% 78 306 0.00% 79 345 0.00% 80 404 0.00% 81 427 0.00% 82 567 0.00% 83 581 0.00% 84 700 0.00% 85 787 0.00% 86 882 0.00% 87 926 0.00% 88 990 0.00% 89 1070 0.00% 90 1286 0.01% 91 1457 0.01% 92 1692 0.01% 93 1839 0.01% 94 2066 0.01% 95 2199 0.01% 96 2477 0.01% 97 2708 0.01% 98 2832 0.01% 99 3102 0.01% 100 3350 0.01% 101 3637 0.02% 102 4122 0.02% 103 4332 0.02% 104 4808 0.02% 105 5378 0.02% 106 5641 0.02% 107 5842 0.03% 108 6280 0.03% 109 6767 0.03% 110 7040 0.03% 111 7538 0.03% 112 8167 0.04% 113 8989 0.04% 114 9434 0.04% 115 10304 0.04% 116 10741 0.05% 117 11107 0.05% 118 11686 0.05% 119 12102 0.05% 120 12719 0.05% 121 13233 0.06% 122 14012 0.06% 123 14993 0.06% 124 15937 0.07% 125 16994 0.07% 126 18069 0.08% 127 18539 0.08% 128 18971 0.08% 129 19845 0.09% 130 20287 0.09% 131 21200 0.09% 132 22433 0.10% 133 23757 0.10% 134 25147 0.11% 135 26078 0.11% 136 27108 0.12% 137 27640 0.12% 138 28463 0.12% 139 29875 0.13% 140 29876 0.13% 141 31032 0.13% 142 32469 0.14% 143 33972 0.15% 144 35648 0.15% 145 37744 0.16% 146 38716 0.17% 147 39608 0.17% 148 40598 0.17% 149 41363 0.18% 150 42760 0.18% 151 22315944 95.71% 23315821 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=24 prefix-density=0.60 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=111.71 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=6.6 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.87 fanout-score-rank=17 prefix-density=0.54 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=30.75 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.5 sequence=CTGGACATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGGTTTTCAAAACAATCACCATCATGCTATTAATGATATTAAAATCCCAACTATACCAAAGAATATCCCAATTATCCATAAAACTGTAACTAAGTGAGGCTCTCTCATTGGTTTATACTTCAATATAAGCCTTGGTAGGGATAGATAGCCACCTATATAGTATAGCTTCCCATCTTCTTTGAGAGTTGTTGGTTTATGCTCATCCCTACTCATAACCCCAGCACTTAGATATTTTAAAGAGGCATCTATCACATAAGGCATCATTATAACTAAAAATGGGATATATTCCTTATAAACTACTGCTAAGACAGCTAAGAAAGCTCCAATTGGTAGAGTTCCAACATCTCCTGGAAAAACCTTTGCTGGATATTTGTTAAATATCAATAGCCCTAAATAGGATGC SRR7804142 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:17:36 Started mapping on | Dec 07 17:17:37 Finished on | Dec 07 17:22:50 Mapping speed, Million of reads per hour | 268.17 Number of input reads | 23315821 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 20632406 Uniquely mapped reads % | 88.49% Average mapped length | 299.11 Number of splices: Total | 19660638 Number of splices: Annotated (sjdb) | 18503013 Number of splices: GT/AG | 19369145 Number of splices: GC/AG | 229905 Number of splices: AT/AC | 8320 Number of splices: Non-canonical | 53268 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 415672 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 42085 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.10% % of reads unmapped: other | 1.45% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2267743 2267743 2267743 N_multimapping 415672 415672 415672 N_noFeature 838968 20006508 1029164 N_ambiguous 546398 5071 110316 UnstrandedReadsAssigned:19247040 PositiveStrandReadsAssigned:620827 NegativeStrandReadsAssigned:19492926 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804142 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804142-trimmed-pair1.fastq SRR7804142-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,315,821 reads, 19,807,871 reads pseudoaligned [quant] estimated average fragment length: 284.448 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52973 SRR7804142.ke.tsv 35125 SRR7804142.se.tsv 88098 total ==> SRR7804142.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 652.977 0 0 PNS24247 1044 760.552 122.841 10.0993 PNS24249 1928 1644.55 241.712 9.1903 PNS24246 1044 760.552 122.841 10.0993 PNS24248 1044 760.552 122.841 10.0993 PNS24244 1471 1187.55 198.766 10.4657 PNS24243 293 79.5559 0 0 KQK14069 1603 1319.55 4818.82 228.346 KQK14071 474 213.552 197.228 57.749 ==> SRR7804142.se.tsv <== BRADI_1g14170v3 5427 BRADI_1g53295v3 924 BRADI_1g59795v3 813 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 402 BRADI_1g74790v3 1420 BRADI_1g09890v3 0 BRADI_1g77505v3 352 BRADI_1g48960v3 0 SRR7804142 completed mapping pipeline successfully