Starting /dee2/code/volunteer_pipeline.sh SRR7804143 current disk space = 1525158813696 free memory = 1559607260 SRR7804143 SRAfilesize 8ccd4bf3a86d9f8668e54374b0d2ff55 SRR7804143.sra SRR7804143.sra file validated SRR7804143 is paired end SRR7804143 is conventional basespace SRR7804143 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804143_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.147 37.0 37.0 37.0 37.0 37.0 2 36.26525 37.0 37.0 37.0 37.0 37.0 3 36.433 37.0 37.0 37.0 37.0 37.0 4 36.423 37.0 37.0 37.0 37.0 37.0 5 36.479 37.0 37.0 37.0 37.0 37.0 6 36.3875 37.0 37.0 37.0 37.0 37.0 7 36.366 37.0 37.0 37.0 37.0 37.0 8 36.495 37.0 37.0 37.0 37.0 37.0 9 36.402 37.0 37.0 37.0 37.0 37.0 10-14 36.5115 37.0 37.0 37.0 37.0 37.0 15-19 36.4671 37.0 37.0 37.0 37.0 37.0 20-24 36.4304 37.0 37.0 37.0 37.0 37.0 25-29 36.389300000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.4368 37.0 37.0 37.0 37.0 37.0 35-39 36.4034 37.0 37.0 37.0 37.0 37.0 40-44 36.4013 37.0 37.0 37.0 37.0 37.0 45-49 36.3284 37.0 37.0 37.0 37.0 37.0 50-54 36.35170000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.3316 37.0 37.0 37.0 37.0 37.0 60-64 36.29780000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.3074 37.0 37.0 37.0 37.0 37.0 70-74 36.2471 37.0 37.0 37.0 37.0 37.0 75-79 36.223 37.0 37.0 37.0 37.0 37.0 80-84 36.18759999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.1782 37.0 37.0 37.0 37.0 37.0 90-94 36.1457 37.0 37.0 37.0 37.0 37.0 95-99 36.126 37.0 37.0 37.0 37.0 37.0 100-104 36.0948 37.0 37.0 37.0 37.0 37.0 105-109 35.9774 37.0 37.0 37.0 37.0 37.0 110-114 35.9693 37.0 37.0 37.0 37.0 37.0 115-119 35.9955 37.0 37.0 37.0 37.0 37.0 120-124 35.926300000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.900400000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.788000000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.7843 37.0 37.0 37.0 37.0 37.0 140-144 35.7922 37.0 37.0 37.0 37.0 37.0 145-149 35.6962 37.0 37.0 37.0 37.0 37.0 150-151 35.223 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 2.0 24 2.0 25 2.0 26 5.0 27 8.0 28 16.0 29 13.0 30 35.0 31 54.0 32 58.0 33 105.0 34 120.0 35 356.0 36 2801.0 37 421.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.55 11.675 8.15 32.625 2 26.54490868151113 13.309982486865149 29.44708531398549 30.69802351763823 3 23.7 19.3 24.2 32.800000000000004 4 29.275000000000002 23.05 21.25 26.424999999999997 5 26.224999999999998 28.299999999999997 22.400000000000002 23.075000000000003 6 26.200000000000003 29.675 20.599999999999998 23.525 7 19.775000000000002 22.2 36.925000000000004 21.099999999999998 8 22.425 21.7 27.075 28.799999999999997 9 23.1 19.400000000000002 30.675 26.825 10-14 25.435000000000002 23.755000000000003 23.485 27.325 15-19 25.15 23.395 24.205 27.250000000000004 20-24 25.240000000000002 23.26 24.095 27.405 25-29 25.324999999999996 23.335 24.23 27.11 30-34 25.4 23.65 23.805 27.145000000000003 35-39 25.490000000000002 23.46 24.099999999999998 26.950000000000003 40-44 25.669999999999998 23.330000000000002 23.905 27.095000000000002 45-49 25.605 23.345 23.815 27.235 50-54 25.345000000000002 23.275000000000002 23.080000000000002 28.299999999999997 55-59 25.635 23.34 23.715 27.310000000000002 60-64 25.97 22.86 23.64 27.529999999999998 65-69 26.16 22.99 22.855 27.994999999999997 70-74 26.235000000000003 23.45 22.745 27.57 75-79 25.735000000000003 23.43 22.919999999999998 27.915 80-84 25.855 22.56 23.185 28.4 85-89 26.005 22.745 23.315 27.935 90-94 26.155 23.015 22.68 28.15 95-99 26.07 22.805 23.68 27.445000000000004 100-104 26.46 22.97 22.46 28.110000000000003 105-109 26.825 22.634999999999998 23.150000000000002 27.389999999999997 110-114 26.35 22.655 22.645 28.349999999999998 115-119 26.22 22.585 22.98 28.215 120-124 27.13 22.515 23.25 27.105 125-129 27.185 22.855 22.24 27.72 130-134 26.284999999999997 22.71 22.8 28.205000000000002 135-139 26.76 22.59 22.505 28.144999999999996 140-144 26.985 22.325 22.505 28.185 145-149 27.015 21.975 22.919999999999998 28.09 150-151 26.7625 22.5 22.6875 28.050000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.0 25 0.0 26 0.0 27 1.5 28 3.0 29 2.5 30 5.0 31 6.0 32 7.5 33 11.5 34 16.5 35 24.0 36 33.0 37 42.0 38 54.0 39 75.0 40 87.5 41 87.5 42 110.0 43 148.0 44 157.5 45 167.0 46 158.0 47 132.5 48 145.5 49 146.5 50 130.5 51 121.5 52 118.0 53 107.0 54 94.0 55 109.0 56 118.0 57 103.0 58 102.5 59 109.0 60 103.5 61 98.0 62 93.5 63 93.5 64 93.5 65 84.5 66 77.0 67 82.5 68 86.0 69 75.0 70 65.0 71 64.0 72 57.0 73 46.5 74 43.5 75 33.0 76 23.0 77 18.5 78 10.0 79 7.5 80 5.0 81 2.5 82 1.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 93.24577861163228 86.97500000000001 2 6.352184400964889 11.85 3 0.34843205574912894 0.975 4 0.05360493165371214 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.5874999999999999 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.75 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.9875 0.0 0.0 0.0 0.0 122-123 1.1125 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.2875 0.0 0.0 0.0 0.0 128-129 1.4125 0.0 0.0 0.0 0.0 130-131 1.625 0.0 0.0 0.0 0.0 132-133 1.9 0.0 0.0 0.0 0.0 134-135 2.0374999999999996 0.0 0.0 0.0 0.0 136-137 2.2375 0.0 0.0 0.0 0.0 138-139 2.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804143 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804143_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.345 37.0 37.0 37.0 37.0 37.0 2 36.1285 37.0 37.0 37.0 37.0 37.0 3 36.121 37.0 37.0 37.0 37.0 37.0 4 36.1585 37.0 37.0 37.0 37.0 37.0 5 36.211 37.0 37.0 37.0 37.0 37.0 6 36.2105 37.0 37.0 37.0 37.0 37.0 7 36.1125 37.0 37.0 37.0 37.0 37.0 8 36.3475 37.0 37.0 37.0 37.0 37.0 9 36.13 37.0 37.0 37.0 37.0 37.0 10-14 36.18489999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.06080000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.0721 37.0 37.0 37.0 37.0 37.0 25-29 36.0731 37.0 37.0 37.0 37.0 37.0 30-34 35.994699999999995 37.0 37.0 37.0 37.0 37.0 35-39 35.9504 37.0 37.0 37.0 37.0 37.0 40-44 35.917500000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.8852 37.0 37.0 37.0 37.0 37.0 50-54 35.812599999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.777100000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.787699999999994 37.0 37.0 37.0 37.0 37.0 65-69 35.7335 37.0 37.0 37.0 37.0 37.0 70-74 35.689600000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.73479999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.69599999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.6844 37.0 37.0 37.0 37.0 37.0 90-94 35.6737 37.0 37.0 37.0 37.0 37.0 95-99 35.581900000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.596199999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.521 37.0 37.0 37.0 37.0 37.0 110-114 35.4006 37.0 37.0 37.0 37.0 37.0 115-119 35.45369999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.3654 37.0 37.0 37.0 37.0 37.0 125-129 35.2594 37.0 37.0 37.0 37.0 37.0 130-134 35.3857 37.0 37.0 37.0 37.0 37.0 135-139 35.2615 37.0 37.0 37.0 34.6 37.0 140-144 35.2524 37.0 37.0 37.0 32.2 37.0 145-149 35.045399999999994 37.0 37.0 37.0 27.4 37.0 150-151 34.5895 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 7.0 14 8.0 15 10.0 16 3.0 17 1.0 18 5.0 19 1.0 20 5.0 21 7.0 22 12.0 23 10.0 24 10.0 25 9.0 26 7.0 27 14.0 28 19.0 29 15.0 30 25.0 31 38.0 32 63.0 33 103.0 34 174.0 35 506.0 36 2686.0 37 260.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.775 18.9 8.55 30.775000000000002 2 32.6 21.3 22.225 23.875 3 25.650000000000002 26.025 24.975 23.35 4 27.474999999999998 29.799999999999997 17.599999999999998 25.124999999999996 5 30.575000000000003 29.775000000000002 16.525000000000002 23.125 6 27.075 33.475 17.0 22.45 7 24.9 19.45 30.15 25.5 8 26.900000000000002 21.125 20.625 31.35 9 25.75 22.375 24.375 27.500000000000004 10-14 28.815 23.365 20.585 27.235 15-19 27.744999999999997 23.849999999999998 21.29 27.115000000000002 20-24 28.22 23.695 21.12 26.965 25-29 28.48 23.805 20.990000000000002 26.724999999999998 30-34 27.584999999999997 23.03 21.84 27.544999999999998 35-39 27.98 23.805 21.044999999999998 27.169999999999998 40-44 28.285 23.085 21.325 27.305 45-49 27.939999999999998 23.465 21.135 27.46 50-54 28.15 23.585 21.044999999999998 27.22 55-59 28.22 22.935 21.51 27.334999999999997 60-64 28.485 23.25 21.490000000000002 26.775 65-69 28.95 23.14 21.17 26.740000000000002 70-74 28.035 23.119999999999997 21.77 27.075 75-79 27.79 23.45 21.48 27.279999999999998 80-84 28.15 22.945 21.845 27.060000000000002 85-89 28.144999999999996 23.515 21.09 27.250000000000004 90-94 28.560000000000002 23.47 21.38 26.590000000000003 95-99 28.110000000000003 23.61 21.115000000000002 27.165 100-104 28.13 22.63 21.805 27.435 105-109 28.4 22.994999999999997 21.535 27.07 110-114 28.084999999999997 23.235 21.22 27.46 115-119 28.194999999999997 23.32 21.545 26.939999999999998 120-124 28.165000000000003 23.535 21.735 26.565 125-129 28.675 22.975 21.78 26.57 130-134 28.860000000000003 22.830000000000002 21.59 26.72 135-139 28.03 23.97 21.490000000000002 26.51 140-144 28.64 23.055 21.795 26.51 145-149 28.925 23.775 21.13 26.169999999999998 150-151 28.299999999999997 23.45 22.575 25.674999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 1.0 10 1.0 11 0.5 12 0.5 13 1.5 14 1.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 1.0 21 2.5 22 2.5 23 1.0 24 0.0 25 1.0 26 1.0 27 0.0 28 2.5 29 4.5 30 5.0 31 6.0 32 6.5 33 7.5 34 8.5 35 12.5 36 19.5 37 20.5 38 36.5 39 58.5 40 63.5 41 75.0 42 104.0 43 122.0 44 114.0 45 117.5 46 140.5 47 149.5 48 136.5 49 126.5 50 123.5 51 116.5 52 119.5 53 115.5 54 101.5 55 90.0 56 96.0 57 110.5 58 115.0 59 108.0 60 110.5 61 114.5 62 111.0 63 123.0 64 117.5 65 101.0 66 102.0 67 101.0 68 83.0 69 82.0 70 87.0 71 80.0 72 75.0 73 53.0 74 39.5 75 41.0 76 30.5 77 19.5 78 15.0 79 14.5 80 9.0 81 4.0 82 2.5 83 2.0 84 1.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.5 90 0.5 91 1.0 92 1.0 93 0.0 94 1.5 95 2.5 96 1.5 97 2.0 98 2.0 99 1.0 100 7.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.070908600701 86.3 2 6.524669722297115 12.1 3 0.37746023186842814 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026961445133459154 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 22 0.5499999999999999 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.36250000000000004 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.5874999999999999 0.0 0.0 0.0 0.0 114-115 0.6625000000000001 0.0 0.0 0.0 0.0 116-117 0.775 0.0 0.0 0.0 0.0 118-119 0.8500000000000001 0.0 0.0 0.0 0.0 120-121 1.0125 0.0 0.0 0.0 0.0 122-123 1.15 0.0 0.0 0.0 0.0 124-125 1.2375 0.0 0.0 0.0 0.0 126-127 1.3624999999999998 0.0 0.0 0.0 0.0 128-129 1.4625 0.0 0.0 0.0 0.0 130-131 1.675 0.0 0.0 0.0 0.0 132-133 1.95 0.0 0.0 0.0 0.0 134-135 2.0875000000000004 0.0 0.0 0.0 0.0 136-137 2.2625 0.0 0.0 0.0 0.0 138-139 2.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGAAA 10 0.006830828 145.0 1 >>END_MODULE Read 1764048 spots for SRR7804143.sra Written 1764048 spots for SRR7804143.sra Read 1764048 spots for SRR7804143.sra Written 1764048 spots for SRR7804143.sra Read 1764048 spots for SRR7804143.sra Written 1764048 spots for SRR7804143.sra Read 1764048 spots for SRR7804143.sra Written 1764048 spots for SRR7804143.sra Read 1764048 spots for SRR7804143.sra Written 1764048 spots for SRR7804143.sra Read 1764048 spots for SRR7804143.sra Written 1764048 spots for SRR7804143.sra Read 1764048 spots for SRR7804143.sra Written 1764048 spots for SRR7804143.sra Read 1764048 spots for SRR7804143.sra Written 1764048 spots for SRR7804143.sra Read 1764048 spots for SRR7804143.sra Written 1764048 spots for SRR7804143.sra Read 1764048 spots for SRR7804143.sra Written 1764048 spots for SRR7804143.sra Read 1764048 spots for SRR7804143.sra Written 1764048 spots for SRR7804143.sra Read 1764066 spots for SRR7804143.sra Written 1764066 spots for SRR7804143.sra Read 1764048 spots for SRR7804143.sra Written 1764048 spots for SRR7804143.sra Read 1764048 spots for SRR7804143.sra Written 1764048 spots for SRR7804143.sra Read 1764048 spots for SRR7804143.sra Written 1764048 spots for SRR7804143.sra Read 1764048 spots for SRR7804143.sra Written 1764048 spots for SRR7804143.sra Read 1764048 spots for SRR7804143.sra Written 1764048 spots for SRR7804143.sra Read 1764048 spots for SRR7804143.sra Written 1764048 spots for SRR7804143.sra Read 1764048 spots for SRR7804143.sra Written 1764048 spots for SRR7804143.sra Read 1764048 spots for SRR7804143.sra Written 1764048 spots for SRR7804143.sra SRR ids: ['SRR7804143.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f8gwffzx SRR7804143.sra spots: 35280978 blocks: [[1, 1764048], [1764049, 3528096], [3528097, 5292144], [5292145, 7056192], [7056193, 8820240], [8820241, 10584288], [10584289, 12348336], [12348337, 14112384], [14112385, 15876432], [15876433, 17640480], [17640481, 19404528], [19404529, 21168576], [21168577, 22932624], [22932625, 24696672], [24696673, 26460720], [26460721, 28224768], [28224769, 29988816], [29988817, 31752864], [31752865, 33516912], [33516913, 35280978]] SRR7804143 file size 11933865 SRR7804143 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804143 SRR7804143_1.fastq SRR7804143_2.fastq Input file: SRR7804143_1.fastq Paired file: SRR7804143_2.fastq trimmed: SRR7804143-trimmed-pair1.fastq, SRR7804143-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:44:56 2024 >> started Tue Dec 10 02:45:36 2024 >> done (40.041s) 35280978 read pairs processed; of these: 106 ( 0.00%) short read pairs filtered out after trimming by size control 1199 ( 0.00%) empty read pairs filtered out after trimming by size control 35279673 (100.00%) read pairs available; of these: 1305858 ( 3.70%) trimmed read pairs available after processing 33973815 (96.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 18 0.00% 20 10 0.00% 21 16 0.00% 22 11 0.00% 23 16 0.00% 24 21 0.00% 25 15 0.00% 26 12 0.00% 27 21 0.00% 28 22 0.00% 29 17 0.00% 30 27 0.00% 31 32 0.00% 32 18 0.00% 33 26 0.00% 34 16 0.00% 35 26 0.00% 36 30 0.00% 37 36 0.00% 38 45 0.00% 39 29 0.00% 40 43 0.00% 41 41 0.00% 42 58 0.00% 43 35 0.00% 44 26 0.00% 45 33 0.00% 46 48 0.00% 47 41 0.00% 48 51 0.00% 49 95 0.00% 50 40 0.00% 51 50 0.00% 52 48 0.00% 53 49 0.00% 54 59 0.00% 55 75 0.00% 56 77 0.00% 57 59 0.00% 58 77 0.00% 59 76 0.00% 60 77 0.00% 61 116 0.00% 62 111 0.00% 63 101 0.00% 64 104 0.00% 65 123 0.00% 66 135 0.00% 67 157 0.00% 68 144 0.00% 69 159 0.00% 70 197 0.00% 71 226 0.00% 72 241 0.00% 73 282 0.00% 74 335 0.00% 75 327 0.00% 76 352 0.00% 77 431 0.00% 78 452 0.00% 79 570 0.00% 80 584 0.00% 81 693 0.00% 82 780 0.00% 83 922 0.00% 84 999 0.00% 85 1164 0.00% 86 1291 0.00% 87 1409 0.00% 88 1504 0.00% 89 1680 0.00% 90 1891 0.01% 91 2132 0.01% 92 2417 0.01% 93 2584 0.01% 94 2978 0.01% 95 3160 0.01% 96 3558 0.01% 97 3758 0.01% 98 4178 0.01% 99 4432 0.01% 100 4701 0.01% 101 5313 0.02% 102 5653 0.02% 103 6116 0.02% 104 6784 0.02% 105 7080 0.02% 106 7595 0.02% 107 8048 0.02% 108 8640 0.02% 109 9058 0.03% 110 9673 0.03% 111 10077 0.03% 112 10907 0.03% 113 11786 0.03% 114 12655 0.04% 115 13545 0.04% 116 14116 0.04% 117 14602 0.04% 118 15355 0.04% 119 15785 0.04% 120 16773 0.05% 121 17907 0.05% 122 18614 0.05% 123 19787 0.06% 124 20816 0.06% 125 22157 0.06% 126 23222 0.07% 127 24157 0.07% 128 24649 0.07% 129 25801 0.07% 130 26519 0.08% 131 27406 0.08% 132 28718 0.08% 133 30400 0.09% 134 32693 0.09% 135 33641 0.10% 136 34207 0.10% 137 35683 0.10% 138 36953 0.10% 139 38423 0.11% 140 39011 0.11% 141 40595 0.12% 142 42266 0.12% 143 43997 0.12% 144 46339 0.13% 145 48046 0.14% 146 48956 0.14% 147 50837 0.14% 148 52725 0.15% 149 53258 0.15% 150 55497 0.16% 151 33973815 96.30% 35279673 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=5.50 fanout-score-rank=10 prefix-density=0.90 prefix-fanout=4.2 sequence=AGGTTCTCGAGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=14.36 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.1 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=25 prefix-density=0.79 prefix-fanout=2.6 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCGGGCAGCCCGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=64.86 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=2.9 sequence=CAAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAGTGC SRR7804143 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:46:27 Started mapping on | Dec 10 02:46:27 Finished on | Dec 10 02:51:38 Mapping speed, Million of reads per hour | 408.38 Number of input reads | 35279673 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 31953488 Uniquely mapped reads % | 90.57% Average mapped length | 299.35 Number of splices: Total | 29380828 Number of splices: Annotated (sjdb) | 27871825 Number of splices: GT/AG | 28971914 Number of splices: GC/AG | 330074 Number of splices: AT/AC | 10599 Number of splices: Non-canonical | 68241 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 504736 % of reads mapped to multiple loci | 1.43% Number of reads mapped to too many loci | 36335 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.02% % of reads unmapped: other | 0.87% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2821449 2821449 2821449 N_multimapping 504736 504736 504736 N_noFeature 977413 30999710 1259131 N_ambiguous 872359 4585 201763 UnstrandedReadsAssigned:30103716 PositiveStrandReadsAssigned:949193 NegativeStrandReadsAssigned:30492594 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804143 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804143-trimmed-pair1.fastq SRR7804143-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,279,673 reads, 30,875,600 reads pseudoaligned [quant] estimated average fragment length: 283.838 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52973 SRR7804143.ke.tsv 35125 SRR7804143.se.tsv 88098 total ==> SRR7804143.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 653.57 0 0 PNS24247 1044 761.162 113.92 5.96134 PNS24249 1928 1645.16 195.716 4.7385 PNS24246 1044 761.162 113.92 5.96134 PNS24248 1044 761.162 113.92 5.96134 PNS24244 1471 1188.16 164.525 5.51544 PNS24243 293 77.0031 0 0 KQK14069 1603 1320.16 12400.5 374.14 KQK14071 474 210.778 142.25 26.8812 ==> SRR7804143.se.tsv <== BRADI_1g14170v3 12532 BRADI_1g53295v3 1464 BRADI_1g59795v3 382 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 541 BRADI_1g74790v3 668 BRADI_1g09890v3 0 BRADI_1g77505v3 437 BRADI_1g48960v3 0 SRR7804143 completed mapping pipeline successfully