Starting /dee2/code/volunteer_pipeline.sh SRR7804144 current disk space = 1525097500672 free memory = 1600034128 SRR7804144 SRAfilesize 268aae0a26118c7b0805da7193be2fa0 SRR7804144.sra SRR7804144.sra file validated SRR7804144 is paired end SRR7804144 is conventional basespace SRR7804144 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804144_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.374 37.0 37.0 37.0 37.0 37.0 2 36.25675 37.0 37.0 37.0 37.0 37.0 3 36.4165 37.0 37.0 37.0 37.0 37.0 4 36.438 37.0 37.0 37.0 37.0 37.0 5 36.482 37.0 37.0 37.0 37.0 37.0 6 36.3865 37.0 37.0 37.0 37.0 37.0 7 36.4245 37.0 37.0 37.0 37.0 37.0 8 36.513 37.0 37.0 37.0 37.0 37.0 9 36.481 37.0 37.0 37.0 37.0 37.0 10-14 36.5176 37.0 37.0 37.0 37.0 37.0 15-19 36.5038 37.0 37.0 37.0 37.0 37.0 20-24 36.4635 37.0 37.0 37.0 37.0 37.0 25-29 36.439400000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.440799999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.429 37.0 37.0 37.0 37.0 37.0 40-44 36.4074 37.0 37.0 37.0 37.0 37.0 45-49 36.43769999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.390499999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.3889 37.0 37.0 37.0 37.0 37.0 60-64 36.334900000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.3355 37.0 37.0 37.0 37.0 37.0 70-74 36.3563 37.0 37.0 37.0 37.0 37.0 75-79 36.3396 37.0 37.0 37.0 37.0 37.0 80-84 36.256299999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.271100000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.24640000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.185199999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.162000000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.09930000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.129400000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.132 37.0 37.0 37.0 37.0 37.0 120-124 36.028999999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.9807 37.0 37.0 37.0 37.0 37.0 130-134 35.9415 37.0 37.0 37.0 37.0 37.0 135-139 35.984500000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.8651 37.0 37.0 37.0 37.0 37.0 145-149 35.813900000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.385999999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 1.0 25 0.0 26 6.0 27 4.0 28 9.0 29 16.0 30 16.0 31 40.0 32 57.0 33 86.0 34 147.0 35 342.0 36 2900.0 37 375.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.25 12.475 8.425 33.85 2 28.182045511377847 13.653413353338333 29.732433108277068 28.432108027006752 3 24.75 19.5 23.974999999999998 31.775 4 28.000000000000004 23.625 21.925 26.450000000000003 5 26.674999999999997 28.95 21.675 22.7 6 24.025 31.8 21.725 22.45 7 18.975 23.1 37.4 20.525 8 21.8 22.025 27.200000000000003 28.975 9 20.775 20.7 30.8 27.725 10-14 24.485 24.490000000000002 24.54 26.484999999999996 15-19 24.83 24.32 24.495 26.355 20-24 24.63 23.72 24.635 27.015 25-29 24.93 24.295 24.54 26.235000000000003 30-34 24.54 23.965 25.005 26.490000000000002 35-39 24.89 24.07 24.605 26.435 40-44 25.455 23.369999999999997 24.72 26.455000000000002 45-49 24.77 24.535 24.279999999999998 26.415 50-54 24.560000000000002 24.515 23.830000000000002 27.095000000000002 55-59 25.305 23.04 24.455 27.200000000000003 60-64 24.305 23.57 24.765 27.36 65-69 24.675 23.34 24.315 27.67 70-74 24.81 23.505000000000003 23.965 27.72 75-79 24.93 23.29 24.245 27.534999999999997 80-84 24.805 23.810000000000002 23.96 27.425 85-89 24.89 23.405 24.235 27.47 90-94 25.424999999999997 23.1 23.965 27.51 95-99 25.7 22.99 24.13 27.18 100-104 25.035 23.275000000000002 24.065 27.625 105-109 25.395 23.225 24.7 26.68 110-114 25.580000000000002 23.705000000000002 23.785 26.93 115-119 25.990000000000002 23.18 23.72 27.11 120-124 25.94 22.965 24.02 27.075 125-129 25.490000000000002 23.525 22.845 28.139999999999997 130-134 25.455 23.330000000000002 23.61 27.605 135-139 25.19 23.0 23.735 28.075 140-144 25.929999999999996 23.09 23.23 27.750000000000004 145-149 26.05 23.22 23.905 26.825 150-151 25.424999999999997 24.0375 23.3375 27.200000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 3.5 27 7.0 28 6.0 29 5.0 30 8.0 31 11.5 32 10.5 33 13.0 34 22.5 35 21.5 36 34.0 37 51.5 38 59.0 39 78.0 40 92.5 41 106.0 42 129.0 43 139.0 44 146.5 45 152.0 46 148.0 47 155.5 48 151.0 49 142.5 50 148.0 51 158.0 52 142.5 53 119.0 54 116.5 55 133.5 56 138.0 57 110.5 58 102.0 59 105.5 60 109.0 61 101.5 62 81.0 63 74.0 64 75.5 65 81.5 66 74.0 67 62.5 68 65.0 69 60.0 70 50.5 71 46.0 72 39.0 73 24.5 74 21.5 75 21.0 76 13.5 77 12.5 78 8.0 79 3.0 80 3.0 81 2.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.12483149096792 86.35000000000001 2 5.958479374494472 11.05 3 0.8627662442706929 2.4 4 0.05392289026691831 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0375 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.5375 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.725 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.7875000000000001 0.0 0.0 0.0 0.0 128-129 0.975 0.0 0.0 0.0 0.0 130-131 1.125 0.0 0.0 0.0 0.0 132-133 1.275 0.0 0.0 0.0 0.0 134-135 1.4 0.0 0.0 0.0 0.0 136-137 1.6 0.0 0.0 0.0 0.0 138-139 1.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGAAA 10 0.006830828 145.0 1 >>END_MODULE SRR7804144 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804144_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.36825 37.0 37.0 37.0 37.0 37.0 2 36.0545 37.0 37.0 37.0 37.0 37.0 3 36.029 37.0 37.0 37.0 37.0 37.0 4 36.2215 37.0 37.0 37.0 37.0 37.0 5 36.1735 37.0 37.0 37.0 37.0 37.0 6 36.208 37.0 37.0 37.0 37.0 37.0 7 36.116 37.0 37.0 37.0 37.0 37.0 8 36.184 37.0 37.0 37.0 37.0 37.0 9 36.0545 37.0 37.0 37.0 37.0 37.0 10-14 36.200100000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.0559 37.0 37.0 37.0 37.0 37.0 20-24 36.1068 37.0 37.0 37.0 37.0 37.0 25-29 36.118900000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.000099999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.974599999999995 37.0 37.0 37.0 37.0 37.0 40-44 35.981100000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.8967 37.0 37.0 37.0 37.0 37.0 50-54 35.8551 37.0 37.0 37.0 37.0 37.0 55-59 35.8423 37.0 37.0 37.0 37.0 37.0 60-64 35.784299999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.771 37.0 37.0 37.0 37.0 37.0 70-74 35.7858 37.0 37.0 37.0 37.0 37.0 75-79 35.7188 37.0 37.0 37.0 37.0 37.0 80-84 35.6879 37.0 37.0 37.0 37.0 37.0 85-89 35.7531 37.0 37.0 37.0 37.0 37.0 90-94 35.7008 37.0 37.0 37.0 37.0 37.0 95-99 35.6275 37.0 37.0 37.0 37.0 37.0 100-104 35.69070000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.5982 37.0 37.0 37.0 37.0 37.0 110-114 35.4661 37.0 37.0 37.0 37.0 37.0 115-119 35.3877 37.0 37.0 37.0 34.6 37.0 120-124 35.4171 37.0 37.0 37.0 37.0 37.0 125-129 35.2864 37.0 37.0 37.0 32.2 37.0 130-134 35.376599999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.313700000000004 37.0 37.0 37.0 34.6 37.0 140-144 35.2962 37.0 37.0 37.0 32.2 37.0 145-149 35.137299999999996 37.0 37.0 37.0 27.4 37.0 150-151 34.617000000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 4.0 15 10.0 16 4.0 17 2.0 18 5.0 19 2.0 20 2.0 21 6.0 22 9.0 23 10.0 24 5.0 25 7.0 26 11.0 27 9.0 28 18.0 29 20.0 30 37.0 31 36.0 32 55.0 33 92.0 34 207.0 35 610.0 36 2617.0 37 220.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.95721791343507 18.01351013259945 10.057543157368027 28.971728796597446 2 32.775 20.3 23.599999999999998 23.325000000000003 3 25.55 24.625 26.75 23.075000000000003 4 28.249999999999996 31.2 18.075 22.475 5 28.575 31.2 17.5 22.725 6 26.05 32.85 17.825 23.275000000000002 7 24.9 19.6 29.65 25.85 8 25.825 22.6 22.1 29.475 9 25.424999999999997 22.400000000000002 24.099999999999998 28.075 10-14 26.900000000000002 24.935 21.26 26.905 15-19 27.22 24.654999999999998 22.3 25.825 20-24 27.560000000000002 24.43 22.25 25.759999999999998 25-29 28.12 23.895 22.3 25.685000000000002 30-34 26.85 24.435000000000002 22.814999999999998 25.900000000000002 35-39 27.105 24.279999999999998 22.39 26.224999999999998 40-44 27.83 24.295 21.545 26.33 45-49 27.839999999999996 24.195 22.055 25.91 50-54 27.200000000000003 24.2 22.365 26.235000000000003 55-59 27.900000000000002 24.15 21.57 26.38 60-64 27.97 24.005000000000003 22.32 25.705 65-69 26.935 24.435000000000002 22.175 26.455000000000002 70-74 26.85 23.845 22.85 26.455000000000002 75-79 27.884999999999998 23.87 22.445 25.8 80-84 27.325 24.22 22.3 26.155 85-89 27.334999999999997 24.33 22.55 25.785000000000004 90-94 27.765 24.09 22.175 25.97 95-99 27.860000000000003 24.635 21.65 25.855 100-104 28.134999999999998 23.845 22.06 25.96 105-109 27.29 24.560000000000002 22.55 25.6 110-114 27.755000000000003 24.13 22.365 25.75 115-119 27.83 24.595 22.040000000000003 25.535000000000004 120-124 27.810000000000002 24.005000000000003 22.46 25.724999999999998 125-129 27.084999999999997 24.355 22.53 26.029999999999998 130-134 27.67 24.145 22.2 25.985000000000003 135-139 27.3 24.73 22.28 25.69 140-144 28.4 23.955000000000002 22.67 24.975 145-149 27.279999999999998 24.645 22.45 25.624999999999996 150-151 27.4125 24.4 23.0125 25.174999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.5 9 0.5 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.5 24 2.5 25 1.5 26 1.5 27 2.0 28 4.5 29 6.0 30 5.5 31 5.0 32 4.5 33 8.0 34 17.5 35 22.0 36 29.0 37 38.0 38 47.5 39 67.5 40 74.5 41 81.5 42 104.0 43 121.0 44 126.5 45 141.5 46 151.5 47 149.5 48 139.5 49 129.0 50 125.5 51 125.5 52 114.5 53 112.0 54 138.0 55 140.5 56 124.5 57 115.5 58 120.5 59 116.5 60 108.5 61 107.0 62 111.0 63 117.5 64 103.5 65 93.5 66 84.5 67 83.0 68 83.0 69 75.0 70 62.5 71 47.5 72 44.0 73 36.0 74 27.5 75 19.5 76 16.0 77 16.0 78 10.5 79 9.0 80 6.0 81 1.0 82 0.5 83 0.0 84 0.5 85 0.5 86 0.5 87 1.0 88 0.5 89 0.0 90 0.5 91 1.0 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 1.0 99 0.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.825 #Duplication Level Percentage of deduplicated Percentage of total 1 92.45848080588075 84.89999999999999 2 6.5613939558943635 12.049999999999999 3 0.7895453307922679 2.175 4 0.1361285053090117 0.5 5 0.027225701061802342 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027225701061802342 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit GCAAAAGCAATGGCCTCCCAGCTCTCCGCCATGGCCTCCGTGCCGCAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0375 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.44999999999999996 0.0 0.0 0.0 0.0 118-119 0.5125 0.0 0.0 0.0 0.0 120-121 0.6625 0.0 0.0 0.0 0.0 122-123 0.725 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.7875000000000001 0.0 0.0 0.0 0.0 128-129 0.975 0.0 0.0 0.0 0.0 130-131 1.125 0.0 0.0 0.0 0.0 132-133 1.275 0.0 0.0 0.0 0.0 134-135 1.3875000000000002 0.0 0.0 0.0 0.0 136-137 1.5750000000000002 0.0 0.0 0.0 0.0 138-139 1.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1370247 spots for SRR7804144.sra Written 1370247 spots for SRR7804144.sra Read 1370247 spots for SRR7804144.sra Written 1370247 spots for SRR7804144.sra Read 1370247 spots for SRR7804144.sra Written 1370247 spots for SRR7804144.sra Read 1370247 spots for SRR7804144.sra Written 1370247 spots for SRR7804144.sra Read 1370247 spots for SRR7804144.sra Written 1370247 spots for SRR7804144.sra Read 1370247 spots for SRR7804144.sra Written 1370247 spots for SRR7804144.sra Read 1370247 spots for SRR7804144.sra Written 1370247 spots for SRR7804144.sra Read 1370247 spots for SRR7804144.sra Written 1370247 spots for SRR7804144.sra Read 1370247 spots for SRR7804144.sra Written 1370247 spots for SRR7804144.sra Read 1370247 spots for SRR7804144.sra Written 1370247 spots for SRR7804144.sra Read 1370247 spots for SRR7804144.sra Written 1370247 spots for SRR7804144.sra Read 1370247 spots for SRR7804144.sra Written 1370247 spots for SRR7804144.sra Read 1370247 spots for SRR7804144.sra Written 1370247 spots for SRR7804144.sra Read 1370247 spots for SRR7804144.sra Written 1370247 spots for SRR7804144.sra Read 1370247 spots for SRR7804144.sra Written 1370247 spots for SRR7804144.sra Read 1370247 spots for SRR7804144.sra Written 1370247 spots for SRR7804144.sra Read 1370266 spots for SRR7804144.sra Written 1370266 spots for SRR7804144.sra Read 1370247 spots for SRR7804144.sra Written 1370247 spots for SRR7804144.sra Read 1370247 spots for SRR7804144.sra Written 1370247 spots for SRR7804144.sra Read 1370247 spots for SRR7804144.sra Written 1370247 spots for SRR7804144.sra SRR ids: ['SRR7804144.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0nev_0ru SRR7804144.sra spots: 27404959 blocks: [[1, 1370247], [1370248, 2740494], [2740495, 4110741], [4110742, 5480988], [5480989, 6851235], [6851236, 8221482], [8221483, 9591729], [9591730, 10961976], [10961977, 12332223], [12332224, 13702470], [13702471, 15072717], [15072718, 16442964], [16442965, 17813211], [17813212, 19183458], [19183459, 20553705], [20553706, 21923952], [21923953, 23294199], [23294200, 24664446], [24664447, 26034693], [26034694, 27404959]] SRR7804144 file size 9264941 SRR7804144 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804144 SRR7804144_1.fastq SRR7804144_2.fastq Input file: SRR7804144_1.fastq Paired file: SRR7804144_2.fastq trimmed: SRR7804144-trimmed-pair1.fastq, SRR7804144-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:46:40 2024 >> started Tue Dec 10 02:47:11 2024 >> done (31.692s) 27404959 read pairs processed; of these: 57 ( 0.00%) short read pairs filtered out after trimming by size control 343 ( 0.00%) empty read pairs filtered out after trimming by size control 27404559 (100.00%) read pairs available; of these: 739683 ( 2.70%) trimmed read pairs available after processing 26664876 (97.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 11 0.00% 20 18 0.00% 21 9 0.00% 22 20 0.00% 23 14 0.00% 24 9 0.00% 25 8 0.00% 26 9 0.00% 27 18 0.00% 28 18 0.00% 29 18 0.00% 30 23 0.00% 31 17 0.00% 32 28 0.00% 33 21 0.00% 34 23 0.00% 35 26 0.00% 36 18 0.00% 37 16 0.00% 38 28 0.00% 39 23 0.00% 40 24 0.00% 41 11 0.00% 42 27 0.00% 43 30 0.00% 44 29 0.00% 45 25 0.00% 46 29 0.00% 47 28 0.00% 48 31 0.00% 49 42 0.00% 50 35 0.00% 51 26 0.00% 52 37 0.00% 53 46 0.00% 54 43 0.00% 55 44 0.00% 56 39 0.00% 57 45 0.00% 58 48 0.00% 59 41 0.00% 60 55 0.00% 61 52 0.00% 62 64 0.00% 63 77 0.00% 64 68 0.00% 65 58 0.00% 66 64 0.00% 67 91 0.00% 68 77 0.00% 69 88 0.00% 70 84 0.00% 71 100 0.00% 72 109 0.00% 73 139 0.00% 74 159 0.00% 75 163 0.00% 76 194 0.00% 77 215 0.00% 78 226 0.00% 79 265 0.00% 80 302 0.00% 81 278 0.00% 82 410 0.00% 83 396 0.00% 84 497 0.00% 85 525 0.00% 86 598 0.00% 87 658 0.00% 88 697 0.00% 89 738 0.00% 90 845 0.00% 91 1043 0.00% 92 1195 0.00% 93 1232 0.00% 94 1424 0.01% 95 1556 0.01% 96 1731 0.01% 97 1863 0.01% 98 1980 0.01% 99 2122 0.01% 100 2316 0.01% 101 2525 0.01% 102 2750 0.01% 103 2926 0.01% 104 3367 0.01% 105 3588 0.01% 106 3808 0.01% 107 3819 0.01% 108 4353 0.02% 109 4656 0.02% 110 4921 0.02% 111 5304 0.02% 112 5711 0.02% 113 6062 0.02% 114 6878 0.03% 115 7015 0.03% 116 7619 0.03% 117 7773 0.03% 118 8003 0.03% 119 8371 0.03% 120 8952 0.03% 121 9246 0.03% 122 10043 0.04% 123 10849 0.04% 124 11450 0.04% 125 12178 0.04% 126 13223 0.05% 127 13003 0.05% 128 13798 0.05% 129 14153 0.05% 130 14654 0.05% 131 15136 0.06% 132 16362 0.06% 133 17619 0.06% 134 18372 0.07% 135 19352 0.07% 136 20273 0.07% 137 20720 0.08% 138 21307 0.08% 139 22118 0.08% 140 22813 0.08% 141 23461 0.09% 142 24720 0.09% 143 25703 0.09% 144 27785 0.10% 145 28604 0.10% 146 30192 0.11% 147 30966 0.11% 148 31399 0.11% 149 32319 0.12% 150 33645 0.12% 151 26664876 97.30% 27404559 reads passed initial QC criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=27 prefix-density=0.85 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=34 fanout-score=46.39 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=3.0 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=23 prefix-density=0.89 prefix-fanout=2.4 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=12.26 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.8 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804144 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:48:06 Started mapping on | Dec 10 02:48:06 Finished on | Dec 10 02:52:44 Mapping speed, Million of reads per hour | 354.88 Number of input reads | 27404559 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 22619002 Uniquely mapped reads % | 82.54% Average mapped length | 299.78 Number of splices: Total | 21268242 Number of splices: Annotated (sjdb) | 20141757 Number of splices: GT/AG | 20953482 Number of splices: GC/AG | 250804 Number of splices: AT/AC | 8204 Number of splices: Non-canonical | 55752 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1233476 % of reads mapped to multiple loci | 4.50% Number of reads mapped to too many loci | 167514 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.45% % of reads unmapped: other | 4.90% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3552081 3552081 3552081 N_multimapping 1233476 1233476 1233476 N_noFeature 1826650 21926569 1966689 N_ambiguous 673820 3848 122160 UnstrandedReadsAssigned:20118532 PositiveStrandReadsAssigned:688585 NegativeStrandReadsAssigned:20530153 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804144 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804144-trimmed-pair1.fastq SRR7804144-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,404,559 reads, 21,136,772 reads pseudoaligned [quant] estimated average fragment length: 298.137 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52973 SRR7804144.ke.tsv 35125 SRR7804144.se.tsv 88098 total ==> SRR7804144.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 639.271 0 0 PNS24247 1044 746.863 86.8026 6.1196 PNS24249 1928 1630.86 149.991 4.84259 PNS24246 1044 746.863 86.8026 6.1196 PNS24248 1044 746.863 86.8026 6.1196 PNS24244 1471 1173.86 133.601 5.99273 PNS24243 293 73.9001 0 0 KQK14069 1603 1305.86 7699.69 310.461 KQK14071 474 200.869 134.933 35.37 ==> SRR7804144.se.tsv <== BRADI_1g14170v3 8116 BRADI_1g53295v3 955 BRADI_1g59795v3 504 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 158 BRADI_1g74790v3 329 BRADI_1g09890v3 0 BRADI_1g77505v3 553 BRADI_1g48960v3 0 SRR7804144 completed mapping pipeline successfully