Starting /dee2/code/volunteer_pipeline.sh SRR7804145 current disk space = 1525103534080 free memory = 1601597024 SRR7804145 SRAfilesize ae6779efbf8a6fef026030fe560d0efb SRR7804145.sra SRR7804145.sra file validated SRR7804145 is paired end SRR7804145 is conventional basespace SRR7804145 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804145_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2735 37.0 37.0 37.0 37.0 37.0 2 36.15125 37.0 37.0 37.0 37.0 37.0 3 36.303 37.0 37.0 37.0 37.0 37.0 4 36.328 37.0 37.0 37.0 37.0 37.0 5 36.473 37.0 37.0 37.0 37.0 37.0 6 36.4585 37.0 37.0 37.0 37.0 37.0 7 36.3695 37.0 37.0 37.0 37.0 37.0 8 36.34 37.0 37.0 37.0 37.0 37.0 9 36.4305 37.0 37.0 37.0 37.0 37.0 10-14 36.424299999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.392 37.0 37.0 37.0 37.0 37.0 20-24 36.3808 37.0 37.0 37.0 37.0 37.0 25-29 36.3563 37.0 37.0 37.0 37.0 37.0 30-34 36.333299999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.380799999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.3018 37.0 37.0 37.0 37.0 37.0 45-49 36.321799999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.2821 37.0 37.0 37.0 37.0 37.0 55-59 36.2658 37.0 37.0 37.0 37.0 37.0 60-64 36.2376 37.0 37.0 37.0 37.0 37.0 65-69 36.2211 37.0 37.0 37.0 37.0 37.0 70-74 36.1428 37.0 37.0 37.0 37.0 37.0 75-79 36.2111 37.0 37.0 37.0 37.0 37.0 80-84 36.086400000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.088499999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.0647 37.0 37.0 37.0 37.0 37.0 95-99 36.047000000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.063 37.0 37.0 37.0 37.0 37.0 105-109 35.9805 37.0 37.0 37.0 37.0 37.0 110-114 35.9418 37.0 37.0 37.0 37.0 37.0 115-119 35.9602 37.0 37.0 37.0 37.0 37.0 120-124 35.8447 37.0 37.0 37.0 37.0 37.0 125-129 35.8353 37.0 37.0 37.0 37.0 37.0 130-134 35.8055 37.0 37.0 37.0 37.0 37.0 135-139 35.7645 37.0 37.0 37.0 37.0 37.0 140-144 35.631800000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.6279 37.0 37.0 37.0 37.0 37.0 150-151 35.04875 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 1.0 24 1.0 25 4.0 26 13.0 27 16.0 28 17.0 29 15.0 30 31.0 31 54.0 32 68.0 33 98.0 34 146.0 35 344.0 36 2800.0 37 390.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.775 14.575 9.700000000000001 31.95 2 27.9459594696022 12.984738553915436 28.546409807355516 30.522892169126848 3 23.549999999999997 16.475 24.4 35.575 4 25.674999999999997 21.475 23.1 29.75 5 26.0 25.825 23.200000000000003 24.975 6 25.474999999999998 27.325 23.925 23.275000000000002 7 19.55 22.725 36.6 21.125 8 21.85 25.25 27.3 25.6 9 20.599999999999998 21.525 32.15 25.724999999999998 10-14 23.705000000000002 25.3 25.174999999999997 25.82 15-19 23.955000000000002 24.33 25.275 26.44 20-24 24.07 24.465 25.645 25.82 25-29 23.990000000000002 24.709999999999997 25.115 26.185000000000002 30-34 23.77 24.959999999999997 24.745 26.525 35-39 24.224999999999998 24.585 25.035 26.155 40-44 23.825 24.25 25.119999999999997 26.805 45-49 23.78 24.745 24.965 26.51 50-54 24.16 24.685000000000002 24.48 26.674999999999997 55-59 24.365000000000002 24.73 24.4 26.505000000000003 60-64 24.37 24.38 24.48 26.77 65-69 24.565 24.060000000000002 24.32 27.055 70-74 23.98 24.595 24.355 27.07 75-79 24.21 24.445 24.490000000000002 26.855 80-84 24.335 24.145 24.27 27.250000000000004 85-89 25.005 24.310000000000002 24.145 26.540000000000003 90-94 24.985 23.785 24.395 26.834999999999997 95-99 24.785 23.86 24.495 26.86 100-104 25.205 23.655 24.39 26.75 105-109 24.6 24.19 24.175 27.034999999999997 110-114 24.83 23.69 24.45 27.029999999999998 115-119 24.585 24.365000000000002 23.965 27.084999999999997 120-124 25.035 23.145 24.43 27.389999999999997 125-129 25.119999999999997 23.59 24.37 26.919999999999998 130-134 24.84 23.82 24.4 26.939999999999998 135-139 24.485 23.515 24.935 27.065 140-144 25.074999999999996 24.044999999999998 24.175 26.705000000000002 145-149 24.84 24.39 23.91 26.86 150-151 25.15 24.0625 24.125 26.6625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 0.5 22 1.0 23 1.5 24 0.5 25 0.5 26 2.5 27 3.0 28 1.5 29 4.5 30 5.5 31 9.0 32 15.5 33 20.5 34 29.5 35 38.5 36 45.0 37 61.0 38 77.5 39 90.5 40 105.5 41 110.0 42 123.5 43 151.0 44 156.0 45 148.0 46 166.0 47 191.5 48 179.5 49 162.0 50 158.5 51 148.5 52 133.5 53 127.5 54 120.5 55 112.5 56 110.0 57 90.5 58 80.5 59 92.5 60 91.5 61 81.0 62 70.5 63 63.5 64 74.5 65 70.0 66 65.0 67 64.5 68 52.0 69 46.0 70 44.0 71 35.5 72 26.5 73 27.0 74 26.5 75 22.0 76 16.5 77 12.0 78 11.0 79 8.5 80 4.0 81 2.5 82 2.5 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.6698717948718 87.675 2 5.876068376068376 11.0 3 0.4273504273504274 1.2 4 0.0 0.0 5 0.02670940170940171 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCATTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.275 0.0 0.0 0.0 0.0 118-119 0.275 0.0 0.0 0.0 0.0 120-121 0.3125 0.0 0.0 0.0 0.0 122-123 0.44999999999999996 0.0 0.0 0.0 0.0 124-125 0.525 0.0 0.0 0.0 0.0 126-127 0.625 0.0 0.0 0.0 0.0 128-129 0.7 0.0 0.0 0.0 0.0 130-131 0.7749999999999999 0.0 0.0 0.0 0.0 132-133 0.9125000000000001 0.0 0.0 0.0 0.0 134-135 1.0625 0.0 0.0 0.0 0.0 136-137 1.2375 0.0 0.0 0.0 0.0 138-139 1.3624999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCAGC 10 0.006830828 145.0 1 CCAGCGT 10 0.006830828 145.0 3 GTCCGCG 10 0.006830828 145.0 8 GCGTCCG 10 0.006830828 145.0 6 TCCGCGG 10 0.006830828 145.0 9 CAGCGTC 10 0.006830828 145.0 4 CGTCCGC 10 0.006830828 145.0 7 >>END_MODULE SRR7804145 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804145_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.278 37.0 37.0 37.0 37.0 37.0 2 35.9495 37.0 37.0 37.0 37.0 37.0 3 35.973 37.0 37.0 37.0 37.0 37.0 4 36.0785 37.0 37.0 37.0 37.0 37.0 5 36.077 37.0 37.0 37.0 37.0 37.0 6 36.003 37.0 37.0 37.0 37.0 37.0 7 35.979 37.0 37.0 37.0 37.0 37.0 8 36.2365 37.0 37.0 37.0 37.0 37.0 9 35.9345 37.0 37.0 37.0 37.0 37.0 10-14 36.018 37.0 37.0 37.0 37.0 37.0 15-19 35.8602 37.0 37.0 37.0 37.0 37.0 20-24 35.887699999999995 37.0 37.0 37.0 37.0 37.0 25-29 35.8754 37.0 37.0 37.0 37.0 37.0 30-34 35.8432 37.0 37.0 37.0 37.0 37.0 35-39 35.772299999999994 37.0 37.0 37.0 37.0 37.0 40-44 35.7418 37.0 37.0 37.0 37.0 37.0 45-49 35.730399999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.6867 37.0 37.0 37.0 37.0 37.0 55-59 35.6567 37.0 37.0 37.0 37.0 37.0 60-64 35.5727 37.0 37.0 37.0 37.0 37.0 65-69 35.5629 37.0 37.0 37.0 37.0 37.0 70-74 35.5441 37.0 37.0 37.0 37.0 37.0 75-79 35.5182 37.0 37.0 37.0 37.0 37.0 80-84 35.499399999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.4062 37.0 37.0 37.0 37.0 37.0 90-94 35.4902 37.0 37.0 37.0 37.0 37.0 95-99 35.4262 37.0 37.0 37.0 37.0 37.0 100-104 35.451 37.0 37.0 37.0 37.0 37.0 105-109 35.3236 37.0 37.0 37.0 37.0 37.0 110-114 35.2379 37.0 37.0 37.0 32.2 37.0 115-119 35.2255 37.0 37.0 37.0 34.6 37.0 120-124 35.242000000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.1572 37.0 37.0 37.0 27.4 37.0 130-134 35.1802 37.0 37.0 37.0 32.2 37.0 135-139 35.0784 37.0 37.0 37.0 27.4 37.0 140-144 35.0512 37.0 37.0 37.0 27.4 37.0 145-149 34.81 37.0 37.0 37.0 25.0 37.0 150-151 34.362 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 10.0 14 8.0 15 12.0 16 5.0 17 7.0 18 2.0 19 2.0 20 4.0 21 5.0 22 14.0 23 15.0 24 7.0 25 17.0 26 13.0 27 15.0 28 18.0 29 24.0 30 37.0 31 49.0 32 62.0 33 123.0 34 175.0 35 553.0 36 2596.0 37 225.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.04602301150575 19.459729864932466 11.980990495247623 26.513256628314156 2 31.275 23.375 23.125 22.225 3 26.700000000000003 23.9 26.275 23.125 4 27.750000000000004 29.525000000000002 20.4 22.325 5 29.175 30.975 18.675 21.175 6 25.575 33.675 18.25 22.5 7 24.224999999999998 20.575 30.825000000000003 24.375 8 28.225 21.925 19.475 30.375000000000004 9 24.15 24.825 25.1 25.924999999999997 10-14 27.634999999999998 25.415 21.685 25.264999999999997 15-19 27.205000000000002 24.88 22.89 25.025 20-24 27.04 25.005 22.74 25.215 25-29 26.955000000000002 25.174999999999997 22.55 25.319999999999997 30-34 26.700000000000003 25.695 22.615 24.990000000000002 35-39 26.595000000000002 25.06 23.200000000000003 25.145 40-44 27.029999999999998 25.09 22.345000000000002 25.535000000000004 45-49 27.345000000000002 25.009999999999998 22.55 25.095 50-54 27.365000000000002 25.019999999999996 22.525000000000002 25.09 55-59 27.57 24.545 22.95 24.935 60-64 26.43 25.169999999999998 23.325000000000003 25.074999999999996 65-69 26.405 25.119999999999997 23.119999999999997 25.355 70-74 26.87 25.05 22.605 25.474999999999998 75-79 27.150000000000002 24.985 23.01 24.855 80-84 27.11 25.185000000000002 22.695 25.009999999999998 85-89 26.595000000000002 24.779999999999998 23.145 25.480000000000004 90-94 27.375 24.855 22.705000000000002 25.064999999999998 95-99 27.029999999999998 24.654999999999998 23.035 25.28 100-104 27.265 24.805 22.495 25.435000000000002 105-109 26.834999999999997 24.515 23.3 25.35 110-114 27.055 24.575 23.04 25.330000000000002 115-119 27.245 24.575 23.02 25.16 120-124 27.12 25.224999999999998 22.955000000000002 24.7 125-129 26.534999999999997 25.505 22.925 25.035 130-134 27.005000000000003 25.174999999999997 23.14 24.68 135-139 27.57 24.89 23.185 24.355 140-144 26.77 25.715 22.759999999999998 24.755 145-149 26.82 25.840000000000003 22.71 24.63 150-151 27.825 25.3 21.912499999999998 24.962500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 1.0 11 2.0 12 2.5 13 1.5 14 0.0 15 0.0 16 1.0 17 1.0 18 1.0 19 2.0 20 1.0 21 1.0 22 1.5 23 1.0 24 1.5 25 2.5 26 4.5 27 4.5 28 3.0 29 4.5 30 5.5 31 9.0 32 10.0 33 11.0 34 18.5 35 25.5 36 34.5 37 51.5 38 64.5 39 76.0 40 97.0 41 110.5 42 119.5 43 128.0 44 136.0 45 148.0 46 163.5 47 176.0 48 178.0 49 152.5 50 134.0 51 135.0 52 132.5 53 126.0 54 134.0 55 128.0 56 107.0 57 102.0 58 93.0 59 91.5 60 91.5 61 91.0 62 87.0 63 80.0 64 70.5 65 62.0 66 60.5 67 63.0 68 61.0 69 59.0 70 51.5 71 47.0 72 50.0 73 41.5 74 32.0 75 26.0 76 23.5 77 20.0 78 13.5 79 7.5 80 2.5 81 1.0 82 1.0 83 1.0 84 1.0 85 0.5 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.5 95 0.5 96 0.5 97 1.0 98 1.0 99 1.0 100 5.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.75 #Duplication Level Percentage of deduplicated Percentage of total 1 93.34231805929919 86.575 2 5.902964959568733 10.95 3 0.646900269541779 1.7999999999999998 4 0.05390835579514825 0.2 5 0.0 0.0 6 0.026954177897574125 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026954177897574125 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit AGAGTTCTTGTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.2375 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.25 0.0 0.0 0.0 0.0 120-121 0.2875 0.0 0.0 0.0 0.0 122-123 0.42500000000000004 0.0 0.0 0.0 0.0 124-125 0.5 0.0 0.0 0.0 0.0 126-127 0.6 0.0 0.0 0.0 0.0 128-129 0.6875 0.0 0.0 0.0 0.0 130-131 0.7749999999999999 0.0 0.0 0.0 0.0 132-133 0.925 0.0 0.0 0.0 0.0 134-135 1.075 0.0 0.0 0.0 0.0 136-137 1.2125 0.0 0.0 0.0 0.0 138-139 1.3624999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTATT 10 0.006830828 145.0 2 AGGGCTT 10 0.006830828 145.0 4 GTATTTG 10 0.006830828 145.0 4 TTGAGGG 10 0.006830828 145.0 8 AGTATTT 10 0.006830828 145.0 3 TATTTGA 10 0.006830828 145.0 5 ATTTGAG 10 0.006830828 145.0 6 TGAGGGT 10 0.006830828 145.0 9 AGGCAAA 10 0.006830828 145.0 145 >>END_MODULE Read 1397123 spots for SRR7804145.sra Written 1397123 spots for SRR7804145.sra Read 1397123 spots for SRR7804145.sra Written 1397123 spots for SRR7804145.sra Read 1397123 spots for SRR7804145.sra Written 1397123 spots for SRR7804145.sra Read 1397123 spots for SRR7804145.sra Written 1397123 spots for SRR7804145.sra Read 1397123 spots for SRR7804145.sra Written 1397123 spots for SRR7804145.sra Read 1397123 spots for SRR7804145.sra Written 1397123 spots for SRR7804145.sra Read 1397123 spots for SRR7804145.sra Written 1397123 spots for SRR7804145.sra Read 1397123 spots for SRR7804145.sra Written 1397123 spots for SRR7804145.sra Read 1397123 spots for SRR7804145.sra Written 1397123 spots for SRR7804145.sra Read 1397123 spots for SRR7804145.sra Written 1397123 spots for SRR7804145.sra Read 1397123 spots for SRR7804145.sra Written 1397123 spots for SRR7804145.sra Read 1397123 spots for SRR7804145.sra Written 1397123 spots for SRR7804145.sra Read 1397130 spots for SRR7804145.sra Written 1397130 spots for SRR7804145.sra Read 1397123 spots for SRR7804145.sra Written 1397123 spots for SRR7804145.sra Read 1397123 spots for SRR7804145.sra Written 1397123 spots for SRR7804145.sra Read 1397123 spots for SRR7804145.sra Written 1397123 spots for SRR7804145.sra Read 1397123 spots for SRR7804145.sra Written 1397123 spots for SRR7804145.sra Read 1397123 spots for SRR7804145.sra Written 1397123 spots for SRR7804145.sra Read 1397123 spots for SRR7804145.sra Written 1397123 spots for SRR7804145.sra Read 1397123 spots for SRR7804145.sra Written 1397123 spots for SRR7804145.sra SRR ids: ['SRR7804145.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ezsb47ia SRR7804145.sra spots: 27942467 blocks: [[1, 1397123], [1397124, 2794246], [2794247, 4191369], [4191370, 5588492], [5588493, 6985615], [6985616, 8382738], [8382739, 9779861], [9779862, 11176984], [11176985, 12574107], [12574108, 13971230], [13971231, 15368353], [15368354, 16765476], [16765477, 18162599], [18162600, 19559722], [19559723, 20956845], [20956846, 22353968], [22353969, 23751091], [23751092, 25148214], [25148215, 26545337], [26545338, 27942467]] SRR7804145 file size 9447084 SRR7804145 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804145 SRR7804145_1.fastq SRR7804145_2.fastq Input file: SRR7804145_1.fastq Paired file: SRR7804145_2.fastq trimmed: SRR7804145-trimmed-pair1.fastq, SRR7804145-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:47:53 2024 >> started Tue Dec 10 02:48:24 2024 >> done (31.187s) 27942467 read pairs processed; of these: 142 ( 0.00%) short read pairs filtered out after trimming by size control 756 ( 0.00%) empty read pairs filtered out after trimming by size control 27941569 (100.00%) read pairs available; of these: 697105 ( 2.49%) trimmed read pairs available after processing 27244464 (97.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 16 0.00% 20 16 0.00% 21 24 0.00% 22 32 0.00% 23 27 0.00% 24 31 0.00% 25 29 0.00% 26 37 0.00% 27 34 0.00% 28 38 0.00% 29 41 0.00% 30 51 0.00% 31 50 0.00% 32 55 0.00% 33 61 0.00% 34 45 0.00% 35 75 0.00% 36 56 0.00% 37 78 0.00% 38 83 0.00% 39 60 0.00% 40 73 0.00% 41 59 0.00% 42 83 0.00% 43 96 0.00% 44 74 0.00% 45 99 0.00% 46 103 0.00% 47 91 0.00% 48 93 0.00% 49 96 0.00% 50 93 0.00% 51 79 0.00% 52 109 0.00% 53 140 0.00% 54 119 0.00% 55 114 0.00% 56 98 0.00% 57 125 0.00% 58 135 0.00% 59 120 0.00% 60 133 0.00% 61 126 0.00% 62 136 0.00% 63 145 0.00% 64 155 0.00% 65 140 0.00% 66 154 0.00% 67 162 0.00% 68 173 0.00% 69 176 0.00% 70 194 0.00% 71 203 0.00% 72 187 0.00% 73 224 0.00% 74 220 0.00% 75 259 0.00% 76 273 0.00% 77 295 0.00% 78 302 0.00% 79 352 0.00% 80 404 0.00% 81 417 0.00% 82 475 0.00% 83 527 0.00% 84 567 0.00% 85 601 0.00% 86 651 0.00% 87 733 0.00% 88 771 0.00% 89 824 0.00% 90 934 0.00% 91 1026 0.00% 92 1203 0.00% 93 1226 0.00% 94 1491 0.01% 95 1557 0.01% 96 1674 0.01% 97 1834 0.01% 98 1905 0.01% 99 2062 0.01% 100 2385 0.01% 101 2522 0.01% 102 2741 0.01% 103 2973 0.01% 104 3253 0.01% 105 3350 0.01% 106 3770 0.01% 107 3842 0.01% 108 4204 0.02% 109 4483 0.02% 110 4778 0.02% 111 4968 0.02% 112 5472 0.02% 113 5927 0.02% 114 6115 0.02% 115 6634 0.02% 116 7133 0.03% 117 7506 0.03% 118 7591 0.03% 119 8190 0.03% 120 8650 0.03% 121 8949 0.03% 122 9623 0.03% 123 10216 0.04% 124 10875 0.04% 125 11568 0.04% 126 11810 0.04% 127 12229 0.04% 128 12721 0.05% 129 13620 0.05% 130 13849 0.05% 131 14567 0.05% 132 15433 0.06% 133 16092 0.06% 134 17036 0.06% 135 17656 0.06% 136 18819 0.07% 137 19127 0.07% 138 19851 0.07% 139 20196 0.07% 140 21207 0.08% 141 21878 0.08% 142 23195 0.08% 143 24269 0.09% 144 24858 0.09% 145 26378 0.09% 146 27211 0.10% 147 28378 0.10% 148 29457 0.11% 149 30327 0.11% 150 31380 0.11% 151 27244464 97.51% 27941569 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=29 prefix-density=0.32 prefix-fanout=2.7 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=133.51 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=6.4 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=5.63 fanout-score-rank=9 prefix-density=0.49 prefix-fanout=4.2 sequence=AAGATCCAGGACAAGGAGGGCATCCCCCCGGACCAGCAGCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=22.21 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.6 sequence=GCAAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAGTGC SRR7804145 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:49:21 Started mapping on | Dec 10 02:49:21 Finished on | Dec 10 02:54:16 Mapping speed, Million of reads per hour | 340.98 Number of input reads | 27941569 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 24821979 Uniquely mapped reads % | 88.84% Average mapped length | 299.80 Number of splices: Total | 24244257 Number of splices: Annotated (sjdb) | 22839631 Number of splices: GT/AG | 23902095 Number of splices: GC/AG | 278000 Number of splices: AT/AC | 7679 Number of splices: Non-canonical | 56483 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 863527 % of reads mapped to multiple loci | 3.09% Number of reads mapped to too many loci | 24932 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.30% % of reads unmapped: other | 0.69% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2256063 2256063 2256063 N_multimapping 863527 863527 863527 N_noFeature 1436822 24110464 1631250 N_ambiguous 632892 7081 115549 UnstrandedReadsAssigned:22752265 PositiveStrandReadsAssigned:704434 NegativeStrandReadsAssigned:23075180 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804145 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804145-trimmed-pair1.fastq SRR7804145-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,941,569 reads, 23,673,656 reads pseudoaligned [quant] estimated average fragment length: 308.102 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52973 SRR7804145.ke.tsv 35125 SRR7804145.se.tsv 88098 total ==> SRR7804145.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 629.662 0 0 PNS24247 1044 736.898 63.9862 4.82679 PNS24249 1928 1620.9 202.585 6.94752 PNS24246 1044 736.898 63.9862 4.82679 PNS24248 1044 736.898 63.9862 4.82679 PNS24244 1471 1163.9 109.457 5.22765 PNS24243 293 71.8385 0 0 KQK14069 1603 1295.9 1455.17 62.4198 KQK14071 474 195.731 12.8343 3.64494 ==> SRR7804145.se.tsv <== BRADI_1g14170v3 1529 BRADI_1g53295v3 109 BRADI_1g59795v3 291 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 462 BRADI_1g74790v3 1971 BRADI_1g09890v3 0 BRADI_1g77505v3 201 BRADI_1g48960v3 0 SRR7804145 completed mapping pipeline successfully