Starting /dee2/code/volunteer_pipeline.sh SRR7804146 current disk space = 1525136084992 free memory = 1565891480 SRR7804146 SRAfilesize a95b4e20ac39bdf65ddbc1399285ad9d SRR7804146.sra SRR7804146.sra file validated SRR7804146 is paired end SRR7804146 is conventional basespace SRR7804146 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804146_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3055 37.0 37.0 37.0 37.0 37.0 2 36.27425 37.0 37.0 37.0 37.0 37.0 3 36.4675 37.0 37.0 37.0 37.0 37.0 4 36.412 37.0 37.0 37.0 37.0 37.0 5 36.562 37.0 37.0 37.0 37.0 37.0 6 36.479 37.0 37.0 37.0 37.0 37.0 7 36.3905 37.0 37.0 37.0 37.0 37.0 8 36.4865 37.0 37.0 37.0 37.0 37.0 9 36.449 37.0 37.0 37.0 37.0 37.0 10-14 36.4798 37.0 37.0 37.0 37.0 37.0 15-19 36.4813 37.0 37.0 37.0 37.0 37.0 20-24 36.465199999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.4091 37.0 37.0 37.0 37.0 37.0 30-34 36.4525 37.0 37.0 37.0 37.0 37.0 35-39 36.4239 37.0 37.0 37.0 37.0 37.0 40-44 36.432300000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.3872 37.0 37.0 37.0 37.0 37.0 50-54 36.4066 37.0 37.0 37.0 37.0 37.0 55-59 36.34740000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.3103 37.0 37.0 37.0 37.0 37.0 65-69 36.379000000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.2736 37.0 37.0 37.0 37.0 37.0 75-79 36.285199999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.2053 37.0 37.0 37.0 37.0 37.0 85-89 36.171899999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.2089 37.0 37.0 37.0 37.0 37.0 95-99 36.1542 37.0 37.0 37.0 37.0 37.0 100-104 36.170300000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.0985 37.0 37.0 37.0 37.0 37.0 110-114 35.9972 37.0 37.0 37.0 37.0 37.0 115-119 36.03150000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.9803 37.0 37.0 37.0 37.0 37.0 125-129 35.94689999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.855399999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.8461 37.0 37.0 37.0 37.0 37.0 140-144 35.7977 37.0 37.0 37.0 37.0 37.0 145-149 35.7605 37.0 37.0 37.0 37.0 37.0 150-151 35.22025 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 2.0 25 2.0 26 8.0 27 11.0 28 12.0 29 11.0 30 38.0 31 43.0 32 59.0 33 90.0 34 115.0 35 318.0 36 2878.0 37 412.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.325 13.375 9.475 33.825 2 27.056764191047762 13.603400850212552 30.9827456864216 28.35708927231808 3 22.125 19.650000000000002 24.075 34.150000000000006 4 26.1 25.0 21.275 27.625 5 26.900000000000002 27.675 22.525000000000002 22.900000000000002 6 25.074999999999996 30.875000000000004 20.175 23.875 7 19.375 22.1 36.8 21.725 8 22.175 22.650000000000002 27.474999999999998 27.700000000000003 9 20.025000000000002 21.475 30.825000000000003 27.675 10-14 24.54 25.324999999999996 23.735 26.400000000000002 15-19 24.13 24.865000000000002 24.765 26.240000000000002 20-24 24.695 24.63 24.2 26.474999999999998 25-29 24.685000000000002 23.895 24.245 27.175 30-34 24.645 24.66 24.605 26.090000000000003 35-39 24.025 24.245 24.89 26.840000000000003 40-44 24.705 24.23 24.455 26.61 45-49 25.16 23.3 24.375 27.165 50-54 24.465 24.15 24.33 27.055 55-59 24.345 24.08 24.385 27.189999999999998 60-64 25.380000000000003 23.919999999999998 24.285 26.415 65-69 24.759999999999998 23.919999999999998 24.04 27.279999999999998 70-74 24.959999999999997 24.26 23.815 26.965 75-79 25.03 24.12 23.855 26.995 80-84 24.935 24.275 24.12 26.669999999999998 85-89 25.290000000000003 24.02 23.94 26.75 90-94 25.96 23.21 24.27 26.56 95-99 25.615 23.785 23.775 26.825 100-104 24.875 23.745 23.68 27.700000000000003 105-109 25.240000000000002 23.47 23.93 27.36 110-114 25.490000000000002 23.32 23.465 27.725 115-119 24.990000000000002 23.39 24.12 27.500000000000004 120-124 26.179999999999996 23.080000000000002 23.525 27.215 125-129 25.445 22.685 24.47 27.400000000000002 130-134 25.56 23.685000000000002 23.74 27.015 135-139 25.685000000000002 23.22 23.87 27.224999999999998 140-144 25.895000000000003 22.36 24.545 27.200000000000003 145-149 25.66 23.605 23.435 27.3 150-151 26.487500000000004 22.925 23.724999999999998 26.8625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 0.5 28 1.0 29 3.5 30 5.5 31 7.0 32 9.5 33 11.5 34 21.0 35 33.0 36 36.5 37 48.0 38 59.5 39 76.0 40 94.5 41 111.0 42 133.0 43 157.5 44 152.0 45 159.5 46 194.0 47 190.5 48 176.5 49 167.5 50 151.0 51 146.5 52 146.0 53 129.0 54 112.5 55 101.5 56 91.0 57 93.5 58 102.5 59 86.0 60 89.5 61 92.5 62 71.0 63 75.0 64 83.5 65 69.5 66 52.5 67 55.5 68 61.5 69 58.0 70 48.0 71 41.0 72 41.5 73 41.5 74 34.0 75 19.5 76 13.0 77 13.0 78 11.0 79 7.5 80 4.5 81 2.0 82 0.5 83 1.0 84 1.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.375 #Duplication Level Percentage of deduplicated Percentage of total 1 93.52074966532797 87.325 2 5.9170013386880855 11.05 3 0.5087014725568942 1.425 4 0.0535475234270415 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.4875 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.6625000000000001 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 1.0375 0.0 0.0 0.0 0.0 130-131 1.2375 0.0 0.0 0.0 0.0 132-133 1.3125 0.0 0.0 0.0 0.0 134-135 1.4500000000000002 0.0 0.0 0.0 0.0 136-137 1.6125 0.0 0.0 0.0 0.0 138-139 1.8624999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTTGCT 10 0.006830828 145.0 2 >>END_MODULE SRR7804146 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804146_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.31325 37.0 37.0 37.0 37.0 37.0 2 36.138 37.0 37.0 37.0 37.0 37.0 3 36.078 37.0 37.0 37.0 37.0 37.0 4 36.2115 37.0 37.0 37.0 37.0 37.0 5 36.1275 37.0 37.0 37.0 37.0 37.0 6 36.1855 37.0 37.0 37.0 37.0 37.0 7 36.1 37.0 37.0 37.0 37.0 37.0 8 36.245 37.0 37.0 37.0 37.0 37.0 9 36.052 37.0 37.0 37.0 37.0 37.0 10-14 36.1728 37.0 37.0 37.0 37.0 37.0 15-19 36.061 37.0 37.0 37.0 37.0 37.0 20-24 36.0569 37.0 37.0 37.0 37.0 37.0 25-29 36.0191 37.0 37.0 37.0 37.0 37.0 30-34 35.9543 37.0 37.0 37.0 37.0 37.0 35-39 35.9411 37.0 37.0 37.0 37.0 37.0 40-44 35.947500000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.8082 37.0 37.0 37.0 37.0 37.0 50-54 35.83919999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.7471 37.0 37.0 37.0 37.0 37.0 60-64 35.86 37.0 37.0 37.0 37.0 37.0 65-69 35.7301 37.0 37.0 37.0 37.0 37.0 70-74 35.76649999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.744699999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.7307 37.0 37.0 37.0 37.0 37.0 85-89 35.732 37.0 37.0 37.0 37.0 37.0 90-94 35.6762 37.0 37.0 37.0 37.0 37.0 95-99 35.611599999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.6043 37.0 37.0 37.0 37.0 37.0 105-109 35.5129 37.0 37.0 37.0 37.0 37.0 110-114 35.3908 37.0 37.0 37.0 37.0 37.0 115-119 35.3981 37.0 37.0 37.0 37.0 37.0 120-124 35.465199999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.3218 37.0 37.0 37.0 37.0 37.0 130-134 35.4043 37.0 37.0 37.0 37.0 37.0 135-139 35.2745 37.0 37.0 37.0 34.6 37.0 140-144 35.283 37.0 37.0 37.0 32.2 37.0 145-149 35.0766 37.0 37.0 37.0 25.0 37.0 150-151 34.650999999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 7.0 15 8.0 16 5.0 17 6.0 18 2.0 19 4.0 20 5.0 21 11.0 22 12.0 23 4.0 24 10.0 25 5.0 26 11.0 27 8.0 28 13.0 29 22.0 30 27.0 31 35.0 32 65.0 33 90.0 34 176.0 35 548.0 36 2655.0 37 265.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.70967741935484 18.6046511627907 10.927731932983246 31.757939484871216 2 30.049999999999997 23.35 24.325 22.275 3 25.624999999999996 23.45 27.05 23.875 4 27.275 30.375000000000004 19.525000000000002 22.825 5 28.025 30.85 18.725 22.400000000000002 6 25.025 33.2 18.125 23.65 7 24.65 18.95 32.125 24.275 8 25.900000000000002 21.675 21.375 31.05 9 24.875 22.400000000000002 24.375 28.349999999999998 10-14 26.63 24.625 21.525 27.22 15-19 27.6 24.165 21.925 26.31 20-24 26.595000000000002 24.495 22.63 26.279999999999998 25-29 26.985 24.12 22.14 26.755000000000003 30-34 26.8 24.23 22.115000000000002 26.855 35-39 27.21 24.54 22.465 25.785000000000004 40-44 27.04 24.435000000000002 22.74 25.785000000000004 45-49 27.375 24.89 22.06 25.674999999999997 50-54 27.485 24.135 22.17 26.21 55-59 27.35 24.740000000000002 21.695 26.215 60-64 27.495000000000005 23.57 22.62 26.314999999999998 65-69 27.224999999999998 24.215 22.045 26.515 70-74 27.3 24.15 22.235 26.314999999999998 75-79 27.544999999999998 24.46 22.220000000000002 25.775 80-84 27.915 23.785 22.31 25.990000000000002 85-89 27.54 24.740000000000002 22.040000000000003 25.679999999999996 90-94 27.224999999999998 24.03 22.564999999999998 26.179999999999996 95-99 27.810000000000002 24.560000000000002 21.765 25.865 100-104 27.72 23.735 22.040000000000003 26.505000000000003 105-109 27.389999999999997 23.94 23.115 25.555 110-114 27.565 23.805 22.35 26.279999999999998 115-119 27.3 24.12 22.625 25.955000000000002 120-124 26.955000000000002 24.09 22.955000000000002 26.0 125-129 27.6 24.325 22.025 26.05 130-134 27.865000000000002 24.025 22.3 25.81 135-139 27.355 24.8 22.425 25.419999999999998 140-144 28.265 24.615000000000002 22.21 24.91 145-149 27.405 24.425 23.015 25.155 150-151 27.925 25.162499999999998 22.325 24.587500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 1.5 19 1.5 20 1.5 21 1.0 22 0.5 23 1.0 24 2.0 25 1.5 26 1.0 27 1.0 28 1.0 29 2.0 30 1.5 31 2.0 32 3.0 33 6.0 34 10.0 35 13.5 36 26.5 37 39.5 38 47.0 39 60.5 40 72.5 41 90.0 42 119.0 43 149.0 44 153.5 45 151.5 46 170.5 47 168.5 48 157.0 49 152.5 50 141.5 51 139.0 52 129.0 53 117.0 54 119.0 55 113.5 56 106.5 57 98.0 58 99.0 59 101.0 60 86.0 61 83.5 62 99.0 63 108.0 64 89.0 65 75.0 66 73.0 67 70.0 68 71.5 69 75.5 70 70.0 71 62.5 72 56.5 73 45.0 74 37.5 75 28.0 76 20.0 77 18.5 78 13.5 79 5.0 80 4.0 81 3.5 82 2.5 83 1.5 84 2.0 85 1.5 86 1.0 87 2.5 88 1.5 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 1.0 96 1.0 97 0.5 98 1.0 99 2.0 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.60902255639097 87.15 2 5.719656283566058 10.65 3 0.5370569280343717 1.5 4 0.10741138560687433 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02685284640171858 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.4875 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.6625000000000001 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 1.0375 0.0 0.0 0.0 0.0 130-131 1.2375 0.0 0.0 0.0 0.0 132-133 1.3125 0.0 0.0 0.0 0.0 134-135 1.4500000000000002 0.0 0.0 0.0 0.0 136-137 1.6125 0.0 0.0 0.0 0.0 138-139 1.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1302548 spots for SRR7804146.sra Written 1302548 spots for SRR7804146.sra Read 1302548 spots for SRR7804146.sra Written 1302548 spots for SRR7804146.sra Read 1302548 spots for SRR7804146.sra Written 1302548 spots for SRR7804146.sra Read 1302548 spots for SRR7804146.sra Written 1302548 spots for SRR7804146.sra Read 1302548 spots for SRR7804146.sra Written 1302548 spots for SRR7804146.sra Read 1302548 spots for SRR7804146.sra Written 1302548 spots for SRR7804146.sra Read 1302551 spots for SRR7804146.sra Written 1302551 spots for SRR7804146.sra Read 1302548 spots for SRR7804146.sra Written 1302548 spots for SRR7804146.sra Read 1302548 spots for SRR7804146.sra Written 1302548 spots for SRR7804146.sra Read 1302548 spots for SRR7804146.sra Written 1302548 spots for SRR7804146.sra Read 1302548 spots for SRR7804146.sra Written 1302548 spots for SRR7804146.sra Read 1302548 spots for SRR7804146.sra Written 1302548 spots for SRR7804146.sra Read 1302548 spots for SRR7804146.sra Written 1302548 spots for SRR7804146.sra Read 1302548 spots for SRR7804146.sra Written 1302548 spots for SRR7804146.sra Read 1302548 spots for SRR7804146.sra Written 1302548 spots for SRR7804146.sra Read 1302548 spots for SRR7804146.sra Written 1302548 spots for SRR7804146.sra Read 1302548 spots for SRR7804146.sra Written 1302548 spots for SRR7804146.sra Read 1302548 spots for SRR7804146.sra Written 1302548 spots for SRR7804146.sra Read 1302548 spots for SRR7804146.sra Written 1302548 spots for SRR7804146.sra Read 1302548 spots for SRR7804146.sra Written 1302548 spots for SRR7804146.sra SRR ids: ['SRR7804146.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5jybsbbf SRR7804146.sra spots: 26050963 blocks: [[1, 1302548], [1302549, 2605096], [2605097, 3907644], [3907645, 5210192], [5210193, 6512740], [6512741, 7815288], [7815289, 9117836], [9117837, 10420384], [10420385, 11722932], [11722933, 13025480], [13025481, 14328028], [14328029, 15630576], [15630577, 16933124], [16933125, 18235672], [18235673, 19538220], [19538221, 20840768], [20840769, 22143316], [22143317, 23445864], [23445865, 24748412], [24748413, 26050963]] SRR7804146 file size 8806116 SRR7804146 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804146 SRR7804146_1.fastq SRR7804146_2.fastq Input file: SRR7804146_1.fastq Paired file: SRR7804146_2.fastq trimmed: SRR7804146-trimmed-pair1.fastq, SRR7804146-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:47:45 2024 >> started Tue Dec 10 02:48:21 2024 >> done (35.962s) 26050963 read pairs processed; of these: 65 ( 0.00%) short read pairs filtered out after trimming by size control 244 ( 0.00%) empty read pairs filtered out after trimming by size control 26050654 (100.00%) read pairs available; of these: 757849 ( 2.91%) trimmed read pairs available after processing 25292805 (97.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 12 0.00% 21 7 0.00% 22 15 0.00% 23 15 0.00% 24 14 0.00% 25 18 0.00% 26 12 0.00% 27 13 0.00% 28 12 0.00% 29 21 0.00% 30 20 0.00% 31 16 0.00% 32 24 0.00% 33 17 0.00% 34 16 0.00% 35 30 0.00% 36 28 0.00% 37 23 0.00% 38 28 0.00% 39 33 0.00% 40 27 0.00% 41 23 0.00% 42 22 0.00% 43 39 0.00% 44 40 0.00% 45 30 0.00% 46 35 0.00% 47 34 0.00% 48 36 0.00% 49 50 0.00% 50 33 0.00% 51 32 0.00% 52 41 0.00% 53 45 0.00% 54 41 0.00% 55 42 0.00% 56 35 0.00% 57 36 0.00% 58 59 0.00% 59 64 0.00% 60 55 0.00% 61 57 0.00% 62 66 0.00% 63 53 0.00% 64 62 0.00% 65 80 0.00% 66 54 0.00% 67 73 0.00% 68 85 0.00% 69 90 0.00% 70 77 0.00% 71 101 0.00% 72 132 0.00% 73 122 0.00% 74 145 0.00% 75 142 0.00% 76 130 0.00% 77 198 0.00% 78 199 0.00% 79 216 0.00% 80 258 0.00% 81 304 0.00% 82 335 0.00% 83 429 0.00% 84 432 0.00% 85 503 0.00% 86 568 0.00% 87 591 0.00% 88 617 0.00% 89 706 0.00% 90 798 0.00% 91 927 0.00% 92 1055 0.00% 93 1197 0.00% 94 1330 0.01% 95 1463 0.01% 96 1564 0.01% 97 1710 0.01% 98 1878 0.01% 99 2036 0.01% 100 2236 0.01% 101 2328 0.01% 102 2623 0.01% 103 2913 0.01% 104 3234 0.01% 105 3517 0.01% 106 3721 0.01% 107 3975 0.02% 108 4176 0.02% 109 4576 0.02% 110 4819 0.02% 111 5246 0.02% 112 5781 0.02% 113 6012 0.02% 114 6694 0.03% 115 7254 0.03% 116 7381 0.03% 117 7613 0.03% 118 7983 0.03% 119 8420 0.03% 120 8800 0.03% 121 9467 0.04% 122 10231 0.04% 123 11273 0.04% 124 11674 0.04% 125 12519 0.05% 126 13045 0.05% 127 13668 0.05% 128 14005 0.05% 129 14594 0.06% 130 15355 0.06% 131 15711 0.06% 132 16707 0.06% 133 17935 0.07% 134 18887 0.07% 135 20175 0.08% 136 21031 0.08% 137 21661 0.08% 138 22113 0.08% 139 23139 0.09% 140 23197 0.09% 141 24479 0.09% 142 26106 0.10% 143 26993 0.10% 144 28527 0.11% 145 30065 0.12% 146 30955 0.12% 147 32045 0.12% 148 32913 0.13% 149 33212 0.13% 150 34876 0.13% 151 25292805 97.09% 26050654 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=21 prefix-density=0.75 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=200.59 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=14.9 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCA criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=4.04 fanout-score-rank=16 prefix-density=0.61 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.17 sequence-density-rank=20 fanout-score=139.41 fanout-score-rank=1 prefix-density=1.13 prefix-fanout=20.6 sequence=CGCCGCCGCCGC SRR7804146 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:49:14 Started mapping on | Dec 10 02:49:14 Finished on | Dec 10 02:51:59 Mapping speed, Million of reads per hour | 568.38 Number of input reads | 26050654 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 23993472 Uniquely mapped reads % | 92.10% Average mapped length | 299.80 Number of splices: Total | 24729849 Number of splices: Annotated (sjdb) | 23345512 Number of splices: GT/AG | 24374695 Number of splices: GC/AG | 289107 Number of splices: AT/AC | 14225 Number of splices: Non-canonical | 51822 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 3.25 Insertion rate per base | 0.02% Insertion average length | 2.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 421658 % of reads mapped to multiple loci | 1.62% Number of reads mapped to too many loci | 48823 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.62% % of reads unmapped: other | 1.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1635524 1635524 1635524 N_multimapping 421658 421658 421658 N_noFeature 669236 23394788 816886 N_ambiguous 558791 4041 108096 UnstrandedReadsAssigned:22765445 PositiveStrandReadsAssigned:594643 NegativeStrandReadsAssigned:23068490 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804146 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804146-trimmed-pair1.fastq SRR7804146-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,050,654 reads, 23,422,174 reads pseudoaligned [quant] estimated average fragment length: 294.761 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,189 rounds 52973 SRR7804146.ke.tsv 35125 SRR7804146.se.tsv 88098 total ==> SRR7804146.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 642.774 0 0 PNS24247 1044 750.239 103.811 7.41279 PNS24249 1928 1634.24 235.311 7.71371 PNS24246 1044 750.239 103.811 7.41279 PNS24248 1044 750.239 103.811 7.41279 PNS24244 1471 1177.24 60.2554 2.74201 PNS24243 293 73.9966 0 0 KQK14069 1603 1309.24 14048.5 574.842 KQK14071 474 204.34 205.81 53.9573 ==> SRR7804146.se.tsv <== BRADI_1g14170v3 14900 BRADI_1g53295v3 1090 BRADI_1g59795v3 268 BRADI_1g07683v3 0 BRADI_1g00485v3 67 BRADI_1g20270v3 3837 BRADI_1g74790v3 452 BRADI_1g09890v3 33 BRADI_1g77505v3 381 BRADI_1g48960v3 0 SRR7804146 completed mapping pipeline successfully