Starting /dee2/code/volunteer_pipeline.sh SRR7804147 current disk space = 1525156139008 free memory = 1563309300 SRR7804147 SRAfilesize f30c1ced9fc64dd01004673f16caea90 SRR7804147.sra SRR7804147.sra file validated SRR7804147 is paired end SRR7804147 is conventional basespace SRR7804147 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804147_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.195 37.0 37.0 37.0 37.0 37.0 2 36.20825 37.0 37.0 37.0 37.0 37.0 3 36.3705 37.0 37.0 37.0 37.0 37.0 4 36.471 37.0 37.0 37.0 37.0 37.0 5 36.43 37.0 37.0 37.0 37.0 37.0 6 36.4455 37.0 37.0 37.0 37.0 37.0 7 36.382 37.0 37.0 37.0 37.0 37.0 8 36.426 37.0 37.0 37.0 37.0 37.0 9 36.511 37.0 37.0 37.0 37.0 37.0 10-14 36.504599999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.441100000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.477999999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.435500000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.3914 37.0 37.0 37.0 37.0 37.0 35-39 36.3875 37.0 37.0 37.0 37.0 37.0 40-44 36.4072 37.0 37.0 37.0 37.0 37.0 45-49 36.351200000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.351299999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.307300000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.3013 37.0 37.0 37.0 37.0 37.0 65-69 36.244 37.0 37.0 37.0 37.0 37.0 70-74 36.2081 37.0 37.0 37.0 37.0 37.0 75-79 36.215700000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.161500000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.1351 37.0 37.0 37.0 37.0 37.0 90-94 36.130700000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.0645 37.0 37.0 37.0 37.0 37.0 100-104 36.1369 37.0 37.0 37.0 37.0 37.0 105-109 36.041000000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.9938 37.0 37.0 37.0 37.0 37.0 115-119 36.037699999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.9332 37.0 37.0 37.0 37.0 37.0 125-129 35.8455 37.0 37.0 37.0 37.0 37.0 130-134 35.814099999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.7467 37.0 37.0 37.0 37.0 37.0 140-144 35.6844 37.0 37.0 37.0 37.0 37.0 145-149 35.7355 37.0 37.0 37.0 37.0 37.0 150-151 35.095 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 2.0 24 1.0 25 5.0 26 6.0 27 12.0 28 8.0 29 18.0 30 36.0 31 51.0 32 65.0 33 79.0 34 155.0 35 304.0 36 2824.0 37 431.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.025 12.425 8.375 32.175 2 27.38184546136534 13.80345086271568 31.032758189547387 27.781945486371594 3 23.825 19.35 25.45 31.374999999999996 4 26.875 26.150000000000002 21.7 25.275 5 26.575 29.825000000000003 21.425 22.175 6 25.25 30.599999999999998 21.75 22.400000000000002 7 18.575 22.175 37.075 22.175 8 22.45 22.45 26.05 29.049999999999997 9 21.375 20.025000000000002 31.25 27.35 10-14 24.825 24.085 23.82 27.27 15-19 24.695 24.205 24.02 27.08 20-24 24.5 24.125 23.915 27.46 25-29 24.65 24.425 23.895 27.029999999999998 30-34 24.72 24.075 23.95 27.255000000000003 35-39 24.25 23.745 24.404999999999998 27.6 40-44 24.83 23.815 23.865 27.49 45-49 25.595000000000002 23.405 23.685000000000002 27.315 50-54 24.765 24.08 23.61 27.544999999999998 55-59 25.36 23.585 23.855 27.200000000000003 60-64 25.775 24.295 22.99 26.939999999999998 65-69 25.119999999999997 23.165 23.935000000000002 27.779999999999998 70-74 25.945 23.135 23.575 27.345000000000002 75-79 25.5 23.75 23.865 26.884999999999998 80-84 25.585 23.925 23.13 27.36 85-89 25.83 23.200000000000003 24.060000000000002 26.91 90-94 25.779999999999998 23.244999999999997 23.865 27.11 95-99 25.564999999999998 22.919999999999998 24.12 27.395000000000003 100-104 25.795 23.400000000000002 23.599999999999998 27.205000000000002 105-109 25.22 23.425 23.555 27.800000000000004 110-114 25.814999999999998 23.085 23.745 27.355 115-119 25.650000000000002 22.939999999999998 23.325000000000003 28.084999999999997 120-124 26.345000000000002 23.064999999999998 23.65 26.939999999999998 125-129 26.095000000000002 23.285 23.605 27.015 130-134 25.97 22.66 23.535 27.834999999999997 135-139 26.13 23.400000000000002 22.869999999999997 27.6 140-144 26.31 22.735 23.849999999999998 27.105 145-149 25.735000000000003 23.105 23.369999999999997 27.79 150-151 27.1 22.1375 23.625 27.1375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.0 25 2.0 26 1.0 27 1.5 28 2.5 29 3.5 30 6.5 31 8.5 32 10.5 33 9.5 34 14.5 35 24.5 36 37.5 37 47.5 38 70.0 39 88.0 40 89.0 41 102.0 42 114.5 43 134.5 44 142.5 45 148.5 46 164.5 47 166.0 48 166.5 49 150.5 50 145.5 51 146.5 52 128.5 53 112.5 54 101.5 55 107.0 56 97.0 57 88.0 58 99.0 59 103.5 60 105.5 61 105.5 62 95.5 63 85.5 64 80.5 65 88.5 66 93.0 67 82.0 68 69.5 69 64.5 70 65.5 71 51.5 72 39.5 73 30.5 74 25.0 75 22.5 76 18.5 77 13.5 78 4.5 79 5.5 80 7.0 81 3.5 82 1.0 83 1.0 84 1.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.25 #Duplication Level Percentage of deduplicated Percentage of total 1 92.33062330623306 85.175 2 7.018970189701896 12.950000000000001 3 0.5691056910569106 1.575 4 0.08130081300813008 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.8375 0.0 0.0 0.0 0.0 124-125 0.875 0.0 0.0 0.0 0.0 126-127 0.9624999999999999 0.0 0.0 0.0 0.0 128-129 1.0875 0.0 0.0 0.0 0.0 130-131 1.1875 0.0 0.0 0.0 0.0 132-133 1.35 0.0 0.0 0.0 0.0 134-135 1.4625 0.0 0.0 0.0 0.0 136-137 1.6625 0.0 0.0 0.0 0.0 138-139 1.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804147 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804147_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.302 37.0 37.0 37.0 37.0 37.0 2 35.9505 37.0 37.0 37.0 37.0 37.0 3 36.06 37.0 37.0 37.0 37.0 37.0 4 36.1025 37.0 37.0 37.0 37.0 37.0 5 36.021 37.0 37.0 37.0 37.0 37.0 6 36.045 37.0 37.0 37.0 37.0 37.0 7 35.906 37.0 37.0 37.0 37.0 37.0 8 36.053 37.0 37.0 37.0 37.0 37.0 9 35.965 37.0 37.0 37.0 37.0 37.0 10-14 36.0284 37.0 37.0 37.0 37.0 37.0 15-19 35.937099999999994 37.0 37.0 37.0 37.0 37.0 20-24 35.9181 37.0 37.0 37.0 37.0 37.0 25-29 35.8755 37.0 37.0 37.0 37.0 37.0 30-34 35.833600000000004 37.0 37.0 37.0 37.0 37.0 35-39 35.819300000000005 37.0 37.0 37.0 37.0 37.0 40-44 35.776399999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.768299999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.768899999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.634299999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.6751 37.0 37.0 37.0 37.0 37.0 65-69 35.6211 37.0 37.0 37.0 37.0 37.0 70-74 35.6398 37.0 37.0 37.0 37.0 37.0 75-79 35.5754 37.0 37.0 37.0 37.0 37.0 80-84 35.5726 37.0 37.0 37.0 37.0 37.0 85-89 35.5536 37.0 37.0 37.0 37.0 37.0 90-94 35.48440000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.4987 37.0 37.0 37.0 37.0 37.0 100-104 35.540800000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.3458 37.0 37.0 37.0 37.0 37.0 110-114 35.3051 37.0 37.0 37.0 37.0 37.0 115-119 35.3084 37.0 37.0 37.0 37.0 37.0 120-124 35.298500000000004 37.0 37.0 37.0 34.6 37.0 125-129 35.239999999999995 37.0 37.0 37.0 32.2 37.0 130-134 35.2638 37.0 37.0 37.0 37.0 37.0 135-139 35.1859 37.0 37.0 37.0 32.2 37.0 140-144 35.1922 37.0 37.0 37.0 32.2 37.0 145-149 34.9463 37.0 37.0 37.0 25.0 37.0 150-151 34.543 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 8.0 14 15.0 15 8.0 16 5.0 17 3.0 18 6.0 19 4.0 20 6.0 21 6.0 22 11.0 23 12.0 24 19.0 25 14.0 26 8.0 27 15.0 28 16.0 29 17.0 30 24.0 31 54.0 32 58.0 33 70.0 34 192.0 35 491.0 36 2645.0 37 290.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.175 17.925 9.575 27.325 2 31.125000000000004 22.875 23.3 22.7 3 26.674999999999997 24.525 23.799999999999997 25.0 4 27.750000000000004 29.25 18.625 24.375 5 28.925 31.15 17.75 22.175 6 26.700000000000003 32.15 17.474999999999998 23.674999999999997 7 25.75 18.95 28.999999999999996 26.3 8 25.374999999999996 22.925 20.674999999999997 31.025000000000002 9 25.5 21.099999999999998 24.55 28.849999999999998 10-14 27.584999999999997 24.36 20.755000000000003 27.3 15-19 28.050000000000004 23.419999999999998 21.47 27.060000000000002 20-24 26.775 24.21 21.97 27.045 25-29 27.57 23.695 21.099999999999998 27.634999999999998 30-34 27.295 24.025 21.625 27.055 35-39 27.12 24.279999999999998 21.42 27.18 40-44 27.605 23.585 21.7 27.11 45-49 27.29 23.455000000000002 21.75 27.505000000000003 50-54 27.51 23.91 21.9 26.68 55-59 28.04 24.445 21.455 26.06 60-64 27.744999999999997 23.985 21.285 26.985 65-69 27.35 23.57 21.95 27.13 70-74 27.62 24.215 21.485000000000003 26.68 75-79 27.145000000000003 24.075 22.21 26.57 80-84 27.54 23.71 21.55 27.200000000000003 85-89 27.91 23.98 21.65 26.46 90-94 27.1 24.355 21.990000000000002 26.555 95-99 27.685 23.674999999999997 21.775 26.865 100-104 27.55 24.02 21.92 26.51 105-109 27.83 24.175 21.64 26.355 110-114 27.83 23.705000000000002 22.220000000000002 26.245 115-119 27.22 24.58 22.125 26.075 120-124 28.27 23.825 21.9 26.005 125-129 27.985 24.645 21.66 25.71 130-134 28.465 24.315 22.040000000000003 25.180000000000003 135-139 27.85 24.240000000000002 22.28 25.629999999999995 140-144 28.21 24.43 22.405 24.955 145-149 28.365000000000002 24.610000000000003 22.015 25.009999999999998 150-151 28.037499999999998 25.112499999999997 21.4125 25.4375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 1.5 9 1.0 10 0.0 11 0.5 12 2.0 13 3.0 14 2.5 15 2.0 16 1.0 17 1.0 18 1.0 19 1.0 20 2.0 21 1.5 22 0.5 23 1.5 24 2.0 25 1.5 26 2.0 27 2.0 28 2.5 29 3.5 30 4.0 31 8.0 32 8.0 33 4.5 34 10.5 35 21.0 36 27.5 37 33.0 38 39.5 39 50.5 40 69.0 41 83.0 42 102.0 43 115.0 44 128.5 45 133.0 46 144.0 47 155.5 48 145.5 49 131.0 50 124.0 51 119.5 52 115.0 53 112.5 54 109.0 55 109.0 56 99.5 57 97.0 58 104.0 59 104.0 60 105.0 61 116.5 62 125.0 63 119.5 64 110.5 65 95.0 66 90.0 67 88.0 68 85.5 69 88.0 70 69.0 71 60.5 72 60.0 73 60.5 74 53.0 75 34.0 76 21.5 77 15.0 78 12.5 79 9.5 80 5.5 81 3.0 82 1.5 83 1.5 84 1.5 85 1.0 86 0.5 87 1.0 88 0.5 89 1.0 90 1.5 91 1.0 92 0.5 93 0.5 94 0.5 95 2.0 96 2.5 97 1.5 98 1.5 99 1.0 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.85 #Duplication Level Percentage of deduplicated Percentage of total 1 92.2427871529668 84.725 2 7.103973870440937 13.05 3 0.5171475231355471 1.425 4 0.08165487207403374 0.3 5 0.027218290691344585 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027218290691344585 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 15 0.375 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 0.85 0.0 0.0 0.0 0.0 126-127 0.9375 0.0 0.0 0.0 0.0 128-129 1.0625 0.0 0.0 0.0 0.0 130-131 1.1625 0.0 0.0 0.0 0.0 132-133 1.325 0.0 0.0 0.0 0.0 134-135 1.4500000000000002 0.0 0.0 0.0 0.0 136-137 1.6625 0.0 0.025 0.0 0.0 138-139 1.8875 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1197863 spots for SRR7804147.sra Written 1197863 spots for SRR7804147.sra Read 1197863 spots for SRR7804147.sra Written 1197863 spots for SRR7804147.sra Read 1197863 spots for SRR7804147.sra Written 1197863 spots for SRR7804147.sra Read 1197863 spots for SRR7804147.sra Written 1197863 spots for SRR7804147.sra Read 1197863 spots for SRR7804147.sra Written 1197863 spots for SRR7804147.sra Read 1197863 spots for SRR7804147.sra Written 1197863 spots for SRR7804147.sra Read 1197863 spots for SRR7804147.sra Written 1197863 spots for SRR7804147.sra Read 1197863 spots for SRR7804147.sra Written 1197863 spots for SRR7804147.sra Read 1197863 spots for SRR7804147.sra Written 1197863 spots for SRR7804147.sra Read 1197863 spots for SRR7804147.sra Written 1197863 spots for SRR7804147.sra Read 1197863 spots for SRR7804147.sra Written 1197863 spots for SRR7804147.sra Read 1197863 spots for SRR7804147.sra Written 1197863 spots for SRR7804147.sra Read 1197863 spots for SRR7804147.sra Written 1197863 spots for SRR7804147.sra Read 1197863 spots for SRR7804147.sra Written 1197863 spots for SRR7804147.sra Read 1197863 spots for SRR7804147.sra Written 1197863 spots for SRR7804147.sra Read 1197874 spots for SRR7804147.sra Written 1197874 spots for SRR7804147.sra Read 1197863 spots for SRR7804147.sra Written 1197863 spots for SRR7804147.sra Read 1197863 spots for SRR7804147.sra Written 1197863 spots for SRR7804147.sra Read 1197863 spots for SRR7804147.sra Written 1197863 spots for SRR7804147.sra Read 1197863 spots for SRR7804147.sra Written 1197863 spots for SRR7804147.sra SRR ids: ['SRR7804147.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y45v7il2 SRR7804147.sra spots: 23957271 blocks: [[1, 1197863], [1197864, 2395726], [2395727, 3593589], [3593590, 4791452], [4791453, 5989315], [5989316, 7187178], [7187179, 8385041], [8385042, 9582904], [9582905, 10780767], [10780768, 11978630], [11978631, 13176493], [13176494, 14374356], [14374357, 15572219], [15572220, 16770082], [16770083, 17967945], [17967946, 19165808], [19165809, 20363671], [20363672, 21561534], [21561535, 22759397], [22759398, 23957271]] SRR7804147 file size 8096632 SRR7804147 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804147 SRR7804147_1.fastq SRR7804147_2.fastq Input file: SRR7804147_1.fastq Paired file: SRR7804147_2.fastq trimmed: SRR7804147-trimmed-pair1.fastq, SRR7804147-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:47:15 2024 >> started Tue Dec 10 02:48:50 2024 >> done (95.170s) 23957271 read pairs processed; of these: 89 ( 0.00%) short read pairs filtered out after trimming by size control 901 ( 0.00%) empty read pairs filtered out after trimming by size control 23956281 (100.00%) read pairs available; of these: 791512 ( 3.30%) trimmed read pairs available after processing 23164769 (96.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 10 0.00% 21 6 0.00% 22 18 0.00% 23 25 0.00% 24 12 0.00% 25 15 0.00% 26 19 0.00% 27 20 0.00% 28 17 0.00% 29 17 0.00% 30 17 0.00% 31 29 0.00% 32 36 0.00% 33 23 0.00% 34 23 0.00% 35 39 0.00% 36 30 0.00% 37 36 0.00% 38 42 0.00% 39 36 0.00% 40 33 0.00% 41 38 0.00% 42 36 0.00% 43 38 0.00% 44 29 0.00% 45 49 0.00% 46 45 0.00% 47 42 0.00% 48 39 0.00% 49 39 0.00% 50 39 0.00% 51 38 0.00% 52 42 0.00% 53 56 0.00% 54 64 0.00% 55 46 0.00% 56 41 0.00% 57 57 0.00% 58 63 0.00% 59 71 0.00% 60 69 0.00% 61 68 0.00% 62 101 0.00% 63 76 0.00% 64 88 0.00% 65 81 0.00% 66 114 0.00% 67 99 0.00% 68 112 0.00% 69 130 0.00% 70 134 0.00% 71 165 0.00% 72 174 0.00% 73 211 0.00% 74 206 0.00% 75 229 0.00% 76 258 0.00% 77 273 0.00% 78 315 0.00% 79 314 0.00% 80 383 0.00% 81 454 0.00% 82 481 0.00% 83 591 0.00% 84 645 0.00% 85 654 0.00% 86 768 0.00% 87 869 0.00% 88 949 0.00% 89 917 0.00% 90 1117 0.00% 91 1255 0.01% 92 1492 0.01% 93 1603 0.01% 94 1745 0.01% 95 1925 0.01% 96 2002 0.01% 97 2283 0.01% 98 2270 0.01% 99 2541 0.01% 100 2685 0.01% 101 2896 0.01% 102 3394 0.01% 103 3653 0.02% 104 4167 0.02% 105 4243 0.02% 106 4495 0.02% 107 4667 0.02% 108 4865 0.02% 109 5374 0.02% 110 5479 0.02% 111 5840 0.02% 112 6554 0.03% 113 7212 0.03% 114 7674 0.03% 115 8094 0.03% 116 8585 0.04% 117 8662 0.04% 118 8910 0.04% 119 9279 0.04% 120 9869 0.04% 121 10328 0.04% 122 10813 0.05% 123 11768 0.05% 124 12727 0.05% 125 13414 0.06% 126 14033 0.06% 127 14401 0.06% 128 14404 0.06% 129 15119 0.06% 130 15526 0.06% 131 16352 0.07% 132 17439 0.07% 133 18565 0.08% 134 19577 0.08% 135 20603 0.09% 136 21509 0.09% 137 22173 0.09% 138 22293 0.09% 139 23112 0.10% 140 23558 0.10% 141 24640 0.10% 142 25471 0.11% 143 26885 0.11% 144 28678 0.12% 145 30159 0.13% 146 31092 0.13% 147 31735 0.13% 148 32538 0.14% 149 32467 0.14% 150 33991 0.14% 151 23164769 96.70% 23956281 reads passed initial QC criterion=sequence-density sequence-density=1.00 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=24 prefix-density=1.04 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.18 sequence-density-rank=26 fanout-score=15.10 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=4.6 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=33 prefix-density=0.78 prefix-fanout=2.0 sequence=ATCCGCTCCAAGTGGGTTCCTTGCCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=63.50 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.2 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804147 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:49:48 Started mapping on | Dec 10 02:49:48 Finished on | Dec 10 02:54:10 Mapping speed, Million of reads per hour | 329.17 Number of input reads | 23956281 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 21695897 Uniquely mapped reads % | 90.56% Average mapped length | 299.42 Number of splices: Total | 21574904 Number of splices: Annotated (sjdb) | 20438067 Number of splices: GT/AG | 21276407 Number of splices: GC/AG | 240478 Number of splices: AT/AC | 7778 Number of splices: Non-canonical | 50241 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 316813 % of reads mapped to multiple loci | 1.32% Number of reads mapped to too many loci | 21655 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.28% % of reads unmapped: other | 0.74% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1943571 1943571 1943571 N_multimapping 316813 316813 316813 N_noFeature 608815 21038748 827028 N_ambiguous 548903 3836 110119 UnstrandedReadsAssigned:20538179 PositiveStrandReadsAssigned:653313 NegativeStrandReadsAssigned:20758750 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804147 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804147-trimmed-pair1.fastq SRR7804147-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,956,281 reads, 21,134,549 reads pseudoaligned [quant] estimated average fragment length: 293.185 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,128 rounds 52973 SRR7804147.ke.tsv 35125 SRR7804147.se.tsv 88098 total ==> SRR7804147.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 644.423 0 0 PNS24247 1044 751.815 98.0484 7.47315 PNS24249 1928 1635.81 175.115 6.13427 PNS24246 1044 751.815 98.0484 7.47315 PNS24248 1044 751.815 98.0484 7.47315 PNS24244 1471 1178.81 119.74 5.82058 PNS24243 293 76.2051 0 0 KQK14069 1603 1310.81 6570.78 287.243 KQK14071 474 207.284 191.419 52.9166 ==> SRR7804147.se.tsv <== BRADI_1g14170v3 7238 BRADI_1g53295v3 2660 BRADI_1g59795v3 498 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 640 BRADI_1g74790v3 1445 BRADI_1g09890v3 4 BRADI_1g77505v3 231 BRADI_1g48960v3 0 SRR7804147 completed mapping pipeline successfully