Starting /dee2/code/volunteer_pipeline.sh SRR7804148 current disk space = 1525151432704 free memory = 1408333452 SRR7804148 SRAfilesize 43dfb9f99a95f2747a2fe0134ec76f9d SRR7804148.sra SRR7804148.sra file validated SRR7804148 is paired end SRR7804148 is conventional basespace SRR7804148 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804148_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2115 37.0 37.0 37.0 37.0 37.0 2 36.24675 37.0 37.0 37.0 37.0 37.0 3 36.424 37.0 37.0 37.0 37.0 37.0 4 36.484 37.0 37.0 37.0 37.0 37.0 5 36.492 37.0 37.0 37.0 37.0 37.0 6 36.4085 37.0 37.0 37.0 37.0 37.0 7 36.42 37.0 37.0 37.0 37.0 37.0 8 36.4795 37.0 37.0 37.0 37.0 37.0 9 36.375 37.0 37.0 37.0 37.0 37.0 10-14 36.4749 37.0 37.0 37.0 37.0 37.0 15-19 36.4448 37.0 37.0 37.0 37.0 37.0 20-24 36.4489 37.0 37.0 37.0 37.0 37.0 25-29 36.400400000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.38250000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.3842 37.0 37.0 37.0 37.0 37.0 40-44 36.3861 37.0 37.0 37.0 37.0 37.0 45-49 36.3625 37.0 37.0 37.0 37.0 37.0 50-54 36.359899999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.349700000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.31230000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.286500000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.232000000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.2175 37.0 37.0 37.0 37.0 37.0 80-84 36.17379999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.2108 37.0 37.0 37.0 37.0 37.0 90-94 36.117000000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.078199999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.0866 37.0 37.0 37.0 37.0 37.0 105-109 36.0539 37.0 37.0 37.0 37.0 37.0 110-114 36.035199999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.0235 37.0 37.0 37.0 37.0 37.0 120-124 35.9668 37.0 37.0 37.0 37.0 37.0 125-129 35.831100000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.8371 37.0 37.0 37.0 37.0 37.0 135-139 35.80740000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.76800000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.731300000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.254000000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 2.0 26 10.0 27 6.0 28 20.0 29 23.0 30 29.0 31 43.0 32 51.0 33 87.0 34 149.0 35 375.0 36 2764.0 37 438.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.4 11.725 8.6 34.275 2 26.481620405101275 12.80320080020005 29.68242060515129 31.032758189547387 3 23.625 17.175 24.575 34.625 4 26.724999999999998 22.375 22.45 28.449999999999996 5 27.0 26.424999999999997 22.675 23.9 6 24.65 29.875 22.15 23.325000000000003 7 19.25 22.775000000000002 38.15 19.825 8 21.925 22.025 26.825 29.225 9 20.25 20.525 31.95 27.275 10-14 24.375 24.75 24.675 26.200000000000003 15-19 24.765 23.745 25.3 26.19 20-24 24.63 23.385 24.83 27.155 25-29 24.38 24.09 24.240000000000002 27.29 30-34 24.47 23.7 24.785 27.045 35-39 24.224999999999998 23.57 25.180000000000003 27.025 40-44 24.63 23.630000000000003 24.63 27.11 45-49 24.58 23.474999999999998 24.54 27.405 50-54 24.605 23.62 24.245 27.529999999999998 55-59 25.165 23.830000000000002 24.18 26.825 60-64 25.319999999999997 23.5 24.099999999999998 27.08 65-69 24.97 23.06 24.275 27.694999999999997 70-74 25.264999999999997 23.125 24.735 26.875 75-79 25.0 23.0 24.34 27.66 80-84 25.045 23.380000000000003 24.21 27.365000000000002 85-89 24.935 22.564999999999998 24.415 28.084999999999997 90-94 25.89 23.205000000000002 23.810000000000002 27.095000000000002 95-99 24.87 22.900000000000002 24.13 28.1 100-104 25.525 22.445 24.05 27.98 105-109 25.330000000000002 23.225 23.669999999999998 27.775 110-114 25.605 23.275000000000002 24.11 27.01 115-119 25.745 23.015 23.75 27.49 120-124 25.53 22.935 23.645 27.889999999999997 125-129 25.53 23.225 23.794999999999998 27.450000000000003 130-134 25.445 22.835 23.64 28.08 135-139 26.275 23.080000000000002 23.825 26.82 140-144 26.005 22.770000000000003 23.990000000000002 27.235 145-149 25.52 22.75 23.580000000000002 28.15 150-151 26.174999999999997 22.35 24.1375 27.3375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 0.5 25 0.5 26 1.0 27 1.5 28 2.5 29 2.5 30 3.0 31 14.0 32 19.5 33 19.5 34 24.0 35 25.0 36 31.5 37 43.0 38 53.5 39 68.5 40 83.5 41 98.5 42 121.5 43 140.5 44 149.5 45 145.5 46 140.5 47 150.5 48 150.0 49 153.5 50 155.0 51 143.0 52 139.0 53 120.0 54 130.0 55 158.0 56 146.0 57 120.5 58 118.0 59 116.0 60 100.5 61 92.0 62 76.0 63 70.5 64 84.0 65 76.0 66 68.5 67 76.0 68 67.5 69 52.5 70 42.5 71 37.5 72 35.5 73 32.5 74 27.5 75 20.0 76 14.5 77 10.0 78 5.5 79 5.5 80 4.5 81 2.0 82 3.0 83 3.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.825 #Duplication Level Percentage of deduplicated Percentage of total 1 92.07732099101553 84.55 2 7.051456575006807 12.950000000000001 3 0.7623196297304655 2.1 4 0.10890280424720937 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.6625000000000001 0.0 0.0 0.0 0.0 116-117 0.725 0.0 0.0 0.0 0.0 118-119 0.75 0.0 0.0 0.0 0.0 120-121 0.8125 0.0 0.0 0.0 0.0 122-123 0.875 0.0 0.0 0.0 0.0 124-125 0.95 0.0 0.0 0.0 0.0 126-127 0.95 0.0 0.0 0.0 0.0 128-129 1.025 0.0 0.0 0.0 0.0 130-131 1.1875 0.0 0.0 0.0 0.0 132-133 1.2875 0.0 0.0 0.0 0.0 134-135 1.4125 0.0 0.0 0.0 0.0 136-137 1.6375 0.0 0.0 0.0 0.0 138-139 1.8250000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACAAA 10 0.006830828 145.0 8 TCATATT 10 0.006830828 145.0 2 >>END_MODULE SRR7804148 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804148_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.33 37.0 37.0 37.0 37.0 37.0 2 36.131 37.0 37.0 37.0 37.0 37.0 3 36.212 37.0 37.0 37.0 37.0 37.0 4 36.301 37.0 37.0 37.0 37.0 37.0 5 36.183 37.0 37.0 37.0 37.0 37.0 6 36.2555 37.0 37.0 37.0 37.0 37.0 7 36.177 37.0 37.0 37.0 37.0 37.0 8 36.2495 37.0 37.0 37.0 37.0 37.0 9 36.161 37.0 37.0 37.0 37.0 37.0 10-14 36.1967 37.0 37.0 37.0 37.0 37.0 15-19 36.131899999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.1352 37.0 37.0 37.0 37.0 37.0 25-29 36.133799999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.0747 37.0 37.0 37.0 37.0 37.0 35-39 36.084999999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.031400000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.9469 37.0 37.0 37.0 37.0 37.0 50-54 35.9321 37.0 37.0 37.0 37.0 37.0 55-59 35.9005 37.0 37.0 37.0 37.0 37.0 60-64 35.978899999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.8294 37.0 37.0 37.0 37.0 37.0 70-74 35.8677 37.0 37.0 37.0 37.0 37.0 75-79 35.8589 37.0 37.0 37.0 37.0 37.0 80-84 35.8651 37.0 37.0 37.0 37.0 37.0 85-89 35.8473 37.0 37.0 37.0 37.0 37.0 90-94 35.7946 37.0 37.0 37.0 37.0 37.0 95-99 35.762 37.0 37.0 37.0 37.0 37.0 100-104 35.7705 37.0 37.0 37.0 37.0 37.0 105-109 35.7207 37.0 37.0 37.0 37.0 37.0 110-114 35.5676 37.0 37.0 37.0 37.0 37.0 115-119 35.5976 37.0 37.0 37.0 37.0 37.0 120-124 35.548899999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.453599999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.5205 37.0 37.0 37.0 37.0 37.0 135-139 35.4589 37.0 37.0 37.0 37.0 37.0 140-144 35.41760000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.1731 37.0 37.0 37.0 29.8 37.0 150-151 34.785250000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 8.0 14 4.0 15 4.0 16 6.0 17 2.0 18 3.0 19 2.0 20 5.0 21 5.0 22 4.0 23 8.0 24 6.0 25 11.0 26 11.0 27 10.0 28 9.0 29 14.0 30 26.0 31 35.0 32 53.0 33 93.0 34 183.0 35 518.0 36 2667.0 37 312.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.5 18.4 10.8 30.3 2 31.75 22.15 22.15 23.95 3 26.6 24.95 24.4 24.05 4 28.7 30.7 17.7 22.900000000000002 5 29.65 29.975 17.599999999999998 22.775000000000002 6 27.325 32.375 17.825 22.475 7 24.725 21.125 30.65 23.5 8 25.775 21.8 21.224999999999998 31.2 9 26.0 22.1 23.95 27.950000000000003 10-14 27.825 24.845 20.995 26.334999999999997 15-19 27.405 24.279999999999998 22.830000000000002 25.485000000000003 20-24 27.47 24.404999999999998 22.025 26.1 25-29 27.73 24.075 21.884999999999998 26.31 30-34 27.73 23.965 22.465 25.840000000000003 35-39 27.425 24.23 22.06 26.284999999999997 40-44 28.075 24.3 22.06 25.564999999999998 45-49 27.435 24.91 21.69 25.965 50-54 27.224999999999998 24.39 22.035 26.35 55-59 27.66 24.12 21.935 26.284999999999997 60-64 27.32 24.355 21.855 26.47 65-69 27.62 24.279999999999998 21.605 26.495 70-74 27.865000000000002 23.98 21.98 26.174999999999997 75-79 28.03 23.630000000000003 21.535 26.805 80-84 27.455000000000002 23.835 22.36 26.35 85-89 27.384999999999998 24.25 22.09 26.275 90-94 27.685 24.745 21.805 25.765 95-99 27.99 24.060000000000002 21.605 26.345000000000002 100-104 27.71 24.0 21.790000000000003 26.5 105-109 27.644999999999996 24.104999999999997 22.25 26.0 110-114 27.705000000000002 24.2 22.245 25.85 115-119 27.79 24.3 21.87 26.040000000000003 120-124 27.985 23.990000000000002 22.175 25.85 125-129 27.655 24.44 21.9 26.005 130-134 28.355000000000004 24.04 21.8 25.805 135-139 27.845 24.335 22.125 25.695 140-144 27.495000000000005 25.21 22.045 25.25 145-149 27.794999999999998 24.525 21.575 26.105 150-151 28.525 24.2375 22.2125 25.025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.5 15 1.5 16 0.0 17 0.5 18 1.0 19 0.5 20 1.0 21 3.0 22 2.0 23 1.5 24 1.5 25 2.0 26 3.0 27 2.0 28 3.5 29 6.0 30 6.5 31 5.0 32 5.5 33 7.5 34 11.0 35 19.5 36 25.0 37 33.5 38 46.5 39 60.5 40 84.0 41 89.5 42 97.0 43 119.0 44 124.5 45 124.0 46 131.5 47 142.5 48 148.5 49 147.5 50 138.5 51 119.0 52 98.5 53 119.5 54 142.5 55 134.5 56 123.0 57 128.5 58 130.0 59 118.5 60 109.0 61 102.5 62 104.0 63 90.0 64 82.0 65 88.0 66 89.5 67 92.0 68 89.0 69 77.0 70 67.0 71 53.0 72 45.0 73 50.0 74 41.0 75 23.0 76 17.0 77 15.0 78 13.0 79 11.0 80 5.5 81 2.5 82 3.0 83 1.5 84 0.0 85 1.0 86 1.0 87 1.0 88 1.0 89 0.5 90 0.5 91 0.0 92 0.5 93 0.5 94 1.0 95 1.0 96 0.0 97 0.0 98 0.5 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.07499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.09442766950315 83.875 2 6.670326653856712 12.15 3 0.8234971177600879 2.25 4 0.2744990392533626 1.0 5 0.08234971177600879 0.375 6 0.02744990392533626 0.15 7 0.0 0.0 8 0.02744990392533626 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 8 0.2 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 5 0.125 No Hit GCTCATCATCTTGTTCAATCCCAAAGCTCTTCTTCTTCTCCTCCTTGATT 5 0.125 No Hit GAGCAATACAAGCGTTGTGCTGCTAGGCGAAGCGGTTGAGTGCCGCACCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.36250000000000004 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.5375000000000001 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.5874999999999999 0.0 0.0 0.0 0.0 116-117 0.65 0.0 0.0 0.0 0.0 118-119 0.675 0.0 0.0 0.0 0.0 120-121 0.7375 0.0 0.0 0.0 0.0 122-123 0.8 0.0 0.0 0.0 0.0 124-125 0.9125000000000001 0.0 0.0 0.0 0.0 126-127 0.925 0.0 0.0 0.0 0.0 128-129 1.0 0.0 0.0 0.0 0.0 130-131 1.1375000000000002 0.0 0.0 0.0 0.0 132-133 1.2375 0.0 0.0 0.0 0.0 134-135 1.3625 0.0 0.0 0.0 0.0 136-137 1.6 0.0 0.0 0.0 0.0 138-139 1.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGATG 10 0.006830828 145.0 7 >>END_MODULE Read 1387057 spots for SRR7804148.sra Written 1387057 spots for SRR7804148.sra Read 1387057 spots for SRR7804148.sra Written 1387057 spots for SRR7804148.sra Read 1387057 spots for SRR7804148.sra Written 1387057 spots for SRR7804148.sra Read 1387057 spots for SRR7804148.sra Written 1387057 spots for SRR7804148.sra Read 1387057 spots for SRR7804148.sra Written 1387057 spots for SRR7804148.sra Read 1387057 spots for SRR7804148.sra Written 1387057 spots for SRR7804148.sra Read 1387057 spots for SRR7804148.sra Written 1387057 spots for SRR7804148.sra Read 1387057 spots for SRR7804148.sra Written 1387057 spots for SRR7804148.sra Read 1387057 spots for SRR7804148.sra Written 1387057 spots for SRR7804148.sra Read 1387057 spots for SRR7804148.sra Written 1387057 spots for SRR7804148.sra Read 1387057 spots for SRR7804148.sra Written 1387057 spots for SRR7804148.sra Read 1387057 spots for SRR7804148.sra Written 1387057 spots for SRR7804148.sra Read 1387057 spots for SRR7804148.sra Written 1387057 spots for SRR7804148.sra Read 1387057 spots for SRR7804148.sra Written 1387057 spots for SRR7804148.sra Read 1387057 spots for SRR7804148.sra Written 1387057 spots for SRR7804148.sra Read 1387057 spots for SRR7804148.sra Written 1387057 spots for SRR7804148.sra Read 1387060 spots for SRR7804148.sra Written 1387060 spots for SRR7804148.sra Read 1387057 spots for SRR7804148.sra Written 1387057 spots for SRR7804148.sra Read 1387057 spots for SRR7804148.sra Written 1387057 spots for SRR7804148.sra Read 1387057 spots for SRR7804148.sra Written 1387057 spots for SRR7804148.sra SRR ids: ['SRR7804148.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wlw9kuhn SRR7804148.sra spots: 27741143 blocks: [[1, 1387057], [1387058, 2774114], [2774115, 4161171], [4161172, 5548228], [5548229, 6935285], [6935286, 8322342], [8322343, 9709399], [9709400, 11096456], [11096457, 12483513], [12483514, 13870570], [13870571, 15257627], [15257628, 16644684], [16644685, 18031741], [18031742, 19418798], [19418799, 20805855], [20805856, 22192912], [22192913, 23579969], [23579970, 24967026], [24967027, 26354083], [26354084, 27741143]] SRR7804148 file size 9378862 SRR7804148 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804148 SRR7804148_1.fastq SRR7804148_2.fastq Input file: SRR7804148_1.fastq Paired file: SRR7804148_2.fastq trimmed: SRR7804148-trimmed-pair1.fastq, SRR7804148-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:47:10 2024 >> started Tue Dec 10 02:47:39 2024 >> done (28.782s) 27741143 read pairs processed; of these: 54 ( 0.00%) short read pairs filtered out after trimming by size control 470 ( 0.00%) empty read pairs filtered out after trimming by size control 27740619 (100.00%) read pairs available; of these: 813124 ( 2.93%) trimmed read pairs available after processing 26927495 (97.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 9 0.00% 20 7 0.00% 21 8 0.00% 22 7 0.00% 23 7 0.00% 24 18 0.00% 25 10 0.00% 26 23 0.00% 27 15 0.00% 28 17 0.00% 29 20 0.00% 30 19 0.00% 31 9 0.00% 32 31 0.00% 33 25 0.00% 34 22 0.00% 35 10 0.00% 36 19 0.00% 37 18 0.00% 38 21 0.00% 39 22 0.00% 40 20 0.00% 41 22 0.00% 42 22 0.00% 43 24 0.00% 44 27 0.00% 45 23 0.00% 46 33 0.00% 47 32 0.00% 48 28 0.00% 49 36 0.00% 50 32 0.00% 51 34 0.00% 52 39 0.00% 53 37 0.00% 54 50 0.00% 55 45 0.00% 56 57 0.00% 57 59 0.00% 58 44 0.00% 59 50 0.00% 60 48 0.00% 61 65 0.00% 62 62 0.00% 63 62 0.00% 64 64 0.00% 65 71 0.00% 66 80 0.00% 67 84 0.00% 68 101 0.00% 69 109 0.00% 70 117 0.00% 71 101 0.00% 72 145 0.00% 73 141 0.00% 74 178 0.00% 75 208 0.00% 76 214 0.00% 77 210 0.00% 78 218 0.00% 79 297 0.00% 80 321 0.00% 81 320 0.00% 82 418 0.00% 83 477 0.00% 84 509 0.00% 85 543 0.00% 86 653 0.00% 87 692 0.00% 88 817 0.00% 89 834 0.00% 90 979 0.00% 91 1065 0.00% 92 1236 0.00% 93 1292 0.00% 94 1576 0.01% 95 1749 0.01% 96 1911 0.01% 97 1982 0.01% 98 2116 0.01% 99 2352 0.01% 100 2561 0.01% 101 2674 0.01% 102 2965 0.01% 103 3315 0.01% 104 3593 0.01% 105 3790 0.01% 106 4186 0.02% 107 4496 0.02% 108 4547 0.02% 109 5078 0.02% 110 5208 0.02% 111 5721 0.02% 112 6091 0.02% 113 6599 0.02% 114 7163 0.03% 115 7703 0.03% 116 8117 0.03% 117 8634 0.03% 118 8954 0.03% 119 9126 0.03% 120 9721 0.04% 121 10392 0.04% 122 10992 0.04% 123 11876 0.04% 124 12531 0.05% 125 13204 0.05% 126 14119 0.05% 127 14534 0.05% 128 15010 0.05% 129 15892 0.06% 130 16205 0.06% 131 16773 0.06% 132 17922 0.06% 133 19594 0.07% 134 20053 0.07% 135 21370 0.08% 136 22200 0.08% 137 22697 0.08% 138 23440 0.08% 139 24656 0.09% 140 25032 0.09% 141 26206 0.09% 142 27641 0.10% 143 28657 0.10% 144 30273 0.11% 145 31847 0.11% 146 33171 0.12% 147 33504 0.12% 148 34932 0.13% 149 35578 0.13% 150 37104 0.13% 151 26927495 97.07% 27740619 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=29 prefix-density=0.75 prefix-fanout=1.9 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.21 sequence-density-rank=30 fanout-score=6.10 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=2.2 sequence=GCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=3.59 fanout-score-rank=12 prefix-density=0.95 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=23.31 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.6 sequence=CGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCGGCCAAG SRR7804148 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 02:49:02 Started mapping on | Dec 10 02:49:03 Finished on | Dec 10 02:54:47 Mapping speed, Million of reads per hour | 290.31 Number of input reads | 27740619 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 22836497 Uniquely mapped reads % | 82.32% Average mapped length | 299.73 Number of splices: Total | 22817548 Number of splices: Annotated (sjdb) | 21621460 Number of splices: GT/AG | 22467628 Number of splices: GC/AG | 291365 Number of splices: AT/AC | 8623 Number of splices: Non-canonical | 49932 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1171799 % of reads mapped to multiple loci | 4.22% Number of reads mapped to too many loci | 153521 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.63% % of reads unmapped: other | 4.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3732323 3732323 3732323 N_multimapping 1171799 1171799 1171799 N_noFeature 1701591 22170929 1849085 N_ambiguous 649765 3934 133015 UnstrandedReadsAssigned:20485141 PositiveStrandReadsAssigned:661634 NegativeStrandReadsAssigned:20854397 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804148 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804148-trimmed-pair1.fastq SRR7804148-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,740,619 reads, 21,625,277 reads pseudoaligned [quant] estimated average fragment length: 292.699 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52973 SRR7804148.ke.tsv 35125 SRR7804148.se.tsv 88098 total ==> SRR7804148.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 644.583 0 0 PNS24247 1044 752.301 80.8411 5.59478 PNS24249 1928 1636.3 121.788 3.8751 PNS24246 1044 752.301 80.8411 5.59478 PNS24248 1044 752.301 80.8411 5.59478 PNS24244 1471 1179.3 106.689 4.71017 PNS24243 293 74.1147 0 0 KQK14069 1603 1311.3 3751.99 148.971 KQK14071 474 204.42 49.9119 12.7123 ==> SRR7804148.se.tsv <== BRADI_1g14170v3 3862 BRADI_1g53295v3 748 BRADI_1g59795v3 169 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 286 BRADI_1g74790v3 429 BRADI_1g09890v3 0 BRADI_1g77505v3 493 BRADI_1g48960v3 0 SRR7804148 completed mapping pipeline successfully