Starting /dee2/code/volunteer_pipeline.sh SRR7804149 current disk space = 1541352656896 free memory = 1601454608 SRR7804149 SRAfilesize dbd2906da6f9ccd13247dd10e4b50eeb SRR7804149.sra SRR7804149.sra file validated SRR7804149 is paired end SRR7804149 is conventional basespace SRR7804149 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804149_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2205 37.0 37.0 37.0 37.0 37.0 2 36.27725 37.0 37.0 37.0 37.0 37.0 3 36.401 37.0 37.0 37.0 37.0 37.0 4 36.454 37.0 37.0 37.0 37.0 37.0 5 36.4175 37.0 37.0 37.0 37.0 37.0 6 36.5465 37.0 37.0 37.0 37.0 37.0 7 36.401 37.0 37.0 37.0 37.0 37.0 8 36.413 37.0 37.0 37.0 37.0 37.0 9 36.5015 37.0 37.0 37.0 37.0 37.0 10-14 36.4698 37.0 37.0 37.0 37.0 37.0 15-19 36.491 37.0 37.0 37.0 37.0 37.0 20-24 36.4482 37.0 37.0 37.0 37.0 37.0 25-29 36.4319 37.0 37.0 37.0 37.0 37.0 30-34 36.389700000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.4198 37.0 37.0 37.0 37.0 37.0 40-44 36.4086 37.0 37.0 37.0 37.0 37.0 45-49 36.3394 37.0 37.0 37.0 37.0 37.0 50-54 36.3451 37.0 37.0 37.0 37.0 37.0 55-59 36.272299999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.2962 37.0 37.0 37.0 37.0 37.0 65-69 36.2753 37.0 37.0 37.0 37.0 37.0 70-74 36.2346 37.0 37.0 37.0 37.0 37.0 75-79 36.1964 37.0 37.0 37.0 37.0 37.0 80-84 36.1617 37.0 37.0 37.0 37.0 37.0 85-89 36.2059 37.0 37.0 37.0 37.0 37.0 90-94 36.122 37.0 37.0 37.0 37.0 37.0 95-99 36.08540000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.0681 37.0 37.0 37.0 37.0 37.0 105-109 36.0588 37.0 37.0 37.0 37.0 37.0 110-114 36.0169 37.0 37.0 37.0 37.0 37.0 115-119 36.049200000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.9472 37.0 37.0 37.0 37.0 37.0 125-129 35.935100000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.8493 37.0 37.0 37.0 37.0 37.0 135-139 35.819900000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.685199999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.7414 37.0 37.0 37.0 37.0 37.0 150-151 35.198 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 2.0 25 3.0 26 3.0 27 11.0 28 21.0 29 28.0 30 29.0 31 36.0 32 57.0 33 82.0 34 145.0 35 337.0 36 2881.0 37 363.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.1 13.600000000000001 10.8 30.5 2 26.282853566958696 15.143929912390488 31.314142678347935 27.25907384230288 3 22.775000000000002 20.875 25.825 30.525000000000002 4 26.625 26.125 22.55 24.7 5 26.35 28.325 21.825 23.5 6 23.575 31.574999999999996 23.175 21.675 7 19.475 22.025 37.65 20.849999999999998 8 22.15 23.45 27.250000000000004 27.150000000000002 9 21.25 21.825 29.15 27.775 10-14 23.455000000000002 26.135 24.84 25.569999999999997 15-19 23.59 24.965 25.264999999999997 26.179999999999996 20-24 24.18 25.009999999999998 24.975 25.835 25-29 24.099999999999998 25.06 24.75 26.090000000000003 30-34 24.135 25.509999999999998 24.529999999999998 25.825 35-39 24.04 25.19 24.47 26.3 40-44 24.59 25.369999999999997 23.96 26.08 45-49 23.665 25.314999999999998 24.89 26.13 50-54 24.535 24.94 24.165 26.36 55-59 23.965 24.959999999999997 24.445 26.63 60-64 24.240000000000002 24.935 24.82 26.005 65-69 24.365000000000002 25.09 24.095 26.450000000000003 70-74 24.195 24.98 24.275 26.55 75-79 24.505 24.925 24.15 26.419999999999998 80-84 24.94 24.385 24.245 26.43 85-89 24.695 23.96 24.695 26.650000000000002 90-94 24.815 24.065 24.605 26.515 95-99 25.095 24.695 23.345 26.865 100-104 24.585 24.404999999999998 24.575 26.435 105-109 25.795 24.095 23.53 26.58 110-114 24.815 23.925 24.279999999999998 26.979999999999997 115-119 24.81 24.445 24.169999999999998 26.575 120-124 24.9 24.42 23.74 26.939999999999998 125-129 25.230000000000004 23.72 24.044999999999998 27.005000000000003 130-134 24.740000000000002 23.94 24.265 27.055 135-139 25.085 24.325 24.13 26.46 140-144 24.545 24.04 24.355 27.060000000000002 145-149 25.259999999999998 24.445 23.65 26.645000000000003 150-151 25.25 23.025000000000002 24.5375 27.187499999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.0 27 1.0 28 3.5 29 5.5 30 8.0 31 16.0 32 24.5 33 32.5 34 34.0 35 39.5 36 60.5 37 75.5 38 85.5 39 89.0 40 100.5 41 131.0 42 145.0 43 152.0 44 175.5 45 187.5 46 171.0 47 155.5 48 151.5 49 152.5 50 151.0 51 146.0 52 127.5 53 116.5 54 104.0 55 89.0 56 89.0 57 77.5 58 80.0 59 86.0 60 75.5 61 74.5 62 80.0 63 67.5 64 70.0 65 72.5 66 72.5 67 72.5 68 59.5 69 46.5 70 44.0 71 44.5 72 37.5 73 32.0 74 23.5 75 20.0 76 16.0 77 11.5 78 7.0 79 3.5 80 1.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.875 #Duplication Level Percentage of deduplicated Percentage of total 1 93.82157123834887 88.075 2 5.858854860186418 11.0 3 0.2929427430093209 0.8250000000000001 4 0.02663115845539281 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.025 94-95 0.1125 0.0 0.0 0.0 0.025 96-97 0.175 0.0 0.0 0.0 0.025 98-99 0.21250000000000002 0.0 0.0 0.0 0.025 100-101 0.25 0.0 0.0 0.0 0.025 102-103 0.30000000000000004 0.0 0.0 0.0 0.025 104-105 0.4125 0.0 0.0 0.0 0.025 106-107 0.48750000000000004 0.0 0.0 0.0 0.025 108-109 0.5875 0.0 0.0 0.0 0.025 110-111 0.65 0.0 0.0 0.0 0.025 112-113 0.7 0.0 0.0 0.0 0.025 114-115 0.8125 0.0 0.0 0.0 0.025 116-117 0.9125000000000001 0.0 0.0 0.0 0.025 118-119 1.0 0.0 0.0 0.0 0.025 120-121 1.1625 0.0 0.0 0.0 0.025 122-123 1.2000000000000002 0.0 0.0 0.0 0.025 124-125 1.3 0.0 0.0 0.0 0.025 126-127 1.3875000000000002 0.0 0.0 0.0 0.025 128-129 1.5625 0.0 0.0 0.0 0.025 130-131 1.8125 0.0 0.0 0.0 0.025 132-133 1.9625 0.0 0.0 0.0 0.025 134-135 2.0875 0.0 0.0 0.0 0.025 136-137 2.425 0.0 0.0 0.0 0.025 138-139 2.6875 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804149 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804149_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.322 37.0 37.0 37.0 37.0 37.0 2 36.1715 37.0 37.0 37.0 37.0 37.0 3 36.094 37.0 37.0 37.0 37.0 37.0 4 36.1715 37.0 37.0 37.0 37.0 37.0 5 36.208 37.0 37.0 37.0 37.0 37.0 6 36.162 37.0 37.0 37.0 37.0 37.0 7 36.036 37.0 37.0 37.0 37.0 37.0 8 36.0945 37.0 37.0 37.0 37.0 37.0 9 36.0565 37.0 37.0 37.0 37.0 37.0 10-14 36.0841 37.0 37.0 37.0 37.0 37.0 15-19 35.92909999999999 37.0 37.0 37.0 37.0 37.0 20-24 35.93549999999999 37.0 37.0 37.0 37.0 37.0 25-29 35.9919 37.0 37.0 37.0 37.0 37.0 30-34 35.9092 37.0 37.0 37.0 37.0 37.0 35-39 35.9401 37.0 37.0 37.0 37.0 37.0 40-44 35.877300000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.8495 37.0 37.0 37.0 37.0 37.0 50-54 35.7971 37.0 37.0 37.0 37.0 37.0 55-59 35.740700000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.78000000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.7538 37.0 37.0 37.0 37.0 37.0 70-74 35.69540000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.683 37.0 37.0 37.0 37.0 37.0 80-84 35.6651 37.0 37.0 37.0 37.0 37.0 85-89 35.6468 37.0 37.0 37.0 37.0 37.0 90-94 35.620099999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.5818 37.0 37.0 37.0 37.0 37.0 100-104 35.5894 37.0 37.0 37.0 37.0 37.0 105-109 35.456599999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.395399999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.4284 37.0 37.0 37.0 37.0 37.0 120-124 35.3318 37.0 37.0 37.0 37.0 37.0 125-129 35.295100000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.355900000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.238600000000005 37.0 37.0 37.0 29.8 37.0 140-144 35.1905 37.0 37.0 37.0 34.6 37.0 145-149 35.019800000000004 37.0 37.0 37.0 25.0 37.0 150-151 34.509 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 7.0 14 8.0 15 10.0 16 4.0 17 4.0 18 5.0 19 4.0 20 10.0 21 12.0 22 10.0 23 16.0 24 9.0 25 12.0 26 12.0 27 12.0 28 15.0 29 13.0 30 18.0 31 43.0 32 43.0 33 102.0 34 171.0 35 457.0 36 2747.0 37 255.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.675 19.625 11.675 28.025 2 32.975 22.975 23.125 20.925 3 26.1 26.55 26.224999999999998 21.125 4 27.950000000000003 29.925 19.075 23.05 5 29.799999999999997 31.225 16.8 22.175 6 26.0 32.6 18.35 23.05 7 23.775 19.775000000000002 32.0 24.45 8 26.8 21.5 20.225 31.474999999999998 9 24.9 23.125 25.5 26.474999999999998 10-14 27.255000000000003 25.009999999999998 21.099999999999998 26.634999999999998 15-19 27.025 24.41 22.71 25.855 20-24 26.729999999999997 25.105 22.455 25.71 25-29 26.99 25.009999999999998 21.645 26.355 30-34 26.229999999999997 25.474999999999998 22.935 25.36 35-39 26.419999999999998 25.165 22.61 25.805 40-44 27.155 25.174999999999997 22.08 25.590000000000003 45-49 26.965 24.605 22.56 25.869999999999997 50-54 26.795 25.019999999999996 22.645 25.540000000000003 55-59 26.99 24.5 22.525000000000002 25.985000000000003 60-64 26.919999999999998 24.990000000000002 22.75 25.34 65-69 26.88 24.64 23.03 25.45 70-74 26.985 24.865000000000002 22.195 25.955000000000002 75-79 26.895000000000003 24.25 22.935 25.919999999999998 80-84 26.465 25.124999999999996 23.11 25.3 85-89 26.39 25.31 22.705000000000002 25.595000000000002 90-94 26.87 25.025 22.395 25.71 95-99 26.97 24.44 23.200000000000003 25.39 100-104 27.26 25.169999999999998 22.34 25.230000000000004 105-109 26.979999999999997 25.355 22.134999999999998 25.53 110-114 27.22 24.795 22.805 25.180000000000003 115-119 26.939999999999998 24.98 22.259999999999998 25.82 120-124 26.924999999999997 25.06 23.185 24.83 125-129 26.155 25.445 23.305 25.095 130-134 26.83 24.81 23.125 25.235000000000003 135-139 26.979999999999997 25.779999999999998 23.02 24.22 140-144 27.21 25.46 22.675 24.654999999999998 145-149 27.29 25.0 23.24 24.47 150-151 27.125 25.337500000000002 22.9875 24.55 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.5 11 1.5 12 2.0 13 1.5 14 0.5 15 0.5 16 0.5 17 1.0 18 1.0 19 1.0 20 1.0 21 0.5 22 2.5 23 3.0 24 2.0 25 2.5 26 4.0 27 3.0 28 4.0 29 8.5 30 11.0 31 10.0 32 10.5 33 13.5 34 14.0 35 20.5 36 31.5 37 40.0 38 55.0 39 75.5 40 91.0 41 105.5 42 124.5 43 140.0 44 150.0 45 161.0 46 158.0 47 149.5 48 156.0 49 151.0 50 137.0 51 132.0 52 129.5 53 117.0 54 111.0 55 113.0 56 98.0 57 88.0 58 92.0 59 91.5 60 91.5 61 94.0 62 93.0 63 96.5 64 92.0 65 86.5 66 80.5 67 72.0 68 71.5 69 65.5 70 57.0 71 48.5 72 35.5 73 39.0 74 39.0 75 28.5 76 22.5 77 12.0 78 13.0 79 11.0 80 4.0 81 3.0 82 2.0 83 2.0 84 1.0 85 1.0 86 1.0 87 0.0 88 0.0 89 1.0 90 1.0 91 0.5 92 0.5 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.5 100 5.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.25 #Duplication Level Percentage of deduplicated Percentage of total 1 93.48525469168901 87.175 2 6.085790884718499 11.35 3 0.34852546916890076 0.975 4 0.05361930294906167 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026809651474530835 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.7124999999999999 0.0 0.0 0.0 0.0 114-115 0.7875 0.0 0.0 0.0 0.0 116-117 0.8875 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.1375 0.0 0.0 0.0 0.0 122-123 1.1749999999999998 0.0 0.0 0.0 0.0 124-125 1.275 0.0 0.0 0.0 0.0 126-127 1.3624999999999998 0.0 0.0 0.0 0.0 128-129 1.5375 0.0 0.0 0.0 0.0 130-131 1.7875 0.0 0.0 0.0 0.0 132-133 1.9125 0.0 0.0 0.0 0.0 134-135 2.0375 0.0 0.0 0.0 0.0 136-137 2.375 0.0 0.0 0.0 0.0 138-139 2.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1389255 spots for SRR7804149.sra Written 1389255 spots for SRR7804149.sra Read 1389255 spots for SRR7804149.sra Written 1389255 spots for SRR7804149.sra Read 1389255 spots for SRR7804149.sra Written 1389255 spots for SRR7804149.sra Read 1389255 spots for SRR7804149.sra Written 1389255 spots for SRR7804149.sra Read 1389255 spots for SRR7804149.sra Written 1389255 spots for SRR7804149.sra Read 1389255 spots for SRR7804149.sra Written 1389255 spots for SRR7804149.sra Read 1389255 spots for SRR7804149.sra Written 1389255 spots for SRR7804149.sra Read 1389255 spots for SRR7804149.sra Written 1389255 spots for SRR7804149.sra Read 1389255 spots for SRR7804149.sra Written 1389255 spots for SRR7804149.sra Read 1389255 spots for SRR7804149.sra Written 1389255 spots for SRR7804149.sra Read 1389255 spots for SRR7804149.sra Written 1389255 spots for SRR7804149.sra Read 1389255 spots for SRR7804149.sra Written 1389255 spots for SRR7804149.sra Read 1389255 spots for SRR7804149.sra Written 1389255 spots for SRR7804149.sra Read 1389274 spots for SRR7804149.sra Written 1389274 spots for SRR7804149.sra Read 1389255 spots for SRR7804149.sra Written 1389255 spots for SRR7804149.sra Read 1389255 spots for SRR7804149.sra Written 1389255 spots for SRR7804149.sra Read 1389255 spots for SRR7804149.sra Written 1389255 spots for SRR7804149.sra Read 1389255 spots for SRR7804149.sra Written 1389255 spots for SRR7804149.sra Read 1389255 spots for SRR7804149.sra Written 1389255 spots for SRR7804149.sra Read 1389255 spots for SRR7804149.sra Written 1389255 spots for SRR7804149.sra SRR ids: ['SRR7804149.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ch0ak8ag SRR7804149.sra spots: 27785119 blocks: [[1, 1389255], [1389256, 2778510], [2778511, 4167765], [4167766, 5557020], [5557021, 6946275], [6946276, 8335530], [8335531, 9724785], [9724786, 11114040], [11114041, 12503295], [12503296, 13892550], [13892551, 15281805], [15281806, 16671060], [16671061, 18060315], [18060316, 19449570], [19449571, 20838825], [20838826, 22228080], [22228081, 23617335], [23617336, 25006590], [25006591, 26395845], [26395846, 27785119]] SRR7804149 file size 9393764 SRR7804149 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804149 SRR7804149_1.fastq SRR7804149_2.fastq Input file: SRR7804149_1.fastq Paired file: SRR7804149_2.fastq trimmed: SRR7804149-trimmed-pair1.fastq, SRR7804149-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:16:51 2024 >> started Sat Dec 7 17:17:20 2024 >> done (28.859s) 27785119 read pairs processed; of these: 144 ( 0.00%) short read pairs filtered out after trimming by size control 1284 ( 0.00%) empty read pairs filtered out after trimming by size control 27783691 (99.99%) read pairs available; of these: 1101608 ( 3.96%) trimmed read pairs available after processing 26682083 (96.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 10 0.00% 20 13 0.00% 21 14 0.00% 22 17 0.00% 23 24 0.00% 24 25 0.00% 25 23 0.00% 26 39 0.00% 27 30 0.00% 28 23 0.00% 29 24 0.00% 30 23 0.00% 31 36 0.00% 32 34 0.00% 33 28 0.00% 34 38 0.00% 35 32 0.00% 36 37 0.00% 37 34 0.00% 38 57 0.00% 39 39 0.00% 40 32 0.00% 41 45 0.00% 42 53 0.00% 43 53 0.00% 44 48 0.00% 45 45 0.00% 46 65 0.00% 47 49 0.00% 48 46 0.00% 49 65 0.00% 50 52 0.00% 51 65 0.00% 52 82 0.00% 53 62 0.00% 54 58 0.00% 55 76 0.00% 56 80 0.00% 57 87 0.00% 58 75 0.00% 59 74 0.00% 60 110 0.00% 61 107 0.00% 62 83 0.00% 63 102 0.00% 64 100 0.00% 65 93 0.00% 66 137 0.00% 67 136 0.00% 68 163 0.00% 69 152 0.00% 70 190 0.00% 71 231 0.00% 72 245 0.00% 73 271 0.00% 74 297 0.00% 75 316 0.00% 76 331 0.00% 77 423 0.00% 78 421 0.00% 79 524 0.00% 80 536 0.00% 81 630 0.00% 82 716 0.00% 83 897 0.00% 84 946 0.00% 85 1046 0.00% 86 1125 0.00% 87 1171 0.00% 88 1376 0.00% 89 1571 0.01% 90 1644 0.01% 91 1904 0.01% 92 2165 0.01% 93 2460 0.01% 94 2740 0.01% 95 2919 0.01% 96 3136 0.01% 97 3428 0.01% 98 3635 0.01% 99 3887 0.01% 100 4251 0.02% 101 4547 0.02% 102 5095 0.02% 103 5496 0.02% 104 6140 0.02% 105 6578 0.02% 106 6783 0.02% 107 7121 0.03% 108 7380 0.03% 109 8014 0.03% 110 8489 0.03% 111 8891 0.03% 112 9739 0.04% 113 10795 0.04% 114 11519 0.04% 115 11811 0.04% 116 12607 0.05% 117 13082 0.05% 118 13236 0.05% 119 13833 0.05% 120 14503 0.05% 121 15059 0.05% 122 15999 0.06% 123 17216 0.06% 124 18651 0.07% 125 19392 0.07% 126 20001 0.07% 127 20823 0.07% 128 20913 0.08% 129 22007 0.08% 130 22222 0.08% 131 23303 0.08% 132 24312 0.09% 133 25966 0.09% 134 27167 0.10% 135 29099 0.10% 136 29762 0.11% 137 30091 0.11% 138 30901 0.11% 139 31203 0.11% 140 32030 0.12% 141 33013 0.12% 142 34118 0.12% 143 35665 0.13% 144 37508 0.14% 145 39272 0.14% 146 40800 0.15% 147 41614 0.15% 148 42724 0.15% 149 42604 0.15% 150 44076 0.16% 151 26682083 96.04% 27783691 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=22 prefix-density=0.65 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=132.29 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=7.5 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.74 fanout-score-rank=16 prefix-density=0.56 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=21.11 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.9 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804149 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:18:13 Started mapping on | Dec 07 17:18:13 Finished on | Dec 07 17:24:17 Mapping speed, Million of reads per hour | 274.78 Number of input reads | 27783691 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 24376744 Uniquely mapped reads % | 87.74% Average mapped length | 299.08 Number of splices: Total | 23339675 Number of splices: Annotated (sjdb) | 21968123 Number of splices: GT/AG | 22986923 Number of splices: GC/AG | 277765 Number of splices: AT/AC | 10216 Number of splices: Non-canonical | 64771 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 460184 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 50656 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.99% % of reads unmapped: other | 1.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2946763 2946763 2946763 N_multimapping 460184 460184 460184 N_noFeature 994539 23639669 1213735 N_ambiguous 656816 5868 138409 UnstrandedReadsAssigned:22725389 PositiveStrandReadsAssigned:731207 NegativeStrandReadsAssigned:23024600 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804149 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804149-trimmed-pair1.fastq SRR7804149-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,783,691 reads, 23,477,516 reads pseudoaligned [quant] estimated average fragment length: 293.274 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52973 SRR7804149.ke.tsv 35125 SRR7804149.se.tsv 88098 total ==> SRR7804149.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 644.222 0 0 PNS24247 1044 751.726 147.513 10.405 PNS24249 1928 1635.73 222.517 7.21315 PNS24246 1044 751.726 147.513 10.405 PNS24248 1044 751.726 147.513 10.405 PNS24244 1471 1178.73 287.944 12.9529 PNS24243 293 78.7469 0 0 KQK14069 1603 1310.73 5635.95 227.997 KQK14071 474 206.166 153.424 39.4593 ==> SRR7804149.se.tsv <== BRADI_1g14170v3 6137 BRADI_1g53295v3 1152 BRADI_1g59795v3 872 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 577 BRADI_1g74790v3 1518 BRADI_1g09890v3 0 BRADI_1g77505v3 356 BRADI_1g48960v3 1 SRR7804149 completed mapping pipeline successfully