Starting /dee2/code/volunteer_pipeline.sh SRR7804150 current disk space = 1525130743808 free memory = 1562476760 SRR7804150 SRAfilesize efd33c39a6229127a620e5cf6976d80d SRR7804150.sra SRR7804150.sra file validated SRR7804150 is paired end SRR7804150 is conventional basespace SRR7804150 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804150_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2435 37.0 37.0 37.0 37.0 37.0 2 36.291 37.0 37.0 37.0 37.0 37.0 3 36.3765 37.0 37.0 37.0 37.0 37.0 4 36.428 37.0 37.0 37.0 37.0 37.0 5 36.4785 37.0 37.0 37.0 37.0 37.0 6 36.4205 37.0 37.0 37.0 37.0 37.0 7 36.5475 37.0 37.0 37.0 37.0 37.0 8 36.462 37.0 37.0 37.0 37.0 37.0 9 36.4785 37.0 37.0 37.0 37.0 37.0 10-14 36.460699999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.456500000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.426 37.0 37.0 37.0 37.0 37.0 25-29 36.406600000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.3943 37.0 37.0 37.0 37.0 37.0 35-39 36.3454 37.0 37.0 37.0 37.0 37.0 40-44 36.3836 37.0 37.0 37.0 37.0 37.0 45-49 36.367 37.0 37.0 37.0 37.0 37.0 50-54 36.214 37.0 37.0 37.0 37.0 37.0 55-59 36.2659 37.0 37.0 37.0 37.0 37.0 60-64 36.286 37.0 37.0 37.0 37.0 37.0 65-69 36.2511 37.0 37.0 37.0 37.0 37.0 70-74 36.219500000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.2035 37.0 37.0 37.0 37.0 37.0 80-84 36.0949 37.0 37.0 37.0 37.0 37.0 85-89 36.158 37.0 37.0 37.0 37.0 37.0 90-94 36.0741 37.0 37.0 37.0 37.0 37.0 95-99 36.0601 37.0 37.0 37.0 37.0 37.0 100-104 36.0376 37.0 37.0 37.0 37.0 37.0 105-109 36.0289 37.0 37.0 37.0 37.0 37.0 110-114 35.9634 37.0 37.0 37.0 37.0 37.0 115-119 35.9938 37.0 37.0 37.0 37.0 37.0 120-124 35.9483 37.0 37.0 37.0 37.0 37.0 125-129 35.8506 37.0 37.0 37.0 37.0 37.0 130-134 35.8137 37.0 37.0 37.0 37.0 37.0 135-139 35.7345 37.0 37.0 37.0 37.0 37.0 140-144 35.6653 37.0 37.0 37.0 37.0 37.0 145-149 35.7039 37.0 37.0 37.0 37.0 37.0 150-151 35.1565 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 3.0 25 4.0 26 14.0 27 7.0 28 18.0 29 21.0 30 31.0 31 41.0 32 69.0 33 93.0 34 126.0 35 370.0 36 2829.0 37 373.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.824999999999996 12.15 8.774999999999999 34.25 2 24.374374374374376 14.514514514514515 32.107107107107105 29.004004004004003 3 22.325 18.675 25.35 33.650000000000006 4 25.775 25.75 21.45 27.025 5 26.924999999999997 27.925 22.925 22.225 6 25.025 30.85 21.0 23.125 7 18.05 23.474999999999998 36.3 22.175 8 22.175 22.225 26.85 28.749999999999996 9 20.45 21.525 32.300000000000004 25.724999999999998 10-14 24.21 25.0 24.075 26.715 15-19 24.2 24.11 25.035 26.655 20-24 23.95 24.465 24.795 26.790000000000003 25-29 24.55 24.435000000000002 24.560000000000002 26.455000000000002 30-34 23.9 24.025 24.855 27.22 35-39 24.15 24.42 24.315 27.115000000000002 40-44 25.180000000000003 24.33 23.91 26.58 45-49 24.255 24.535 23.755000000000003 27.455000000000002 50-54 24.654999999999998 23.674999999999997 24.505 27.165 55-59 25.14 23.71 24.065 27.084999999999997 60-64 24.490000000000002 23.995 24.2 27.315 65-69 25.124999999999996 23.91 24.12 26.845000000000002 70-74 24.325 24.22 24.0 27.455000000000002 75-79 25.324999999999996 23.244999999999997 24.265 27.165 80-84 24.95 24.03 24.01 27.01 85-89 25.165 23.549999999999997 24.015 27.27 90-94 25.485000000000003 23.075000000000003 24.375 27.065 95-99 24.955 23.895 24.310000000000002 26.840000000000003 100-104 25.635 24.175 23.005 27.185 105-109 25.495 23.48 23.91 27.115000000000002 110-114 25.330000000000002 24.34 23.474999999999998 26.855 115-119 25.195 23.215 24.415 27.175 120-124 25.465 23.575 23.95 27.01 125-129 25.5 22.895 23.915 27.689999999999998 130-134 25.81 23.855 23.97 26.365 135-139 25.374999999999996 23.745 23.445 27.435 140-144 26.085 23.169999999999998 23.724999999999998 27.02 145-149 26.075 23.455000000000002 23.494999999999997 26.974999999999998 150-151 26.200000000000003 22.912499999999998 24.25 26.637499999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.0 27 1.5 28 2.0 29 3.5 30 4.0 31 6.5 32 11.0 33 16.5 34 23.5 35 28.5 36 39.5 37 53.5 38 59.0 39 78.5 40 97.0 41 122.5 42 136.0 43 149.0 44 162.5 45 157.0 46 177.0 47 184.5 48 164.5 49 141.0 50 148.5 51 149.5 52 137.0 53 131.0 54 116.5 55 98.5 56 92.0 57 97.5 58 94.5 59 86.5 60 80.0 61 88.0 62 90.5 63 88.0 64 89.5 65 80.0 66 66.5 67 59.5 68 64.5 69 60.5 70 48.5 71 46.0 72 37.5 73 29.5 74 25.5 75 19.5 76 17.0 77 15.0 78 9.0 79 5.5 80 4.0 81 1.0 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.5 #Duplication Level Percentage of deduplicated Percentage of total 1 93.52941176470588 87.45 2 5.989304812834225 11.200000000000001 3 0.4812834224598931 1.35 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.6 0.0 0.0 0.0 0.0 122-123 0.6625 0.0 0.0 0.0 0.0 124-125 0.725 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.775 0.0 0.0 0.0 0.0 130-131 0.8625 0.0 0.0 0.0 0.0 132-133 0.975 0.0 0.0 0.0 0.0 134-135 1.0375 0.0 0.0 0.0 0.0 136-137 1.1125 0.0 0.0 0.0 0.0 138-139 1.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804150 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804150_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2885 37.0 37.0 37.0 37.0 37.0 2 35.9795 37.0 37.0 37.0 37.0 37.0 3 35.9445 37.0 37.0 37.0 37.0 37.0 4 36.1835 37.0 37.0 37.0 37.0 37.0 5 36.1005 37.0 37.0 37.0 37.0 37.0 6 36.1205 37.0 37.0 37.0 37.0 37.0 7 35.8875 37.0 37.0 37.0 37.0 37.0 8 36.1525 37.0 37.0 37.0 37.0 37.0 9 36.1195 37.0 37.0 37.0 37.0 37.0 10-14 36.080799999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.04200000000001 37.0 37.0 37.0 37.0 37.0 20-24 35.979200000000006 37.0 37.0 37.0 37.0 37.0 25-29 35.9485 37.0 37.0 37.0 37.0 37.0 30-34 35.9796 37.0 37.0 37.0 37.0 37.0 35-39 35.9288 37.0 37.0 37.0 37.0 37.0 40-44 35.936099999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.8652 37.0 37.0 37.0 37.0 37.0 50-54 35.826 37.0 37.0 37.0 37.0 37.0 55-59 35.7372 37.0 37.0 37.0 37.0 37.0 60-64 35.75149999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.6928 37.0 37.0 37.0 37.0 37.0 70-74 35.7584 37.0 37.0 37.0 37.0 37.0 75-79 35.6727 37.0 37.0 37.0 37.0 37.0 80-84 35.7372 37.0 37.0 37.0 37.0 37.0 85-89 35.707300000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.6687 37.0 37.0 37.0 37.0 37.0 95-99 35.6356 37.0 37.0 37.0 37.0 37.0 100-104 35.6288 37.0 37.0 37.0 37.0 37.0 105-109 35.5479 37.0 37.0 37.0 37.0 37.0 110-114 35.455400000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.4476 37.0 37.0 37.0 37.0 37.0 120-124 35.4296 37.0 37.0 37.0 34.6 37.0 125-129 35.2816 37.0 37.0 37.0 34.6 37.0 130-134 35.346799999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.1739 37.0 37.0 37.0 29.8 37.0 140-144 35.2346 37.0 37.0 37.0 32.2 37.0 145-149 34.9993 37.0 37.0 37.0 25.0 37.0 150-151 34.571250000000006 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 7.0 14 5.0 15 6.0 16 1.0 17 0.0 18 1.0 19 2.0 20 1.0 21 7.0 22 11.0 23 7.0 24 10.0 25 7.0 26 9.0 27 15.0 28 25.0 29 27.0 30 21.0 31 44.0 32 63.0 33 115.0 34 213.0 35 600.0 36 2618.0 37 183.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.26426426426426 18.643643643643642 9.234234234234235 32.85785785785786 2 29.75 22.775000000000002 25.424999999999997 22.05 3 24.575 24.474999999999998 25.5 25.45 4 28.4 30.525000000000002 18.4 22.675 5 28.65 32.225 17.375 21.75 6 25.25 32.9 18.575 23.275000000000002 7 23.925 18.6 31.25 26.224999999999998 8 25.624999999999996 22.575 21.25 30.55 9 24.275 23.150000000000002 23.275000000000002 29.299999999999997 10-14 26.174999999999997 24.45 21.98 27.395000000000003 15-19 26.584999999999997 24.05 22.555 26.810000000000002 20-24 27.08 24.42 22.2 26.3 25-29 26.715 23.995 22.509999999999998 26.779999999999998 30-34 26.590000000000003 24.169999999999998 23.28 25.96 35-39 26.590000000000003 24.025 22.759999999999998 26.625 40-44 26.939999999999998 24.834999999999997 21.86 26.365 45-49 27.02 23.9 22.395 26.685 50-54 26.755000000000003 23.89 22.37 26.985 55-59 27.37 23.474999999999998 22.555 26.6 60-64 27.52 23.59 22.42 26.47 65-69 27.22 24.065 22.64 26.075 70-74 26.900000000000002 24.295 22.89 25.915 75-79 27.295 23.875 22.615 26.215 80-84 27.560000000000002 23.995 22.220000000000002 26.224999999999998 85-89 27.284999999999997 23.355 22.770000000000003 26.590000000000003 90-94 27.405 23.84 22.55 26.205000000000002 95-99 27.175 23.855 22.905 26.064999999999998 100-104 27.48 24.13 22.220000000000002 26.169999999999998 105-109 27.084999999999997 23.665 22.66 26.590000000000003 110-114 26.950000000000003 23.79 22.835 26.424999999999997 115-119 27.800000000000004 23.565 22.264999999999997 26.369999999999997 120-124 27.439999999999998 23.905 22.1 26.555 125-129 27.415 24.33 22.25 26.005 130-134 28.035 24.445 22.465 25.055 135-139 27.425 24.03 22.875 25.669999999999998 140-144 27.66 24.165 22.84 25.335 145-149 28.12 24.025 22.755 25.1 150-151 27.237499999999997 24.15 23.125 25.4875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 1.5 4 2.0 5 1.0 6 0.0 7 0.5 8 0.5 9 0.5 10 1.0 11 1.0 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.5 23 0.5 24 0.0 25 1.5 26 1.5 27 1.5 28 3.0 29 2.5 30 5.0 31 6.0 32 5.0 33 11.5 34 21.0 35 28.0 36 31.0 37 38.5 38 46.5 39 53.0 40 77.0 41 95.5 42 104.0 43 127.0 44 153.5 45 164.5 46 155.0 47 150.5 48 143.5 49 140.5 50 136.5 51 125.5 52 127.0 53 116.0 54 102.0 55 107.5 56 107.5 57 94.5 58 96.0 59 102.0 60 94.5 61 96.0 62 99.5 63 107.0 64 101.5 65 88.0 66 90.0 67 89.0 68 87.5 69 84.0 70 77.5 71 60.0 72 47.0 73 44.0 74 35.5 75 25.5 76 21.5 77 17.0 78 10.5 79 6.5 80 5.0 81 3.0 82 1.5 83 1.0 84 2.0 85 2.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.5 97 0.5 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.45 #Duplication Level Percentage of deduplicated Percentage of total 1 93.6864633493847 87.55 2 5.778491171749598 10.8 3 0.4815409309791332 1.35 4 0.0 0.0 5 0.026752273943285176 0.125 6 0.0 0.0 7 0.026752273943285176 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTCATCATCTTGTTCAATCCCAAAGCTCTTCTTCTTCTCCTCCTTGATT 7 0.17500000000000002 No Hit GGTGGGTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.6 0.0 0.0 0.0 0.0 122-123 0.6625 0.0 0.0 0.0 0.0 124-125 0.725 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.775 0.0 0.0 0.0 0.0 130-131 0.85 0.0 0.0 0.0 0.0 132-133 0.95 0.0 0.0 0.0 0.0 134-135 1.0125 0.0 0.0 0.0 0.0 136-137 1.0875 0.0 0.0 0.0 0.0 138-139 1.2000000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGGGAT 10 0.006830828 145.0 6 CAACTCT 10 0.006830828 145.0 3 GGCAACT 10 0.006830828 145.0 1 GCAACTC 10 0.006830828 145.0 2 AACTCTC 10 0.006830828 145.0 4 >>END_MODULE Read 1559517 spots for SRR7804150.sra Written 1559517 spots for SRR7804150.sra Read 1559517 spots for SRR7804150.sra Written 1559517 spots for SRR7804150.sra Read 1559517 spots for SRR7804150.sra Written 1559517 spots for SRR7804150.sra Read 1559517 spots for SRR7804150.sra Written 1559517 spots for SRR7804150.sra Read 1559517 spots for SRR7804150.sra Written 1559517 spots for SRR7804150.sra Read 1559517 spots for SRR7804150.sra Written 1559517 spots for SRR7804150.sra Read 1559517 spots for SRR7804150.sra Written 1559517 spots for SRR7804150.sra Read 1559517 spots for SRR7804150.sra Written 1559517 spots for SRR7804150.sra Read 1559517 spots for SRR7804150.sra Written 1559517 spots for SRR7804150.sra Read 1559517 spots for SRR7804150.sra Written 1559517 spots for SRR7804150.sra Read 1559517 spots for SRR7804150.sra Written 1559517 spots for SRR7804150.sra Read 1559517 spots for SRR7804150.sra Written 1559517 spots for SRR7804150.sra Read 1559517 spots for SRR7804150.sra Written 1559517 spots for SRR7804150.sra Read 1559517 spots for SRR7804150.sra Written 1559517 spots for SRR7804150.sra Read 1559517 spots for SRR7804150.sra Written 1559517 spots for SRR7804150.sra Read 1559517 spots for SRR7804150.sra Written 1559517 spots for SRR7804150.sra Read 1559517 spots for SRR7804150.sra Written 1559517 spots for SRR7804150.sra Read 1559517 spots for SRR7804150.sra Written 1559517 spots for SRR7804150.sra Read 1559534 spots for SRR7804150.sra Written 1559534 spots for SRR7804150.sra Read 1559517 spots for SRR7804150.sra Written 1559517 spots for SRR7804150.sra SRR ids: ['SRR7804150.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ysoe6pwd SRR7804150.sra spots: 31190357 blocks: [[1, 1559517], [1559518, 3119034], [3119035, 4678551], [4678552, 6238068], [6238069, 7797585], [7797586, 9357102], [9357103, 10916619], [10916620, 12476136], [12476137, 14035653], [14035654, 15595170], [15595171, 17154687], [17154688, 18714204], [18714205, 20273721], [20273722, 21833238], [21833239, 23392755], [23392756, 24952272], [24952273, 26511789], [26511790, 28071306], [28071307, 29630823], [29630824, 31190357]] SRR7804150 file size 10547688 SRR7804150 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804150 SRR7804150_1.fastq SRR7804150_2.fastq Input file: SRR7804150_1.fastq Paired file: SRR7804150_2.fastq trimmed: SRR7804150-trimmed-pair1.fastq, SRR7804150-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:58:56 2024 >> started Tue Dec 10 02:59:34 2024 >> done (38.083s) 31190357 read pairs processed; of these: 91 ( 0.00%) short read pairs filtered out after trimming by size control 533 ( 0.00%) empty read pairs filtered out after trimming by size control 31189733 (100.00%) read pairs available; of these: 766607 ( 2.46%) trimmed read pairs available after processing 30423126 (97.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 14 0.00% 20 8 0.00% 21 13 0.00% 22 19 0.00% 23 25 0.00% 24 16 0.00% 25 22 0.00% 26 17 0.00% 27 32 0.00% 28 31 0.00% 29 33 0.00% 30 30 0.00% 31 34 0.00% 32 35 0.00% 33 33 0.00% 34 36 0.00% 35 37 0.00% 36 35 0.00% 37 43 0.00% 38 58 0.00% 39 53 0.00% 40 50 0.00% 41 46 0.00% 42 50 0.00% 43 43 0.00% 44 53 0.00% 45 49 0.00% 46 60 0.00% 47 67 0.00% 48 51 0.00% 49 54 0.00% 50 53 0.00% 51 55 0.00% 52 55 0.00% 53 75 0.00% 54 66 0.00% 55 64 0.00% 56 78 0.00% 57 88 0.00% 58 84 0.00% 59 69 0.00% 60 82 0.00% 61 92 0.00% 62 92 0.00% 63 103 0.00% 64 81 0.00% 65 120 0.00% 66 87 0.00% 67 112 0.00% 68 119 0.00% 69 137 0.00% 70 143 0.00% 71 153 0.00% 72 161 0.00% 73 225 0.00% 74 195 0.00% 75 223 0.00% 76 213 0.00% 77 258 0.00% 78 272 0.00% 79 316 0.00% 80 362 0.00% 81 396 0.00% 82 443 0.00% 83 525 0.00% 84 604 0.00% 85 614 0.00% 86 675 0.00% 87 748 0.00% 88 753 0.00% 89 874 0.00% 90 965 0.00% 91 1060 0.00% 92 1221 0.00% 93 1326 0.00% 94 1481 0.00% 95 1648 0.01% 96 1757 0.01% 97 1934 0.01% 98 2023 0.01% 99 2373 0.01% 100 2394 0.01% 101 2582 0.01% 102 2816 0.01% 103 3148 0.01% 104 3418 0.01% 105 3713 0.01% 106 3969 0.01% 107 4037 0.01% 108 4323 0.01% 109 4744 0.02% 110 5019 0.02% 111 5244 0.02% 112 5726 0.02% 113 6468 0.02% 114 6678 0.02% 115 7102 0.02% 116 7568 0.02% 117 7887 0.03% 118 8301 0.03% 119 8842 0.03% 120 9022 0.03% 121 9687 0.03% 122 10054 0.03% 123 10949 0.04% 124 11838 0.04% 125 12314 0.04% 126 13190 0.04% 127 14036 0.05% 128 14092 0.05% 129 14328 0.05% 130 15072 0.05% 131 16009 0.05% 132 16737 0.05% 133 17897 0.06% 134 18971 0.06% 135 20156 0.06% 136 20753 0.07% 137 21434 0.07% 138 22375 0.07% 139 22898 0.07% 140 23709 0.08% 141 24448 0.08% 142 26026 0.08% 143 27126 0.09% 144 28336 0.09% 145 30089 0.10% 146 30907 0.10% 147 32080 0.10% 148 32761 0.11% 149 33656 0.11% 150 34866 0.11% 151 30423126 97.54% 31189733 reads passed initial QC criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=23 prefix-density=0.97 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=26 fanout-score=16.47 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=4.6 sequence=ACTTGCCGGGGACGAAGTTGGTGGC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=29 prefix-density=0.71 prefix-fanout=2.0 sequence=ATCCGCTCCAAGTGGGTTCCTTGCCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=52.76 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.1 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804150 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:00:26 Started mapping on | Dec 10 03:00:26 Finished on | Dec 10 03:05:05 Mapping speed, Million of reads per hour | 402.45 Number of input reads | 31189733 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 28861634 Uniquely mapped reads % | 92.54% Average mapped length | 299.86 Number of splices: Total | 29408913 Number of splices: Annotated (sjdb) | 27817707 Number of splices: GT/AG | 29003357 Number of splices: GC/AG | 324108 Number of splices: AT/AC | 11992 Number of splices: Non-canonical | 69456 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.97 Insertion rate per base | 0.02% Insertion average length | 2.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 396821 % of reads mapped to multiple loci | 1.27% Number of reads mapped to too many loci | 26590 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.44% % of reads unmapped: other | 0.67% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1931278 1931278 1931278 N_multimapping 396821 396821 396821 N_noFeature 806547 27997595 1094743 N_ambiguous 712678 5140 136946 UnstrandedReadsAssigned:27342409 PositiveStrandReadsAssigned:858899 NegativeStrandReadsAssigned:27629945 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804150 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804150-trimmed-pair1.fastq SRR7804150-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,189,733 reads, 27,864,799 reads pseudoaligned [quant] estimated average fragment length: 307.498 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52973 SRR7804150.ke.tsv 35125 SRR7804150.se.tsv 88098 total ==> SRR7804150.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 630.304 0 0 PNS24247 1044 737.502 129.614 7.75141 PNS24249 1928 1621.5 218.868 5.9533 PNS24246 1044 737.502 129.614 7.75141 PNS24248 1044 737.502 129.614 7.75141 PNS24244 1471 1164.5 200.291 7.58602 PNS24243 293 72.6666 0 0 KQK14069 1603 1296.5 9123.56 310.373 KQK14071 474 199.2 133.727 29.6089 ==> SRR7804150.se.tsv <== BRADI_1g14170v3 9910 BRADI_1g53295v3 4294 BRADI_1g59795v3 625 BRADI_1g07683v3 0 BRADI_1g00485v3 22 BRADI_1g20270v3 1893 BRADI_1g74790v3 1871 BRADI_1g09890v3 13 BRADI_1g77505v3 348 BRADI_1g48960v3 2 SRR7804150 completed mapping pipeline successfully