Starting /dee2/code/volunteer_pipeline.sh SRR7804151 current disk space = 1541345161216 free memory = 1414986708 SRR7804151 SRAfilesize ab360bba709901ad5c35cc577ae7c423 SRR7804151.sra SRR7804151.sra file validated SRR7804151 is paired end SRR7804151 is conventional basespace SRR7804151 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804151_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.202 37.0 37.0 37.0 37.0 37.0 2 36.338 37.0 37.0 37.0 37.0 37.0 3 36.3535 37.0 37.0 37.0 37.0 37.0 4 36.505 37.0 37.0 37.0 37.0 37.0 5 36.514 37.0 37.0 37.0 37.0 37.0 6 36.3815 37.0 37.0 37.0 37.0 37.0 7 36.4255 37.0 37.0 37.0 37.0 37.0 8 36.4615 37.0 37.0 37.0 37.0 37.0 9 36.574 37.0 37.0 37.0 37.0 37.0 10-14 36.4913 37.0 37.0 37.0 37.0 37.0 15-19 36.4708 37.0 37.0 37.0 37.0 37.0 20-24 36.463 37.0 37.0 37.0 37.0 37.0 25-29 36.4115 37.0 37.0 37.0 37.0 37.0 30-34 36.4257 37.0 37.0 37.0 37.0 37.0 35-39 36.4144 37.0 37.0 37.0 37.0 37.0 40-44 36.4298 37.0 37.0 37.0 37.0 37.0 45-49 36.384 37.0 37.0 37.0 37.0 37.0 50-54 36.3874 37.0 37.0 37.0 37.0 37.0 55-59 36.33710000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.32 37.0 37.0 37.0 37.0 37.0 65-69 36.2668 37.0 37.0 37.0 37.0 37.0 70-74 36.2254 37.0 37.0 37.0 37.0 37.0 75-79 36.1864 37.0 37.0 37.0 37.0 37.0 80-84 36.222300000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.1902 37.0 37.0 37.0 37.0 37.0 90-94 36.2015 37.0 37.0 37.0 37.0 37.0 95-99 36.125 37.0 37.0 37.0 37.0 37.0 100-104 36.1211 37.0 37.0 37.0 37.0 37.0 105-109 36.0861 37.0 37.0 37.0 37.0 37.0 110-114 36.067400000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.036500000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.9525 37.0 37.0 37.0 37.0 37.0 125-129 35.8918 37.0 37.0 37.0 37.0 37.0 130-134 35.8491 37.0 37.0 37.0 37.0 37.0 135-139 35.784800000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.7486 37.0 37.0 37.0 37.0 37.0 145-149 35.7931 37.0 37.0 37.0 37.0 37.0 150-151 35.207 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 1.0 25 1.0 26 3.0 27 9.0 28 12.0 29 20.0 30 25.0 31 46.0 32 64.0 33 89.0 34 143.0 35 339.0 36 2883.0 37 363.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.925000000000004 11.475 9.475 36.125 2 26.663331665832917 14.607303651825912 29.989994997498748 28.73936968484242 3 22.650000000000002 18.175 24.474999999999998 34.699999999999996 4 25.95 25.8 21.8 26.450000000000003 5 27.0 27.900000000000002 21.224999999999998 23.875 6 25.4 30.025000000000002 21.575 23.0 7 19.6 23.825 36.475 20.1 8 22.45 22.7 25.974999999999998 28.875 9 21.2 22.175 29.7 26.924999999999997 10-14 23.955000000000002 25.369999999999997 24.445 26.229999999999997 15-19 24.9 24.645 24.275 26.179999999999996 20-24 23.895 24.5 24.7 26.905 25-29 24.8 23.74 24.725 26.735 30-34 24.465 24.69 24.005000000000003 26.840000000000003 35-39 24.895 24.005000000000003 24.37 26.729999999999997 40-44 24.48 24.165 24.224999999999998 27.13 45-49 24.365000000000002 24.19 24.5 26.945000000000004 50-54 24.8 24.095 24.605 26.5 55-59 24.65 24.305 24.104999999999997 26.939999999999998 60-64 24.715 24.29 24.235 26.76 65-69 24.605 23.5 24.990000000000002 26.905 70-74 24.8 23.765 24.805 26.63 75-79 25.3 23.615 23.97 27.115000000000002 80-84 24.905 23.56 24.65 26.884999999999998 85-89 24.615000000000002 24.38 24.224999999999998 26.779999999999998 90-94 25.64 23.755000000000003 24.490000000000002 26.115 95-99 25.21 23.36 24.285 27.145000000000003 100-104 25.14 23.880000000000003 23.810000000000002 27.169999999999998 105-109 25.169999999999998 23.93 23.845 27.055 110-114 25.735000000000003 23.465 23.935000000000002 26.865 115-119 24.645 23.9 23.835 27.62 120-124 25.435000000000002 24.044999999999998 23.515 27.005000000000003 125-129 24.995 23.215 24.555 27.235 130-134 26.255 23.075000000000003 23.715 26.955000000000002 135-139 25.6 23.885 23.57 26.945000000000004 140-144 25.8 23.555 23.485 27.16 145-149 25.72 23.05 23.775 27.455000000000002 150-151 26.075 23.0125 22.975 27.9375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 1.0 26 1.0 27 4.0 28 4.5 29 3.0 30 3.5 31 3.5 32 6.0 33 12.5 34 20.0 35 25.5 36 34.5 37 49.5 38 60.5 39 79.0 40 107.5 41 121.0 42 138.0 43 160.0 44 171.5 45 171.0 46 178.0 47 182.0 48 164.0 49 159.5 50 156.0 51 135.0 52 126.0 53 131.0 54 113.5 55 96.0 56 88.0 57 89.0 58 88.0 59 85.0 60 93.0 61 100.5 62 91.0 63 78.0 64 76.5 65 75.5 66 80.5 67 69.0 68 65.0 69 57.5 70 47.5 71 48.5 72 36.0 73 27.0 74 26.5 75 21.0 76 11.5 77 10.0 78 8.5 79 3.0 80 0.0 81 2.0 82 2.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.1 #Duplication Level Percentage of deduplicated Percentage of total 1 94.04888416578109 88.5 2 5.63230605738576 10.6 3 0.3188097768331562 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.4875 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.6125 0.0 0.0 0.0 0.0 124-125 0.775 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 1.025 0.0 0.0 0.0 0.0 130-131 1.0875 0.0 0.0 0.0 0.0 132-133 1.25 0.0 0.0 0.0 0.0 134-135 1.4 0.0 0.0 0.0 0.0 136-137 1.5375 0.0 0.0 0.0 0.0 138-139 1.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804151 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804151_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.20825 37.0 37.0 37.0 37.0 37.0 2 36.0585 37.0 37.0 37.0 37.0 37.0 3 35.9865 37.0 37.0 37.0 37.0 37.0 4 36.2585 37.0 37.0 37.0 37.0 37.0 5 36.1135 37.0 37.0 37.0 37.0 37.0 6 36.189 37.0 37.0 37.0 37.0 37.0 7 35.971 37.0 37.0 37.0 37.0 37.0 8 36.1795 37.0 37.0 37.0 37.0 37.0 9 36.042 37.0 37.0 37.0 37.0 37.0 10-14 36.1053 37.0 37.0 37.0 37.0 37.0 15-19 36.000299999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.0169 37.0 37.0 37.0 37.0 37.0 25-29 35.987 37.0 37.0 37.0 37.0 37.0 30-34 35.9321 37.0 37.0 37.0 37.0 37.0 35-39 35.87760000000001 37.0 37.0 37.0 37.0 37.0 40-44 35.8986 37.0 37.0 37.0 37.0 37.0 45-49 35.8097 37.0 37.0 37.0 37.0 37.0 50-54 35.8026 37.0 37.0 37.0 37.0 37.0 55-59 35.7561 37.0 37.0 37.0 37.0 37.0 60-64 35.7537 37.0 37.0 37.0 37.0 37.0 65-69 35.659800000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.7064 37.0 37.0 37.0 37.0 37.0 75-79 35.6061 37.0 37.0 37.0 37.0 37.0 80-84 35.669 37.0 37.0 37.0 37.0 37.0 85-89 35.617399999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.57019999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.605000000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.4889 37.0 37.0 37.0 37.0 37.0 105-109 35.5004 37.0 37.0 37.0 37.0 37.0 110-114 35.30159999999999 37.0 37.0 37.0 32.2 37.0 115-119 35.2952 37.0 37.0 37.0 34.6 37.0 120-124 35.3165 37.0 37.0 37.0 34.6 37.0 125-129 35.2515 37.0 37.0 37.0 34.6 37.0 130-134 35.3589 37.0 37.0 37.0 37.0 37.0 135-139 35.188599999999994 37.0 37.0 37.0 32.2 37.0 140-144 35.2132 37.0 37.0 37.0 29.8 37.0 145-149 35.0224 37.0 37.0 37.0 25.0 37.0 150-151 34.50325 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 4.0 15 7.0 16 4.0 17 1.0 18 2.0 19 0.0 20 6.0 21 5.0 22 7.0 23 5.0 24 4.0 25 8.0 26 16.0 27 19.0 28 26.0 29 20.0 30 40.0 31 39.0 32 70.0 33 129.0 34 214.0 35 644.0 36 2537.0 37 188.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.404553415061294 18.21366024518389 11.033274956217163 31.34851138353765 2 32.475 21.5 25.124999999999996 20.9 3 24.375 24.3 26.125 25.2 4 28.475 28.299999999999997 18.275 24.95 5 28.749999999999996 30.349999999999998 18.8 22.1 6 25.674999999999997 33.15 18.275 22.900000000000002 7 24.25 19.525000000000002 31.75 24.474999999999998 8 26.375 22.25 21.3 30.075000000000003 9 23.225 22.875 24.175 29.725 10-14 27.43 24.575 21.5 26.495 15-19 26.88 24.275 22.365 26.479999999999997 20-24 26.634999999999998 24.335 22.31 26.72 25-29 27.505000000000003 24.11 21.915000000000003 26.47 30-34 26.685 24.565 22.16 26.590000000000003 35-39 26.529999999999998 24.555 22.155 26.76 40-44 27.529999999999998 24.515 21.43 26.525 45-49 27.034999999999997 24.065 22.255 26.645000000000003 50-54 26.825 24.035 22.650000000000002 26.490000000000002 55-59 27.495000000000005 23.82 22.400000000000002 26.284999999999997 60-64 27.005000000000003 24.135 22.41 26.450000000000003 65-69 27.36 23.7 22.57 26.369999999999997 70-74 26.83 24.36 21.98 26.83 75-79 27.22 24.04 22.445 26.295 80-84 27.63 24.04 22.395 25.935000000000002 85-89 27.339999999999996 23.535 22.919999999999998 26.205000000000002 90-94 27.155 24.485 22.5 25.86 95-99 27.46 24.285 22.21 26.045 100-104 28.16 23.305 22.74 25.795 105-109 26.825 23.794999999999998 22.919999999999998 26.46 110-114 27.38 24.2 22.33 26.090000000000003 115-119 27.22 24.095 22.43 26.255 120-124 27.125 23.97 22.919999999999998 25.985000000000003 125-129 27.375 24.154999999999998 22.720000000000002 25.75 130-134 27.495000000000005 24.525 22.66 25.319999999999997 135-139 27.715 24.865000000000002 22.35 25.069999999999997 140-144 27.51 24.495 22.485 25.509999999999998 145-149 27.384999999999998 24.625 22.78 25.21 150-151 27.500000000000004 25.0125 21.712500000000002 25.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.5 25 0.5 26 0.5 27 0.5 28 1.0 29 2.5 30 5.0 31 8.0 32 10.0 33 7.5 34 11.0 35 18.0 36 21.0 37 27.0 38 41.0 39 59.5 40 78.0 41 106.0 42 126.0 43 138.0 44 147.0 45 152.5 46 160.0 47 158.5 48 145.0 49 139.5 50 135.5 51 124.0 52 125.0 53 122.5 54 118.5 55 110.5 56 87.5 57 85.0 58 96.5 59 103.5 60 106.0 61 106.5 62 109.5 63 110.5 64 103.0 65 96.5 66 102.0 67 91.5 68 76.5 69 79.5 70 83.0 71 67.5 72 41.0 73 37.0 74 38.0 75 21.5 76 10.0 77 10.5 78 10.0 79 4.5 80 2.0 81 2.0 82 1.5 83 0.5 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 1.0 95 1.0 96 1.0 97 1.5 98 0.5 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 93.841642228739 88.0 2 5.785123966942149 10.85 3 0.2932551319648094 0.8250000000000001 4 0.053319114902692616 0.2 5 0.026659557451346308 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.4875 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.6125 0.0 0.0 0.0 0.0 124-125 0.775 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 1.0375 0.0 0.0 0.0 0.0 130-131 1.1125 0.0 0.0 0.0 0.0 132-133 1.275 0.0 0.0 0.0 0.0 134-135 1.4125 0.0 0.0 0.0 0.0 136-137 1.5375 0.0 0.0 0.0 0.0 138-139 1.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATCTT 10 0.006830828 145.0 8 CAAATCT 10 0.006830828 145.0 7 >>END_MODULE Read 1571813 spots for SRR7804151.sra Written 1571813 spots for SRR7804151.sra Read 1571813 spots for SRR7804151.sra Written 1571813 spots for SRR7804151.sra Read 1571813 spots for SRR7804151.sra Written 1571813 spots for SRR7804151.sra Read 1571813 spots for SRR7804151.sra Written 1571813 spots for SRR7804151.sra Read 1571813 spots for SRR7804151.sra Written 1571813 spots for SRR7804151.sra Read 1571813 spots for SRR7804151.sra Written 1571813 spots for SRR7804151.sra Read 1571813 spots for SRR7804151.sra Written 1571813 spots for SRR7804151.sra Read 1571813 spots for SRR7804151.sra Written 1571813 spots for SRR7804151.sra Read 1571813 spots for SRR7804151.sra Written 1571813 spots for SRR7804151.sra Read 1571813 spots for SRR7804151.sra Written 1571813 spots for SRR7804151.sra Read 1571813 spots for SRR7804151.sra Written 1571813 spots for SRR7804151.sra Read 1571813 spots for SRR7804151.sra Written 1571813 spots for SRR7804151.sra Read 1571813 spots for SRR7804151.sra Written 1571813 spots for SRR7804151.sra Read 1571823 spots for SRR7804151.sra Written 1571823 spots for SRR7804151.sra Read 1571813 spots for SRR7804151.sra Written 1571813 spots for SRR7804151.sra Read 1571813 spots for SRR7804151.sra Written 1571813 spots for SRR7804151.sra Read 1571813 spots for SRR7804151.sra Written 1571813 spots for SRR7804151.sra Read 1571813 spots for SRR7804151.sra Written 1571813 spots for SRR7804151.sra Read 1571813 spots for SRR7804151.sra Written 1571813 spots for SRR7804151.sra Read 1571813 spots for SRR7804151.sra Written 1571813 spots for SRR7804151.sra SRR ids: ['SRR7804151.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3966_coc SRR7804151.sra spots: 31436270 blocks: [[1, 1571813], [1571814, 3143626], [3143627, 4715439], [4715440, 6287252], [6287253, 7859065], [7859066, 9430878], [9430879, 11002691], [11002692, 12574504], [12574505, 14146317], [14146318, 15718130], [15718131, 17289943], [17289944, 18861756], [18861757, 20433569], [20433570, 22005382], [22005383, 23577195], [23577196, 25149008], [25149009, 26720821], [26720822, 28292634], [28292635, 29864447], [29864448, 31436270]] SRR7804151 file size 10631020 SRR7804151 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804151 SRR7804151_1.fastq SRR7804151_2.fastq Input file: SRR7804151_1.fastq Paired file: SRR7804151_2.fastq trimmed: SRR7804151-trimmed-pair1.fastq, SRR7804151-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:18:22 2024 >> started Sat Dec 7 17:18:56 2024 >> done (34.372s) 31436270 read pairs processed; of these: 76 ( 0.00%) short read pairs filtered out after trimming by size control 599 ( 0.00%) empty read pairs filtered out after trimming by size control 31435595 (100.00%) read pairs available; of these: 897800 ( 2.86%) trimmed read pairs available after processing 30537795 (97.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 11 0.00% 20 13 0.00% 21 10 0.00% 22 14 0.00% 23 20 0.00% 24 13 0.00% 25 25 0.00% 26 23 0.00% 27 27 0.00% 28 36 0.00% 29 25 0.00% 30 27 0.00% 31 30 0.00% 32 25 0.00% 33 40 0.00% 34 30 0.00% 35 51 0.00% 36 31 0.00% 37 42 0.00% 38 51 0.00% 39 32 0.00% 40 52 0.00% 41 34 0.00% 42 43 0.00% 43 41 0.00% 44 49 0.00% 45 52 0.00% 46 53 0.00% 47 57 0.00% 48 47 0.00% 49 55 0.00% 50 50 0.00% 51 64 0.00% 52 57 0.00% 53 50 0.00% 54 65 0.00% 55 80 0.00% 56 70 0.00% 57 62 0.00% 58 76 0.00% 59 75 0.00% 60 63 0.00% 61 78 0.00% 62 98 0.00% 63 101 0.00% 64 95 0.00% 65 93 0.00% 66 110 0.00% 67 98 0.00% 68 118 0.00% 69 152 0.00% 70 133 0.00% 71 151 0.00% 72 170 0.00% 73 184 0.00% 74 224 0.00% 75 223 0.00% 76 244 0.00% 77 272 0.00% 78 320 0.00% 79 336 0.00% 80 393 0.00% 81 409 0.00% 82 565 0.00% 83 547 0.00% 84 626 0.00% 85 708 0.00% 86 814 0.00% 87 827 0.00% 88 993 0.00% 89 1048 0.00% 90 1174 0.00% 91 1311 0.00% 92 1482 0.00% 93 1636 0.01% 94 1830 0.01% 95 1935 0.01% 96 2214 0.01% 97 2331 0.01% 98 2572 0.01% 99 2688 0.01% 100 3062 0.01% 101 3419 0.01% 102 3566 0.01% 103 3944 0.01% 104 4317 0.01% 105 4754 0.02% 106 5007 0.02% 107 5220 0.02% 108 5547 0.02% 109 5822 0.02% 110 6095 0.02% 111 6741 0.02% 112 7297 0.02% 113 7778 0.02% 114 8339 0.03% 115 8876 0.03% 116 9278 0.03% 117 9776 0.03% 118 10193 0.03% 119 10553 0.03% 120 11132 0.04% 121 11555 0.04% 122 12350 0.04% 123 13256 0.04% 124 14072 0.04% 125 15261 0.05% 126 15832 0.05% 127 16222 0.05% 128 16814 0.05% 129 17085 0.05% 130 18064 0.06% 131 18749 0.06% 132 19995 0.06% 133 21165 0.07% 134 22141 0.07% 135 23147 0.07% 136 23961 0.08% 137 25197 0.08% 138 25523 0.08% 139 26596 0.08% 140 27314 0.09% 141 28105 0.09% 142 29630 0.09% 143 31110 0.10% 144 32562 0.10% 145 34226 0.11% 146 35123 0.11% 147 35821 0.11% 148 37491 0.12% 149 38001 0.12% 150 39634 0.13% 151 30537795 97.14% 31435595 reads passed initial QC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=25 prefix-density=0.84 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=34 fanout-score=15.67 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=4.8 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=4.00 fanout-score-rank=18 prefix-density=0.66 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=43.95 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.5 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804151 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:20:17 Started mapping on | Dec 07 17:20:17 Finished on | Dec 07 17:25:04 Mapping speed, Million of reads per hour | 394.31 Number of input reads | 31435595 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 29162559 Uniquely mapped reads % | 92.77% Average mapped length | 299.72 Number of splices: Total | 30228480 Number of splices: Annotated (sjdb) | 28593497 Number of splices: GT/AG | 29808998 Number of splices: GC/AG | 338918 Number of splices: AT/AC | 12693 Number of splices: Non-canonical | 67871 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 410740 % of reads mapped to multiple loci | 1.31% Number of reads mapped to too many loci | 28005 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.14% % of reads unmapped: other | 0.70% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1862296 1862296 1862296 N_multimapping 410740 410740 410740 N_noFeature 827322 28288600 1118790 N_ambiguous 710814 5182 128282 UnstrandedReadsAssigned:27624423 PositiveStrandReadsAssigned:868777 NegativeStrandReadsAssigned:27915487 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804151 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804151-trimmed-pair1.fastq SRR7804151-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,435,595 reads, 28,123,413 reads pseudoaligned [quant] estimated average fragment length: 301.775 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52973 SRR7804151.ke.tsv 35125 SRR7804151.se.tsv 88098 total ==> SRR7804151.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 635.851 0 0 PNS24247 1044 743.225 153.388 9.23224 PNS24249 1928 1627.22 206.742 5.68352 PNS24246 1044 743.225 153.388 9.23224 PNS24248 1044 743.225 153.388 9.23224 PNS24244 1471 1170.22 212.094 8.10766 PNS24243 293 73.5092 0 0 KQK14069 1603 1302.22 8331.81 286.213 KQK14071 474 201.173 142.911 31.7783 ==> SRR7804151.se.tsv <== BRADI_1g14170v3 9143 BRADI_1g53295v3 5438 BRADI_1g59795v3 712 BRADI_1g07683v3 0 BRADI_1g00485v3 15 BRADI_1g20270v3 966 BRADI_1g74790v3 1469 BRADI_1g09890v3 5 BRADI_1g77505v3 388 BRADI_1g48960v3 0 SRR7804151 completed mapping pipeline successfully