Starting /dee2/code/volunteer_pipeline.sh SRR7804154 current disk space = 1541351886848 free memory = 1411588672 SRR7804154 SRAfilesize e1cb837e9a4e0f2e3413fd9b8f4758ea SRR7804154.sra SRR7804154.sra file validated SRR7804154 is paired end SRR7804154 is conventional basespace SRR7804154 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804154_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.13825 37.0 37.0 37.0 37.0 37.0 2 36.262 37.0 37.0 37.0 37.0 37.0 3 36.321 37.0 37.0 37.0 37.0 37.0 4 36.501 37.0 37.0 37.0 37.0 37.0 5 36.4585 37.0 37.0 37.0 37.0 37.0 6 36.517 37.0 37.0 37.0 37.0 37.0 7 36.2255 37.0 37.0 37.0 37.0 37.0 8 36.439 37.0 37.0 37.0 37.0 37.0 9 36.391 37.0 37.0 37.0 37.0 37.0 10-14 36.4678 37.0 37.0 37.0 37.0 37.0 15-19 36.4527 37.0 37.0 37.0 37.0 37.0 20-24 36.4099 37.0 37.0 37.0 37.0 37.0 25-29 36.341699999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.3451 37.0 37.0 37.0 37.0 37.0 35-39 36.361599999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.3057 37.0 37.0 37.0 37.0 37.0 45-49 36.197900000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.2181 37.0 37.0 37.0 37.0 37.0 55-59 36.167899999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.1283 37.0 37.0 37.0 37.0 37.0 65-69 36.107899999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.035999999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.0533 37.0 37.0 37.0 37.0 37.0 80-84 36.01219999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.9756 37.0 37.0 37.0 37.0 37.0 90-94 35.867000000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.8311 37.0 37.0 37.0 37.0 37.0 100-104 35.7387 37.0 37.0 37.0 37.0 37.0 105-109 35.7656 37.0 37.0 37.0 37.0 37.0 110-114 35.8014 37.0 37.0 37.0 37.0 37.0 115-119 35.5834 37.0 37.0 37.0 37.0 37.0 120-124 35.5332 37.0 37.0 37.0 37.0 37.0 125-129 35.5663 37.0 37.0 37.0 37.0 37.0 130-134 35.4579 37.0 37.0 37.0 37.0 37.0 135-139 35.3019 37.0 37.0 37.0 32.2 37.0 140-144 35.3383 37.0 37.0 37.0 29.8 37.0 145-149 35.15559999999999 37.0 37.0 37.0 25.0 37.0 150-151 34.58725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 1.0 24 0.0 25 4.0 26 9.0 27 12.0 28 27.0 29 24.0 30 48.0 31 57.0 32 59.0 33 120.0 34 179.0 35 460.0 36 2771.0 37 225.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.15627347858753 12.82243926872026 10.217881292261458 44.80340596043075 2 23.974999999999998 19.55 36.9 19.575 3 21.5 25.624999999999996 23.9 28.975 4 25.15 32.75 18.9 23.200000000000003 5 26.825 31.95 22.0 19.225 6 19.375 33.425 23.75 23.45 7 15.725 20.075000000000003 42.15 22.05 8 21.0 18.7 27.125 33.175 9 19.325 18.65 30.9 31.125000000000004 10-14 23.04 26.68 23.895 26.384999999999998 15-19 23.59 25.585 24.72 26.105 20-24 23.31 25.314999999999998 25.180000000000003 26.195 25-29 23.44 25.365 25.330000000000002 25.865 30-34 23.095 26.1 24.82 25.985000000000003 35-39 23.465 25.775 24.66 26.1 40-44 23.31 25.185000000000002 24.665 26.840000000000003 45-49 23.135 25.619999999999997 24.490000000000002 26.755000000000003 50-54 23.14 25.52 24.3 27.04 55-59 24.39 24.91 24.51 26.19 60-64 23.56 24.84 24.635 26.965 65-69 23.68 25.605 24.29 26.424999999999997 70-74 23.51 25.869999999999997 24.755 25.865 75-79 24.11 24.665 24.645 26.58 80-84 23.905 25.045 24.875 26.174999999999997 85-89 24.375 24.47 24.66 26.495 90-94 24.165 24.55 24.505 26.779999999999998 95-99 24.895 24.759999999999998 24.85 25.495 100-104 24.455 24.610000000000003 24.645 26.290000000000003 105-109 24.37 24.79 24.89 25.95 110-114 24.535 25.319999999999997 24.26 25.885 115-119 24.54 24.455 24.66 26.345000000000002 120-124 24.03 25.19 24.07 26.71 125-129 24.385 25.080000000000002 24.14 26.395000000000003 130-134 24.959999999999997 24.87 24.0 26.169999999999998 135-139 24.45 24.805 24.135 26.61 140-144 25.16 24.759999999999998 24.15 25.929999999999996 145-149 25.235000000000003 24.37 24.03 26.365 150-151 25.2875 24.325 23.6125 26.775 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.5 25 3.5 26 4.0 27 5.5 28 7.0 29 5.5 30 5.0 31 8.5 32 14.5 33 21.0 34 28.5 35 48.0 36 63.5 37 77.0 38 89.5 39 91.5 40 105.5 41 134.5 42 154.0 43 158.5 44 159.5 45 160.5 46 170.0 47 193.5 48 201.5 49 184.5 50 176.5 51 159.5 52 134.5 53 119.0 54 107.5 55 100.5 56 91.5 57 87.5 58 77.0 59 71.5 60 70.5 61 61.5 62 57.5 63 58.0 64 62.0 65 64.0 66 54.5 67 46.5 68 52.0 69 53.0 70 38.5 71 25.5 72 26.5 73 29.5 74 25.0 75 15.0 76 13.0 77 10.0 78 6.5 79 6.5 80 2.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.05 #Duplication Level Percentage of deduplicated Percentage of total 1 96.01769911504425 92.225 2 3.8521603331598127 7.3999999999999995 3 0.1301405517959396 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0125 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.037500000000000006 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.0875 0.0 0.0 0.0 0.0 110-111 0.1125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.125 0.0 0.0 0.0 0.0 116-117 0.1375 0.0 0.0 0.0 0.0 118-119 0.15 0.0 0.0 0.0 0.0 120-121 0.15 0.0 0.0 0.0 0.0 122-123 0.225 0.0 0.0 0.0 0.0 124-125 0.2875 0.0 0.0 0.0 0.0 126-127 0.3625 0.0 0.0 0.0 0.0 128-129 0.475 0.0 0.0 0.0 0.0 130-131 0.6125 0.0 0.0 0.0 0.0 132-133 0.6625000000000001 0.0 0.0 0.0 0.0 134-135 0.7375 0.0 0.0 0.0 0.0 136-137 0.8875 0.0 0.0 0.0 0.0 138-139 1.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTCGA 10 0.006830828 145.0 6 >>END_MODULE SRR7804154 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804154_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4105 37.0 37.0 37.0 37.0 37.0 2 36.0815 37.0 37.0 37.0 37.0 37.0 3 36.272 37.0 37.0 37.0 37.0 37.0 4 36.3135 37.0 37.0 37.0 37.0 37.0 5 36.388 37.0 37.0 37.0 37.0 37.0 6 36.224 37.0 37.0 37.0 37.0 37.0 7 36.094 37.0 37.0 37.0 37.0 37.0 8 36.386 37.0 37.0 37.0 37.0 37.0 9 36.234 37.0 37.0 37.0 37.0 37.0 10-14 36.2411 37.0 37.0 37.0 37.0 37.0 15-19 36.2174 37.0 37.0 37.0 37.0 37.0 20-24 36.1841 37.0 37.0 37.0 37.0 37.0 25-29 36.1434 37.0 37.0 37.0 37.0 37.0 30-34 36.0768 37.0 37.0 37.0 37.0 37.0 35-39 36.039699999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.032 37.0 37.0 37.0 37.0 37.0 45-49 35.8998 37.0 37.0 37.0 37.0 37.0 50-54 35.93900000000001 37.0 37.0 37.0 37.0 37.0 55-59 35.9036 37.0 37.0 37.0 37.0 37.0 60-64 35.757600000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.6902 37.0 37.0 37.0 37.0 37.0 70-74 35.6755 37.0 37.0 37.0 37.0 37.0 75-79 35.581199999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.588899999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.53090000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.376999999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.4037 37.0 37.0 37.0 37.0 37.0 100-104 35.2944 37.0 37.0 37.0 34.6 37.0 105-109 35.254599999999996 37.0 37.0 37.0 29.8 37.0 110-114 35.123 37.0 37.0 37.0 25.0 37.0 115-119 35.059900000000006 37.0 37.0 37.0 25.0 37.0 120-124 35.01370000000001 37.0 37.0 37.0 25.0 37.0 125-129 34.818400000000004 37.0 37.0 37.0 25.0 37.0 130-134 34.9176 37.0 37.0 37.0 25.0 37.0 135-139 34.6563 37.0 37.0 37.0 25.0 37.0 140-144 34.516200000000005 37.0 37.0 37.0 25.0 37.0 145-149 34.4108 37.0 37.0 37.0 25.0 37.0 150-151 33.65175 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 0.0 16 1.0 17 2.0 18 1.0 19 1.0 20 2.0 21 4.0 22 6.0 23 2.0 24 9.0 25 4.0 26 15.0 27 14.0 28 20.0 29 24.0 30 53.0 31 74.0 32 92.0 33 154.0 34 306.0 35 799.0 36 2325.0 37 90.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.95 11.55 12.525 44.975 2 28.875 18.4 32.25 20.474999999999998 3 23.275000000000002 21.9 27.750000000000004 27.075 4 27.950000000000003 30.55 16.775000000000002 24.725 5 26.424999999999997 33.15 16.85 23.575 6 18.825 35.65 21.224999999999998 24.3 7 20.075000000000003 14.05 37.5 28.375 8 21.125 19.35 24.625 34.9 9 24.2 20.849999999999998 25.6 29.349999999999998 10-14 25.44 24.48 21.959999999999997 28.12 15-19 26.25 24.044999999999998 23.36 26.345000000000002 20-24 25.665 25.35 22.455 26.529999999999998 25-29 26.169999999999998 24.09 23.41 26.33 30-34 25.865 24.345 23.46 26.33 35-39 26.235000000000003 23.555 23.585 26.625 40-44 26.205000000000002 24.375 22.715 26.705000000000002 45-49 26.669999999999998 24.044999999999998 23.305 25.979999999999997 50-54 26.93 24.575 22.939999999999998 25.555 55-59 26.584999999999997 24.05 23.419999999999998 25.945 60-64 26.745 24.02 23.025000000000002 26.21 65-69 26.484999999999996 23.845 23.549999999999997 26.119999999999997 70-74 27.295 23.48 23.705000000000002 25.52 75-79 26.745 24.25 23.39 25.615 80-84 26.66 24.43 23.080000000000002 25.83 85-89 26.99 23.765 23.055 26.19 90-94 26.715 24.16 23.505000000000003 25.619999999999997 95-99 27.26 24.0 22.99 25.75 100-104 26.884999999999998 24.905 23.169999999999998 25.040000000000003 105-109 26.700000000000003 24.485 23.04 25.775 110-114 27.439999999999998 24.23 23.005 25.324999999999996 115-119 26.815 24.08 23.625 25.480000000000004 120-124 27.435 24.47 23.305 24.79 125-129 27.48 24.099999999999998 23.45 24.97 130-134 27.425 24.19 23.56 24.825 135-139 26.950000000000003 24.39 23.98 24.68 140-144 27.13 24.965 23.169999999999998 24.735 145-149 27.21 24.75 23.205000000000002 24.834999999999997 150-151 27.212500000000002 23.9 24.0375 24.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 2.0 23 2.5 24 1.0 25 1.5 26 2.5 27 3.0 28 4.0 29 6.5 30 8.0 31 10.0 32 12.5 33 15.5 34 19.0 35 27.0 36 44.5 37 50.0 38 47.5 39 67.5 40 91.0 41 103.0 42 120.0 43 127.0 44 140.5 45 153.0 46 159.5 47 174.0 48 164.5 49 150.0 50 137.5 51 136.5 52 134.5 53 123.0 54 117.5 55 105.0 56 94.0 57 89.5 58 85.5 59 80.0 60 86.5 61 89.0 62 76.5 63 77.0 64 86.5 65 99.0 66 92.0 67 75.5 68 78.0 69 66.5 70 68.5 71 67.5 72 49.0 73 46.5 74 36.5 75 27.0 76 20.5 77 12.5 78 11.5 79 8.5 80 4.5 81 2.0 82 0.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.5 88 1.5 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.475 #Duplication Level Percentage of deduplicated Percentage of total 1 95.88897617177271 91.55 2 3.8491751767478397 7.35 3 0.13092432573972246 0.375 4 0.07855459544383347 0.3 5 0.0 0.0 6 0.0 0.0 7 0.02618486514794449 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02618486514794449 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTC 10 0.25 No Hit CGAAGCCTCAAACTCGTCAGAGAATCAATGGCGTCCTCCGCTAGAGCTGC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.025 108-109 0.1375 0.0 0.0 0.0 0.025 110-111 0.15 0.0 0.0 0.0 0.025 112-113 0.15 0.0 0.0 0.0 0.025 114-115 0.15 0.0 0.0 0.0 0.025 116-117 0.16249999999999998 0.0 0.0 0.0 0.025 118-119 0.175 0.0 0.0 0.0 0.025 120-121 0.175 0.0 0.0 0.0 0.025 122-123 0.25 0.0 0.0 0.0 0.025 124-125 0.3125 0.0 0.0 0.0 0.025 126-127 0.3875 0.0 0.0 0.0 0.025 128-129 0.5 0.0 0.0 0.0 0.025 130-131 0.6375 0.0 0.0 0.0 0.025 132-133 0.6875 0.0 0.0 0.0 0.025 134-135 0.75 0.0 0.0 0.0 0.025 136-137 0.8875 0.0 0.0 0.0 0.025 138-139 1.025 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1780956 spots for SRR7804154.sra Written 1780956 spots for SRR7804154.sra Read 1780956 spots for SRR7804154.sra Written 1780956 spots for SRR7804154.sra Read 1780956 spots for SRR7804154.sra Written 1780956 spots for SRR7804154.sra Read 1780956 spots for SRR7804154.sra Written 1780956 spots for SRR7804154.sra Read 1780956 spots for SRR7804154.sra Written 1780956 spots for SRR7804154.sra Read 1780956 spots for SRR7804154.sra Written 1780956 spots for SRR7804154.sra Read 1780956 spots for SRR7804154.sra Written 1780956 spots for SRR7804154.sra Read 1780956 spots for SRR7804154.sra Written 1780956 spots for SRR7804154.sra Read 1780956 spots for SRR7804154.sra Written 1780956 spots for SRR7804154.sra Read 1780956 spots for SRR7804154.sra Written 1780956 spots for SRR7804154.sra Read 1780956 spots for SRR7804154.sra Written 1780956 spots for SRR7804154.sra Read 1780956 spots for SRR7804154.sra Written 1780956 spots for SRR7804154.sra Read 1780956 spots for SRR7804154.sra Written 1780956 spots for SRR7804154.sra Read 1780956 spots for SRR7804154.sra Written 1780956 spots for SRR7804154.sra Read 1780956 spots for SRR7804154.sra Written 1780956 spots for SRR7804154.sra Read 1780962 spots for SRR7804154.sra Written 1780962 spots for SRR7804154.sra Read 1780956 spots for SRR7804154.sra Written 1780956 spots for SRR7804154.sra Read 1780956 spots for SRR7804154.sra Written 1780956 spots for SRR7804154.sra Read 1780956 spots for SRR7804154.sra Written 1780956 spots for SRR7804154.sra Read 1780956 spots for SRR7804154.sra Written 1780956 spots for SRR7804154.sra SRR ids: ['SRR7804154.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ss8pfuch SRR7804154.sra spots: 35619126 blocks: [[1, 1780956], [1780957, 3561912], [3561913, 5342868], [5342869, 7123824], [7123825, 8904780], [8904781, 10685736], [10685737, 12466692], [12466693, 14247648], [14247649, 16028604], [16028605, 17809560], [17809561, 19590516], [19590517, 21371472], [21371473, 23152428], [23152429, 24933384], [24933385, 26714340], [26714341, 28495296], [28495297, 30276252], [30276253, 32057208], [32057209, 33838164], [33838165, 35619126]] SRR7804154 file size 12048452 SRR7804154 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804154 SRR7804154_1.fastq SRR7804154_2.fastq Input file: SRR7804154_1.fastq Paired file: SRR7804154_2.fastq trimmed: SRR7804154-trimmed-pair1.fastq, SRR7804154-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:25:02 2024 >> started Sat Dec 7 17:25:46 2024 >> done (43.851s) 35619126 read pairs processed; of these: 70 ( 0.00%) short read pairs filtered out after trimming by size control 374 ( 0.00%) empty read pairs filtered out after trimming by size control 35618682 (100.00%) read pairs available; of these: 620123 ( 1.74%) trimmed read pairs available after processing 34998559 (98.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 11 0.00% 20 17 0.00% 21 16 0.00% 22 22 0.00% 23 21 0.00% 24 27 0.00% 25 23 0.00% 26 35 0.00% 27 35 0.00% 28 25 0.00% 29 36 0.00% 30 40 0.00% 31 36 0.00% 32 52 0.00% 33 43 0.00% 34 51 0.00% 35 61 0.00% 36 47 0.00% 37 57 0.00% 38 54 0.00% 39 65 0.00% 40 58 0.00% 41 65 0.00% 42 66 0.00% 43 78 0.00% 44 62 0.00% 45 81 0.00% 46 91 0.00% 47 59 0.00% 48 87 0.00% 49 68 0.00% 50 80 0.00% 51 79 0.00% 52 65 0.00% 53 105 0.00% 54 101 0.00% 55 103 0.00% 56 81 0.00% 57 97 0.00% 58 104 0.00% 59 103 0.00% 60 113 0.00% 61 107 0.00% 62 114 0.00% 63 145 0.00% 64 123 0.00% 65 129 0.00% 66 152 0.00% 67 133 0.00% 68 132 0.00% 69 160 0.00% 70 164 0.00% 71 193 0.00% 72 215 0.00% 73 206 0.00% 74 184 0.00% 75 202 0.00% 76 237 0.00% 77 247 0.00% 78 275 0.00% 79 307 0.00% 80 327 0.00% 81 369 0.00% 82 389 0.00% 83 398 0.00% 84 487 0.00% 85 522 0.00% 86 574 0.00% 87 584 0.00% 88 625 0.00% 89 820 0.00% 90 833 0.00% 91 901 0.00% 92 1010 0.00% 93 1063 0.00% 94 1279 0.00% 95 1322 0.00% 96 1419 0.00% 97 1554 0.00% 98 1746 0.00% 99 1877 0.01% 100 2047 0.01% 101 2141 0.01% 102 2272 0.01% 103 2597 0.01% 104 2893 0.01% 105 3010 0.01% 106 3301 0.01% 107 3416 0.01% 108 3695 0.01% 109 4086 0.01% 110 4312 0.01% 111 4528 0.01% 112 4927 0.01% 113 5139 0.01% 114 5571 0.02% 115 6010 0.02% 116 6154 0.02% 117 6554 0.02% 118 6964 0.02% 119 7209 0.02% 120 7641 0.02% 121 8241 0.02% 122 8665 0.02% 123 9069 0.03% 124 9683 0.03% 125 9998 0.03% 126 10315 0.03% 127 10988 0.03% 128 11616 0.03% 129 11933 0.03% 130 12818 0.04% 131 13109 0.04% 132 13936 0.04% 133 14227 0.04% 134 14773 0.04% 135 15928 0.04% 136 16414 0.05% 137 16885 0.05% 138 17956 0.05% 139 18386 0.05% 140 19219 0.05% 141 19857 0.06% 142 20775 0.06% 143 21224 0.06% 144 22373 0.06% 145 23389 0.07% 146 24179 0.07% 147 25131 0.07% 148 25916 0.07% 149 26389 0.07% 150 28207 0.08% 151 34998559 98.26% 35618682 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=28 prefix-density=0.28 prefix-fanout=2.2 sequence=TGGGCACACTCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=70.56 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=14.5 sequence=CTTCTTGGCACCACCCTTCAAGTGAGCTGCGGCCTTGTCCTTGTCAGTGAAGACACCAGTGGACTCCACGACATAATCGGCACCAGCCT criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=34 prefix-density=0.75 prefix-fanout=2.5 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=1534.46 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=20.6 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGC SRR7804154 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:27:20 Started mapping on | Dec 07 17:27:20 Finished on | Dec 07 17:34:00 Mapping speed, Million of reads per hour | 320.57 Number of input reads | 35618682 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 33734044 Uniquely mapped reads % | 94.71% Average mapped length | 300.35 Number of splices: Total | 34092375 Number of splices: Annotated (sjdb) | 32055481 Number of splices: GT/AG | 33658447 Number of splices: GC/AG | 366910 Number of splices: AT/AC | 21205 Number of splices: Non-canonical | 45813 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.74 Insertion rate per base | 0.01% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 331516 % of reads mapped to multiple loci | 0.93% Number of reads mapped to too many loci | 14781 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.02% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1553122 1553122 1553122 N_multimapping 331516 331516 331516 N_noFeature 975035 32859039 1290754 N_ambiguous 685623 5304 126687 UnstrandedReadsAssigned:32073386 PositiveStrandReadsAssigned:869701 NegativeStrandReadsAssigned:32316603 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804154 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804154-trimmed-pair1.fastq SRR7804154-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,618,682 reads, 32,526,697 reads pseudoaligned [quant] estimated average fragment length: 344.145 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52973 SRR7804154.ke.tsv 35125 SRR7804154.se.tsv 88098 total ==> SRR7804154.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 594.376 0 0 PNS24247 1044 700.855 132.884 7.4738 PNS24249 1928 1584.85 292.173 7.26688 PNS24246 1044 700.855 132.884 7.4738 PNS24248 1044 700.855 132.884 7.4738 PNS24244 1471 1127.85 174.175 6.08737 PNS24243 293 67.2362 2 1.17253 KQK14069 1603 1259.85 5330.15 166.769 KQK14071 474 181.171 1.46542 0.318838 ==> SRR7804154.se.tsv <== BRADI_1g14170v3 5339 BRADI_1g53295v3 553 BRADI_1g59795v3 369 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 989 BRADI_1g74790v3 588 BRADI_1g09890v3 0 BRADI_1g77505v3 271 BRADI_1g48960v3 1 SRR7804154 completed mapping pipeline successfully