Starting /dee2/code/volunteer_pipeline.sh SRR7804155 current disk space = 1541170024448 free memory = 1458967252 SRR7804155 SRAfilesize f0f4f821904846240fab42c49bdb7dff SRR7804155.sra SRR7804155.sra file validated SRR7804155 is paired end SRR7804155 is conventional basespace SRR7804155 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804155_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9545 37.0 37.0 37.0 37.0 37.0 2 36.166 37.0 37.0 37.0 37.0 37.0 3 36.3445 37.0 37.0 37.0 37.0 37.0 4 36.43 37.0 37.0 37.0 37.0 37.0 5 36.389 37.0 37.0 37.0 37.0 37.0 6 36.4355 37.0 37.0 37.0 37.0 37.0 7 36.229 37.0 37.0 37.0 37.0 37.0 8 36.4335 37.0 37.0 37.0 37.0 37.0 9 36.375 37.0 37.0 37.0 37.0 37.0 10-14 36.448499999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.4487 37.0 37.0 37.0 37.0 37.0 20-24 36.429899999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.337999999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.32769999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.2885 37.0 37.0 37.0 37.0 37.0 40-44 36.2671 37.0 37.0 37.0 37.0 37.0 45-49 36.2133 37.0 37.0 37.0 37.0 37.0 50-54 36.1152 37.0 37.0 37.0 37.0 37.0 55-59 36.134699999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.0927 37.0 37.0 37.0 37.0 37.0 65-69 36.1125 37.0 37.0 37.0 37.0 37.0 70-74 36.03660000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.019 37.0 37.0 37.0 37.0 37.0 80-84 35.9858 37.0 37.0 37.0 37.0 37.0 85-89 35.9423 37.0 37.0 37.0 37.0 37.0 90-94 35.8298 37.0 37.0 37.0 37.0 37.0 95-99 35.739599999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.730599999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.68050000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.633500000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.5237 37.0 37.0 37.0 37.0 37.0 120-124 35.4732 37.0 37.0 37.0 37.0 37.0 125-129 35.5656 37.0 37.0 37.0 37.0 37.0 130-134 35.311099999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.2747 37.0 37.0 37.0 29.8 37.0 140-144 35.2045 37.0 37.0 37.0 29.8 37.0 145-149 34.9585 37.0 37.0 37.0 25.0 37.0 150-151 34.431749999999994 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 4.0 25 3.0 26 5.0 27 13.0 28 26.0 29 40.0 30 38.0 31 44.0 32 95.0 33 121.0 34 194.0 35 513.0 36 2680.0 37 222.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.721525338685396 10.411440040140493 11.51530356246864 43.35173105870547 2 26.85 14.575 32.875 25.7 3 25.525 22.45 22.6 29.425 4 28.9 30.2 16.2 24.7 5 27.450000000000003 31.1 21.325 20.125 6 23.150000000000002 31.15 23.3 22.400000000000002 7 17.65 19.975 39.525 22.85 8 22.775000000000002 18.375 26.85 32.0 9 23.025000000000002 18.9 29.95 28.125 10-14 24.4 25.435000000000002 23.974999999999998 26.19 15-19 25.445 23.825 23.985 26.745 20-24 24.945 24.015 24.195 26.845000000000002 25-29 25.06 23.74 24.59 26.61 30-34 25.35 23.674999999999997 23.73 27.245 35-39 25.335 23.585 24.29 26.790000000000003 40-44 25.115 23.72 24.22 26.945000000000004 45-49 24.915000000000003 23.54 24.13 27.415 50-54 25.580000000000002 23.445 23.325000000000003 27.650000000000002 55-59 25.6 23.275000000000002 23.76 27.365000000000002 60-64 26.08 23.169999999999998 23.49 27.26 65-69 25.564999999999998 23.225 23.925 27.284999999999997 70-74 25.995 23.474999999999998 23.105 27.425 75-79 25.97 23.95 22.765 27.315 80-84 25.455 22.985 23.72 27.839999999999996 85-89 26.21 22.830000000000002 23.175 27.785 90-94 26.56 23.125 22.975 27.339999999999996 95-99 27.07 22.585 23.575 26.77 100-104 26.11 22.79 23.5 27.6 105-109 26.595000000000002 22.425 23.41 27.57 110-114 26.375 23.11 23.419999999999998 27.095000000000002 115-119 26.165 22.49 23.330000000000002 28.015 120-124 26.185000000000002 22.655 23.43 27.73 125-129 26.55 22.49 23.27 27.689999999999998 130-134 27.08 23.415 22.305 27.200000000000003 135-139 27.089999999999996 23.3 22.145 27.465 140-144 27.200000000000003 22.54 22.835 27.425 145-149 26.72 22.575 23.04 27.665 150-151 27.650000000000002 21.75 23.125 27.474999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 2.0 28 1.5 29 2.0 30 4.5 31 5.0 32 5.5 33 13.0 34 17.5 35 27.5 36 38.5 37 42.5 38 54.5 39 72.5 40 94.0 41 106.0 42 126.5 43 152.0 44 154.5 45 153.5 46 146.0 47 142.0 48 148.0 49 142.5 50 131.5 51 127.0 52 121.5 53 105.0 54 96.5 55 90.5 56 98.0 57 109.5 58 101.5 59 111.0 60 119.5 61 123.0 62 122.5 63 107.5 64 98.0 65 90.0 66 86.0 67 89.0 68 81.5 69 62.0 70 54.0 71 49.0 72 37.0 73 35.0 74 33.0 75 22.0 76 11.5 77 6.5 78 7.5 79 5.5 80 3.5 81 2.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.575 #Duplication Level Percentage of deduplicated Percentage of total 1 94.17579481699173 88.125 2 5.102858669516431 9.55 3 0.56104728827144 1.575 4 0.05343307507347048 0.2 5 0.05343307507347048 0.25 6 0.05343307507347048 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGG 6 0.15 No Hit GTCGAAGCTGCCGCCGGGGTAGAGAGGGTCGACGATCTCACCGAGCGGAC 6 0.15 No Hit GAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTGAGCTGAC 5 0.125 No Hit CCGGGTTGTTGGGAGAGATCACATGCATAAATACAACATGAAACAAACGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.025 102-103 0.1375 0.0 0.0 0.0 0.025 104-105 0.15 0.0 0.0 0.0 0.025 106-107 0.16249999999999998 0.0 0.0 0.0 0.025 108-109 0.225 0.0 0.0 0.0 0.025 110-111 0.25 0.0 0.0 0.0 0.025 112-113 0.3 0.0 0.0 0.0 0.025 114-115 0.325 0.0 0.0 0.0 0.025 116-117 0.3625 0.0 0.0 0.0 0.025 118-119 0.4125 0.0 0.0 0.0 0.025 120-121 0.4375 0.0 0.0 0.0 0.025 122-123 0.475 0.0 0.0 0.0 0.025 124-125 0.4875 0.0 0.0 0.0 0.025 126-127 0.625 0.0 0.0 0.0 0.025 128-129 0.6875 0.0 0.0 0.0 0.025 130-131 0.7625 0.0 0.0 0.0 0.025 132-133 0.85 0.0 0.0 0.0 0.025 134-135 0.9375 0.0 0.0 0.0 0.025 136-137 1.0375 0.0 0.0 0.0 0.025 138-139 1.0875 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGCCGT 10 0.006830828 145.0 1 AAAAAGC 10 0.006830828 145.0 2 CTACTTT 10 0.006830828 145.0 8 >>END_MODULE SRR7804155 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804155_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 56 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.226 37.0 37.0 37.0 37.0 37.0 2 35.9795 37.0 37.0 37.0 37.0 37.0 3 36.0625 37.0 37.0 37.0 37.0 37.0 4 36.203 37.0 37.0 37.0 37.0 37.0 5 36.235 37.0 37.0 37.0 37.0 37.0 6 36.17 37.0 37.0 37.0 37.0 37.0 7 36.011 37.0 37.0 37.0 37.0 37.0 8 36.1945 37.0 37.0 37.0 37.0 37.0 9 36.2015 37.0 37.0 37.0 37.0 37.0 10-14 36.1607 37.0 37.0 37.0 37.0 37.0 15-19 36.0623 37.0 37.0 37.0 37.0 37.0 20-24 36.0446 37.0 37.0 37.0 37.0 37.0 25-29 35.9805 37.0 37.0 37.0 37.0 37.0 30-34 35.94199999999999 37.0 37.0 37.0 37.0 37.0 35-39 35.8482 37.0 37.0 37.0 37.0 37.0 40-44 35.8621 37.0 37.0 37.0 37.0 37.0 45-49 35.73780000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.786899999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.6857 37.0 37.0 37.0 37.0 37.0 60-64 35.6126 37.0 37.0 37.0 37.0 37.0 65-69 35.57170000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.487 37.0 37.0 37.0 37.0 37.0 75-79 35.501900000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.4645 37.0 37.0 37.0 37.0 37.0 85-89 35.3226 37.0 37.0 37.0 34.6 37.0 90-94 35.217 37.0 37.0 37.0 27.4 37.0 95-99 35.0064 37.0 37.0 37.0 25.0 37.0 100-104 35.0062 37.0 37.0 37.0 25.0 37.0 105-109 35.0103 37.0 37.0 37.0 25.0 37.0 110-114 34.7976 37.0 37.0 37.0 25.0 37.0 115-119 34.73440000000001 37.0 37.0 37.0 25.0 37.0 120-124 34.715799999999994 37.0 37.0 37.0 25.0 37.0 125-129 34.546299999999995 37.0 37.0 37.0 25.0 37.0 130-134 34.547599999999996 37.0 37.0 37.0 25.0 37.0 135-139 34.2376 37.0 37.0 37.0 25.0 37.0 140-144 34.061 37.0 37.0 37.0 25.0 37.0 145-149 33.9925 37.0 37.0 37.0 25.0 37.0 150-151 33.366 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 3.0 15 2.0 16 1.0 17 2.0 18 1.0 19 2.0 20 3.0 21 6.0 22 3.0 23 7.0 24 11.0 25 10.0 26 7.0 27 19.0 28 22.0 29 39.0 30 51.0 31 64.0 32 116.0 33 182.0 34 397.0 35 912.0 36 2059.0 37 77.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.324999999999996 11.1 14.249999999999998 42.325 2 28.725 16.35 29.475 25.45 3 26.775 19.3 26.174999999999997 27.750000000000004 4 28.549999999999997 28.749999999999996 15.875 26.825 5 30.349999999999998 29.25 17.549999999999997 22.85 6 24.2 32.9 17.875 25.025 7 23.25 13.775 33.050000000000004 29.925 8 22.25 20.525 21.65 35.575 9 25.224999999999998 19.6 24.525 30.65 10-14 26.5 23.835 20.765 28.9 15-19 27.889999999999997 22.35 21.255 28.505000000000003 20-24 27.61 22.84 21.349999999999998 28.199999999999996 25-29 27.47 22.6 21.72 28.21 30-34 27.185 23.095 21.39 28.33 35-39 27.534999999999997 23.02 21.385 28.060000000000002 40-44 28.26 23.125 20.580000000000002 28.035 45-49 27.93 22.125 21.595 28.349999999999998 50-54 28.095 22.509999999999998 21.029999999999998 28.365000000000002 55-59 28.01 22.365 20.925 28.7 60-64 27.425 22.36 21.5 28.715000000000003 65-69 27.13 22.505 21.595 28.77 70-74 27.855 21.965 21.235 28.945 75-79 27.785 21.415 21.515 29.285 80-84 28.37 21.790000000000003 21.029999999999998 28.810000000000002 85-89 27.735 22.314999999999998 21.215 28.735 90-94 28.035 22.515 20.885 28.565 95-99 28.199999999999996 22.085 20.919999999999998 28.794999999999998 100-104 27.82 22.375 21.47 28.335 105-109 27.075 22.655 21.37 28.9 110-114 28.125 22.245 21.13 28.499999999999996 115-119 28.475 22.515 20.794999999999998 28.215 120-124 28.299999999999997 22.75 21.12 27.83 125-129 27.99 22.3 21.61 28.1 130-134 28.199999999999996 22.56 21.005 28.235 135-139 27.79 22.825 21.255 28.13 140-144 28.349999999999998 22.775000000000002 21.529999999999998 27.345000000000002 145-149 28.110000000000003 22.835 21.625 27.43 150-151 28.375 23.525 20.962500000000002 27.1375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 1.0 28 1.0 29 1.5 30 2.0 31 5.0 32 5.0 33 4.0 34 8.5 35 12.0 36 16.0 37 27.0 38 41.0 39 58.0 40 55.5 41 52.0 42 77.5 43 96.0 44 107.5 45 115.5 46 112.0 47 123.0 48 137.5 49 117.5 50 104.5 51 104.0 52 93.0 53 100.0 54 99.5 55 112.5 56 111.0 57 99.5 58 118.0 59 127.5 60 126.5 61 130.0 62 149.0 63 147.0 64 126.0 65 119.0 66 117.0 67 111.0 68 109.0 69 107.5 70 97.0 71 80.0 72 68.0 73 67.5 74 61.0 75 38.0 76 23.5 77 20.0 78 14.0 79 8.5 80 6.5 81 6.5 82 4.0 83 1.0 84 2.0 85 1.5 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 1.0 96 0.5 97 0.0 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.0 #Duplication Level Percentage of deduplicated Percentage of total 1 93.34239130434783 85.875 2 5.46195652173913 10.05 3 0.7880434782608695 2.175 4 0.16304347826086957 0.6 5 0.08152173913043478 0.375 6 0.1358695652173913 0.75 7 0.02717391304347826 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 7 0.17500000000000002 No Hit CTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCT 6 0.15 No Hit CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 6 0.15 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 6 0.15 No Hit CTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGTGATGGCT 6 0.15 No Hit GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 6 0.15 No Hit CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGC 5 0.125 No Hit CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 5 0.125 No Hit CCTCTCTCCGTGGAGTCTCTCCTGAAGCAGATCGAGTACCTGATCCGCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.30000000000000004 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.4875 0.0 0.0 0.0 0.0 122-123 0.525 0.0 0.0 0.0 0.0 124-125 0.5375000000000001 0.0 0.0 0.0 0.0 126-127 0.675 0.0 0.0 0.0 0.0 128-129 0.7375 0.0 0.0 0.0 0.0 130-131 0.8125 0.0 0.0 0.0 0.0 132-133 0.9 0.0 0.0 0.0 0.0 134-135 0.975 0.0 0.0 0.0 0.0 136-137 1.0875 0.0 0.0 0.0 0.0 138-139 1.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1489848 spots for SRR7804155.sra Written 1489848 spots for SRR7804155.sra Read 1489848 spots for SRR7804155.sra Written 1489848 spots for SRR7804155.sra Read 1489848 spots for SRR7804155.sra Written 1489848 spots for SRR7804155.sra Read 1489848 spots for SRR7804155.sra Written 1489848 spots for SRR7804155.sra Read 1489848 spots for SRR7804155.sra Written 1489848 spots for SRR7804155.sra Read 1489848 spots for SRR7804155.sra Written 1489848 spots for SRR7804155.sra Read 1489848 spots for SRR7804155.sra Written 1489848 spots for SRR7804155.sra Read 1489848 spots for SRR7804155.sra Written 1489848 spots for SRR7804155.sra Read 1489848 spots for SRR7804155.sra Written 1489848 spots for SRR7804155.sra Read 1489856 spots for SRR7804155.sra Written 1489856 spots for SRR7804155.sra Read 1489848 spots for SRR7804155.sra Written 1489848 spots for SRR7804155.sra Read 1489848 spots for SRR7804155.sra Written 1489848 spots for SRR7804155.sra Read 1489848 spots for SRR7804155.sra Written 1489848 spots for SRR7804155.sra Read 1489848 spots for SRR7804155.sra Written 1489848 spots for SRR7804155.sra Read 1489848 spots for SRR7804155.sra Written 1489848 spots for SRR7804155.sra Read 1489848 spots for SRR7804155.sra Written 1489848 spots for SRR7804155.sra Read 1489848 spots for SRR7804155.sra Written 1489848 spots for SRR7804155.sra Read 1489848 spots for SRR7804155.sra Written 1489848 spots for SRR7804155.sra Read 1489848 spots for SRR7804155.sra Written 1489848 spots for SRR7804155.sra Read 1489848 spots for SRR7804155.sra Written 1489848 spots for SRR7804155.sra SRR ids: ['SRR7804155.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qvdh52z5 SRR7804155.sra spots: 29796968 blocks: [[1, 1489848], [1489849, 2979696], [2979697, 4469544], [4469545, 5959392], [5959393, 7449240], [7449241, 8939088], [8939089, 10428936], [10428937, 11918784], [11918785, 13408632], [13408633, 14898480], [14898481, 16388328], [16388329, 17878176], [17878177, 19368024], [19368025, 20857872], [20857873, 22347720], [22347721, 23837568], [23837569, 25327416], [25327417, 26817264], [26817265, 28307112], [28307113, 29796968]] SRR7804155 file size 10075514 SRR7804155 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804155 SRR7804155_1.fastq SRR7804155_2.fastq Input file: SRR7804155_1.fastq Paired file: SRR7804155_2.fastq trimmed: SRR7804155-trimmed-pair1.fastq, SRR7804155-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:31:18 2024 >> started Sat Dec 7 17:31:56 2024 >> done (38.131s) 29796968 read pairs processed; of these: 85 ( 0.00%) short read pairs filtered out after trimming by size control 971 ( 0.00%) empty read pairs filtered out after trimming by size control 29795912 (100.00%) read pairs available; of these: 702657 ( 2.36%) trimmed read pairs available after processing 29093255 (97.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 19 0.00% 20 18 0.00% 21 19 0.00% 22 21 0.00% 23 18 0.00% 24 28 0.00% 25 30 0.00% 26 29 0.00% 27 37 0.00% 28 33 0.00% 29 30 0.00% 30 61 0.00% 31 33 0.00% 32 43 0.00% 33 37 0.00% 34 41 0.00% 35 40 0.00% 36 49 0.00% 37 47 0.00% 38 54 0.00% 39 56 0.00% 40 49 0.00% 41 57 0.00% 42 56 0.00% 43 64 0.00% 44 64 0.00% 45 67 0.00% 46 58 0.00% 47 71 0.00% 48 62 0.00% 49 78 0.00% 50 73 0.00% 51 60 0.00% 52 85 0.00% 53 68 0.00% 54 84 0.00% 55 70 0.00% 56 93 0.00% 57 74 0.00% 58 85 0.00% 59 75 0.00% 60 84 0.00% 61 110 0.00% 62 107 0.00% 63 129 0.00% 64 97 0.00% 65 85 0.00% 66 115 0.00% 67 116 0.00% 68 130 0.00% 69 147 0.00% 70 161 0.00% 71 185 0.00% 72 183 0.00% 73 193 0.00% 74 191 0.00% 75 206 0.00% 76 243 0.00% 77 265 0.00% 78 287 0.00% 79 316 0.00% 80 332 0.00% 81 401 0.00% 82 411 0.00% 83 461 0.00% 84 552 0.00% 85 588 0.00% 86 680 0.00% 87 704 0.00% 88 755 0.00% 89 852 0.00% 90 1001 0.00% 91 1110 0.00% 92 1204 0.00% 93 1351 0.00% 94 1492 0.01% 95 1622 0.01% 96 1782 0.01% 97 1980 0.01% 98 2095 0.01% 99 2373 0.01% 100 2469 0.01% 101 2802 0.01% 102 3057 0.01% 103 3022 0.01% 104 3530 0.01% 105 3587 0.01% 106 4123 0.01% 107 4341 0.01% 108 4564 0.02% 109 4876 0.02% 110 5130 0.02% 111 5393 0.02% 112 5886 0.02% 113 6393 0.02% 114 6747 0.02% 115 7232 0.02% 116 7464 0.03% 117 7814 0.03% 118 8068 0.03% 119 8764 0.03% 120 8961 0.03% 121 9375 0.03% 122 10299 0.03% 123 10443 0.04% 124 11285 0.04% 125 11837 0.04% 126 12276 0.04% 127 12748 0.04% 128 13230 0.04% 129 13631 0.05% 130 14302 0.05% 131 14988 0.05% 132 15895 0.05% 133 16208 0.05% 134 17276 0.06% 135 18107 0.06% 136 18809 0.06% 137 19322 0.06% 138 19974 0.07% 139 21096 0.07% 140 21070 0.07% 141 21884 0.07% 142 22649 0.08% 143 23245 0.08% 144 24240 0.08% 145 25331 0.09% 146 26434 0.09% 147 27540 0.09% 148 28816 0.10% 149 28965 0.10% 150 29918 0.10% 151 29093255 97.64% 29795912 reads passed initial QC criterion=sequence-density sequence-density=1.88 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=19 prefix-density=1.93 prefix-fanout=2.1 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=15.64 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=1.8 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=1.52 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=20 prefix-density=1.62 prefix-fanout=2.6 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCAGGCAGCCCGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=100.72 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=6.2 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR7804155 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:32:58 Started mapping on | Dec 07 17:32:58 Finished on | Dec 07 17:37:50 Mapping speed, Million of reads per hour | 367.35 Number of input reads | 29795912 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 27954937 Uniquely mapped reads % | 93.82% Average mapped length | 300.08 Number of splices: Total | 28108368 Number of splices: Annotated (sjdb) | 26694550 Number of splices: GT/AG | 27742729 Number of splices: GC/AG | 327224 Number of splices: AT/AC | 6047 Number of splices: Non-canonical | 32368 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.37 Insertion rate per base | 0.01% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 316499 % of reads mapped to multiple loci | 1.06% Number of reads mapped to too many loci | 39392 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.98% % of reads unmapped: other | 1.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1524476 1524476 1524476 N_multimapping 316499 316499 316499 N_noFeature 695049 27091945 858192 N_ambiguous 853534 4049 155035 UnstrandedReadsAssigned:26406354 PositiveStrandReadsAssigned:858943 NegativeStrandReadsAssigned:26941710 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804155 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804155-trimmed-pair1.fastq SRR7804155-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,795,912 reads, 27,057,570 reads pseudoaligned [quant] estimated average fragment length: 339.654 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,011 rounds 52973 SRR7804155.ke.tsv 35125 SRR7804155.se.tsv 88098 total ==> SRR7804155.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 598.397 0 0 PNS24247 1044 705.346 51.5478 3.10945 PNS24249 1928 1589.35 75.4922 2.02097 PNS24246 1044 705.346 51.5478 3.10945 PNS24248 1044 705.346 51.5478 3.10945 PNS24244 1471 1132.35 42.8643 1.61062 PNS24243 293 71.529 0 0 KQK14069 1603 1264.35 4786.74 161.083 KQK14071 474 185.769 51.8758 11.8814 ==> SRR7804155.se.tsv <== BRADI_1g14170v3 5146 BRADI_1g53295v3 104 BRADI_1g59795v3 960 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 278 BRADI_1g74790v3 126 BRADI_1g09890v3 0 BRADI_1g77505v3 321 BRADI_1g48960v3 0 SRR7804155 completed mapping pipeline successfully