Starting /dee2/code/volunteer_pipeline.sh SRR7804156 current disk space = 1541337071616 free memory = 1458063120 SRR7804156 SRAfilesize be9e7dc78af1a3d0a74617dfcfc20bd2 SRR7804156.sra SRR7804156.sra file validated SRR7804156 is paired end SRR7804156 is conventional basespace SRR7804156 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804156_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0605 37.0 37.0 37.0 37.0 37.0 2 36.2045 37.0 37.0 37.0 37.0 37.0 3 36.3505 37.0 37.0 37.0 37.0 37.0 4 36.556 37.0 37.0 37.0 37.0 37.0 5 36.5125 37.0 37.0 37.0 37.0 37.0 6 36.447 37.0 37.0 37.0 37.0 37.0 7 36.315 37.0 37.0 37.0 37.0 37.0 8 36.573 37.0 37.0 37.0 37.0 37.0 9 36.349 37.0 37.0 37.0 37.0 37.0 10-14 36.5384 37.0 37.0 37.0 37.0 37.0 15-19 36.494099999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.4843 37.0 37.0 37.0 37.0 37.0 25-29 36.4263 37.0 37.0 37.0 37.0 37.0 30-34 36.3956 37.0 37.0 37.0 37.0 37.0 35-39 36.368100000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.3176 37.0 37.0 37.0 37.0 37.0 45-49 36.2659 37.0 37.0 37.0 37.0 37.0 50-54 36.3058 37.0 37.0 37.0 37.0 37.0 55-59 36.202 37.0 37.0 37.0 37.0 37.0 60-64 36.2002 37.0 37.0 37.0 37.0 37.0 65-69 36.2192 37.0 37.0 37.0 37.0 37.0 70-74 36.1423 37.0 37.0 37.0 37.0 37.0 75-79 36.1494 37.0 37.0 37.0 37.0 37.0 80-84 36.0988 37.0 37.0 37.0 37.0 37.0 85-89 36.0274 37.0 37.0 37.0 37.0 37.0 90-94 36.0245 37.0 37.0 37.0 37.0 37.0 95-99 35.913 37.0 37.0 37.0 37.0 37.0 100-104 35.8747 37.0 37.0 37.0 37.0 37.0 105-109 35.837 37.0 37.0 37.0 37.0 37.0 110-114 35.8105 37.0 37.0 37.0 37.0 37.0 115-119 35.6902 37.0 37.0 37.0 37.0 37.0 120-124 35.657399999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.61 37.0 37.0 37.0 37.0 37.0 130-134 35.450300000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.397999999999996 37.0 37.0 37.0 34.6 37.0 140-144 35.3872 37.0 37.0 37.0 34.6 37.0 145-149 35.15 37.0 37.0 37.0 27.4 37.0 150-151 34.64275 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 2.0 24 1.0 25 2.0 26 10.0 27 8.0 28 13.0 29 21.0 30 36.0 31 70.0 32 63.0 33 91.0 34 172.0 35 466.0 36 2810.0 37 234.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.734335839599 11.052631578947368 11.503759398496241 43.70927318295739 2 24.45 18.85 34.300000000000004 22.400000000000002 3 25.674999999999997 23.275000000000002 22.650000000000002 28.4 4 28.65 29.799999999999997 17.724999999999998 23.825 5 26.25 32.0 20.4 21.349999999999998 6 21.775 31.55 23.3 23.375 7 17.275 18.0 41.875 22.85 8 20.825 20.05 26.8 32.324999999999996 9 23.3 17.474999999999998 30.825000000000003 28.4 10-14 24.46 25.740000000000002 23.71 26.090000000000003 15-19 23.974999999999998 25.575 24.05 26.400000000000002 20-24 24.310000000000002 24.495 24.915000000000003 26.279999999999998 25-29 23.635 24.18 25.490000000000002 26.695 30-34 24.195 24.46 25.03 26.314999999999998 35-39 24.165 24.52 24.465 26.85 40-44 24.32 24.27 24.565 26.845000000000002 45-49 24.95 24.4 24.54 26.11 50-54 24.685000000000002 24.355 24.435000000000002 26.525 55-59 25.019999999999996 24.305 24.18 26.495 60-64 24.97 23.935000000000002 24.415 26.68 65-69 24.955 24.099999999999998 24.07 26.875 70-74 24.75 24.425 24.66 26.165 75-79 24.915000000000003 24.085 23.94 27.060000000000002 80-84 25.395 23.755000000000003 24.01 26.840000000000003 85-89 25.445 24.48 23.724999999999998 26.35 90-94 25.335 24.275 23.885 26.505000000000003 95-99 25.245 23.635 24.36 26.76 100-104 26.115 23.03 24.085 26.77 105-109 25.545 23.715 23.75 26.99 110-114 25.929999999999996 23.810000000000002 23.905 26.355 115-119 25.509999999999998 22.915 24.4 27.175 120-124 25.674999999999997 23.605 24.01 26.71 125-129 24.795 23.48 24.47 27.255000000000003 130-134 25.94 23.169999999999998 24.295 26.595000000000002 135-139 25.995 23.465 23.724999999999998 26.815 140-144 26.174999999999997 23.21 23.56 27.055 145-149 25.580000000000002 23.41 23.9 27.11 150-151 26.887499999999996 22.95 22.55 27.6125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 1.5 27 1.5 28 1.0 29 3.0 30 8.5 31 13.5 32 16.5 33 20.5 34 24.5 35 29.5 36 43.5 37 58.0 38 64.5 39 83.0 40 113.0 41 139.5 42 161.5 43 171.0 44 164.0 45 153.0 46 152.0 47 174.0 48 169.0 49 152.5 50 144.5 51 123.5 52 119.0 53 118.5 54 113.5 55 107.5 56 99.0 57 85.0 58 80.0 59 78.5 60 84.0 61 88.0 62 87.5 63 81.5 64 71.0 65 69.0 66 63.5 67 76.0 68 80.0 69 62.5 70 45.0 71 35.0 72 40.0 73 39.5 74 29.0 75 19.5 76 10.5 77 8.0 78 9.0 79 4.0 80 2.5 81 3.0 82 1.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.675 #Duplication Level Percentage of deduplicated Percentage of total 1 95.76691925790436 91.625 2 3.99790958975699 7.6499999999999995 3 0.1829108962633917 0.525 4 0.052260256075254766 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.55 0.0 0.0 0.0 0.0 124-125 0.5874999999999999 0.0 0.0 0.0 0.0 126-127 0.7 0.0 0.0 0.0 0.0 128-129 0.775 0.0 0.0 0.0 0.0 130-131 0.8625 0.0 0.0 0.0 0.0 132-133 0.9375 0.0 0.0 0.0 0.0 134-135 1.0375 0.0 0.0 0.0 0.0 136-137 1.1375 0.0 0.0 0.0 0.0 138-139 1.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTCTTC 10 0.006830828 145.0 5 >>END_MODULE SRR7804156 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804156_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5145 37.0 37.0 37.0 37.0 37.0 2 36.2445 37.0 37.0 37.0 37.0 37.0 3 36.269 37.0 37.0 37.0 37.0 37.0 4 36.4285 37.0 37.0 37.0 37.0 37.0 5 36.459 37.0 37.0 37.0 37.0 37.0 6 36.2875 37.0 37.0 37.0 37.0 37.0 7 36.3295 37.0 37.0 37.0 37.0 37.0 8 36.458 37.0 37.0 37.0 37.0 37.0 9 36.4115 37.0 37.0 37.0 37.0 37.0 10-14 36.399899999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.3677 37.0 37.0 37.0 37.0 37.0 20-24 36.3058 37.0 37.0 37.0 37.0 37.0 25-29 36.2421 37.0 37.0 37.0 37.0 37.0 30-34 36.228899999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.186899999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.198699999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.1485 37.0 37.0 37.0 37.0 37.0 50-54 36.060700000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.08579999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.9597 37.0 37.0 37.0 37.0 37.0 65-69 35.9013 37.0 37.0 37.0 37.0 37.0 70-74 35.907799999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.85850000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.8104 37.0 37.0 37.0 37.0 37.0 85-89 35.7384 37.0 37.0 37.0 37.0 37.0 90-94 35.68679999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.5197 37.0 37.0 37.0 37.0 37.0 100-104 35.472300000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.5462 37.0 37.0 37.0 37.0 37.0 110-114 35.3107 37.0 37.0 37.0 32.2 37.0 115-119 35.2692 37.0 37.0 37.0 29.8 37.0 120-124 35.257400000000004 37.0 37.0 37.0 32.2 37.0 125-129 35.16369999999999 37.0 37.0 37.0 27.4 37.0 130-134 35.0443 37.0 37.0 37.0 25.0 37.0 135-139 34.8756 37.0 37.0 37.0 25.0 37.0 140-144 34.695800000000006 37.0 37.0 37.0 25.0 37.0 145-149 34.597500000000004 37.0 37.0 37.0 25.0 37.0 150-151 33.83425 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 0.0 17 0.0 18 1.0 19 3.0 20 1.0 21 2.0 22 1.0 23 4.0 24 4.0 25 9.0 26 7.0 27 13.0 28 13.0 29 18.0 30 27.0 31 54.0 32 94.0 33 131.0 34 264.0 35 787.0 36 2466.0 37 99.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.775 11.15 13.200000000000001 42.875 2 28.925 17.525 32.75 20.8 3 24.7 22.325 25.3 27.675 4 28.725 27.750000000000004 17.575 25.95 5 27.950000000000003 31.574999999999996 17.349999999999998 23.125 6 21.6 34.925 18.55 24.925 7 22.35 13.750000000000002 37.175000000000004 26.724999999999998 8 22.575 19.975 21.575 35.875 9 23.575 20.3 25.85 30.275000000000002 10-14 25.924999999999997 24.19 22.470000000000002 27.415 15-19 26.645000000000003 23.445 23.085 26.825 20-24 26.3 24.245 22.509999999999998 26.945000000000004 25-29 26.424999999999997 23.825 22.814999999999998 26.935 30-34 26.35 23.62 22.555 27.474999999999998 35-39 27.375 23.515 22.470000000000002 26.640000000000004 40-44 27.139999999999997 23.1 22.735 27.025 45-49 27.01 22.935 22.650000000000002 27.405 50-54 26.505000000000003 23.935000000000002 22.665 26.895000000000003 55-59 26.75 23.474999999999998 22.725 27.05 60-64 26.46 23.880000000000003 22.405 27.255000000000003 65-69 26.61 23.990000000000002 22.645 26.755000000000003 70-74 27.02 23.71 21.915000000000003 27.355 75-79 26.21 23.66 23.169999999999998 26.96 80-84 26.875 22.805 22.905 27.415 85-89 26.790000000000003 23.165 22.919999999999998 27.125 90-94 27.26 23.085 22.689999999999998 26.965 95-99 26.855 24.01 22.655 26.479999999999997 100-104 27.35 23.705000000000002 22.15 26.795 105-109 27.22 23.810000000000002 22.475 26.495 110-114 27.465 23.71 22.39 26.435 115-119 27.334999999999997 23.54 22.5 26.625 120-124 27.169999999999998 23.095 23.064999999999998 26.669999999999998 125-129 27.250000000000004 23.62 22.505 26.625 130-134 27.35 23.630000000000003 22.62 26.400000000000002 135-139 27.79 24.39 22.605 25.215 140-144 27.565 23.925 22.465 26.045 145-149 27.91 23.97 22.445 25.674999999999997 150-151 27.437499999999996 24.4375 22.875 25.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 0.5 26 0.5 27 3.5 28 4.0 29 3.5 30 6.5 31 11.5 32 13.5 33 11.5 34 17.5 35 26.0 36 30.5 37 42.5 38 54.0 39 62.0 40 79.0 41 98.5 42 109.0 43 126.0 44 154.0 45 160.5 46 139.5 47 136.0 48 147.5 49 131.0 50 116.0 51 126.5 52 108.5 53 90.5 54 98.0 55 102.0 56 101.0 57 83.0 58 82.5 59 102.0 60 111.0 61 108.0 62 110.0 63 110.0 64 105.5 65 98.0 66 93.5 67 95.5 68 90.5 69 83.0 70 68.0 71 63.0 72 66.5 73 65.5 74 52.5 75 34.0 76 20.5 77 14.0 78 10.0 79 6.0 80 4.5 81 1.0 82 1.5 83 1.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.05 #Duplication Level Percentage of deduplicated Percentage of total 1 95.42346133613887 90.7 2 4.129405576012625 7.85 3 0.34192530247238295 0.975 4 0.052603892688058915 0.2 5 0.026301946344029457 0.125 6 0.026301946344029457 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATG 6 0.15 No Hit CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.325 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.55 0.0 0.0 0.0 0.0 124-125 0.5874999999999999 0.0 0.0 0.0 0.0 126-127 0.7 0.0 0.0 0.0 0.0 128-129 0.775 0.0 0.0 0.0 0.0 130-131 0.8625 0.0 0.0 0.0 0.0 132-133 0.9375 0.0 0.0 0.0 0.0 134-135 1.0375 0.0 0.0 0.0 0.0 136-137 1.1375 0.0 0.0 0.0 0.0 138-139 1.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCCGT 10 0.006830828 145.0 5 >>END_MODULE Read 1679002 spots for SRR7804156.sra Written 1679002 spots for SRR7804156.sra Read 1679002 spots for SRR7804156.sra Written 1679002 spots for SRR7804156.sra Read 1679002 spots for SRR7804156.sra Written 1679002 spots for SRR7804156.sra Read 1679002 spots for SRR7804156.sra Written 1679002 spots for SRR7804156.sra Read 1679002 spots for SRR7804156.sra Written 1679002 spots for SRR7804156.sra Read 1679002 spots for SRR7804156.sra Written 1679002 spots for SRR7804156.sra Read 1679002 spots for SRR7804156.sra Written 1679002 spots for SRR7804156.sra Read 1679002 spots for SRR7804156.sra Written 1679002 spots for SRR7804156.sra Read 1679002 spots for SRR7804156.sra Written 1679002 spots for SRR7804156.sra Read 1679002 spots for SRR7804156.sra Written 1679002 spots for SRR7804156.sra Read 1679002 spots for SRR7804156.sra Written 1679002 spots for SRR7804156.sra Read 1679002 spots for SRR7804156.sra Written 1679002 spots for SRR7804156.sra Read 1679002 spots for SRR7804156.sra Written 1679002 spots for SRR7804156.sra Read 1679002 spots for SRR7804156.sra Written 1679002 spots for SRR7804156.sra Read 1679002 spots for SRR7804156.sra Written 1679002 spots for SRR7804156.sra Read 1679004 spots for SRR7804156.sra Written 1679004 spots for SRR7804156.sra Read 1679002 spots for SRR7804156.sra Written 1679002 spots for SRR7804156.sra Read 1679002 spots for SRR7804156.sra Written 1679002 spots for SRR7804156.sra Read 1679002 spots for SRR7804156.sra Written 1679002 spots for SRR7804156.sra Read 1679002 spots for SRR7804156.sra Written 1679002 spots for SRR7804156.sra SRR ids: ['SRR7804156.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mx7_59zs SRR7804156.sra spots: 33580042 blocks: [[1, 1679002], [1679003, 3358004], [3358005, 5037006], [5037007, 6716008], [6716009, 8395010], [8395011, 10074012], [10074013, 11753014], [11753015, 13432016], [13432017, 15111018], [15111019, 16790020], [16790021, 18469022], [18469023, 20148024], [20148025, 21827026], [21827027, 23506028], [23506029, 25185030], [25185031, 26864032], [26864033, 28543034], [28543035, 30222036], [30222037, 31901038], [31901039, 33580042]] SRR7804156 file size 11357474 SRR7804156 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804156 SRR7804156_1.fastq SRR7804156_2.fastq Input file: SRR7804156_1.fastq Paired file: SRR7804156_2.fastq trimmed: SRR7804156-trimmed-pair1.fastq, SRR7804156-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:31:56 2024 >> started Sat Dec 7 17:32:38 2024 >> done (41.559s) 33580042 read pairs processed; of these: 72 ( 0.00%) short read pairs filtered out after trimming by size control 892 ( 0.00%) empty read pairs filtered out after trimming by size control 33579078 (100.00%) read pairs available; of these: 740052 ( 2.20%) trimmed read pairs available after processing 32839026 (97.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 14 0.00% 20 9 0.00% 21 18 0.00% 22 16 0.00% 23 29 0.00% 24 17 0.00% 25 17 0.00% 26 30 0.00% 27 28 0.00% 28 26 0.00% 29 21 0.00% 30 35 0.00% 31 33 0.00% 32 40 0.00% 33 31 0.00% 34 38 0.00% 35 48 0.00% 36 39 0.00% 37 44 0.00% 38 62 0.00% 39 60 0.00% 40 58 0.00% 41 46 0.00% 42 58 0.00% 43 71 0.00% 44 57 0.00% 45 63 0.00% 46 72 0.00% 47 72 0.00% 48 61 0.00% 49 67 0.00% 50 62 0.00% 51 69 0.00% 52 75 0.00% 53 77 0.00% 54 85 0.00% 55 74 0.00% 56 84 0.00% 57 89 0.00% 58 83 0.00% 59 91 0.00% 60 108 0.00% 61 94 0.00% 62 105 0.00% 63 124 0.00% 64 109 0.00% 65 121 0.00% 66 131 0.00% 67 113 0.00% 68 161 0.00% 69 151 0.00% 70 174 0.00% 71 178 0.00% 72 204 0.00% 73 194 0.00% 74 201 0.00% 75 243 0.00% 76 248 0.00% 77 271 0.00% 78 320 0.00% 79 339 0.00% 80 347 0.00% 81 402 0.00% 82 473 0.00% 83 515 0.00% 84 549 0.00% 85 637 0.00% 86 725 0.00% 87 785 0.00% 88 920 0.00% 89 935 0.00% 90 1060 0.00% 91 1151 0.00% 92 1330 0.00% 93 1386 0.00% 94 1600 0.00% 95 1740 0.01% 96 1909 0.01% 97 2115 0.01% 98 2193 0.01% 99 2572 0.01% 100 2634 0.01% 101 2807 0.01% 102 3069 0.01% 103 3347 0.01% 104 3609 0.01% 105 3820 0.01% 106 4151 0.01% 107 4474 0.01% 108 4631 0.01% 109 5177 0.02% 110 5386 0.02% 111 5791 0.02% 112 6076 0.02% 113 6511 0.02% 114 7040 0.02% 115 7553 0.02% 116 7769 0.02% 117 8211 0.02% 118 8768 0.03% 119 9068 0.03% 120 9358 0.03% 121 10119 0.03% 122 10570 0.03% 123 11125 0.03% 124 11596 0.03% 125 12031 0.04% 126 13009 0.04% 127 13408 0.04% 128 13758 0.04% 129 14311 0.04% 130 14999 0.04% 131 15700 0.05% 132 16575 0.05% 133 17294 0.05% 134 18352 0.05% 135 18870 0.06% 136 19604 0.06% 137 20704 0.06% 138 20828 0.06% 139 21818 0.06% 140 22525 0.07% 141 22986 0.07% 142 24196 0.07% 143 24983 0.07% 144 26001 0.08% 145 27267 0.08% 146 27737 0.08% 147 28973 0.09% 148 29990 0.09% 149 30737 0.09% 150 31727 0.09% 151 32839026 97.80% 33579078 reads passed initial QC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=23 prefix-density=0.94 prefix-fanout=2.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.12 sequence-density-rank=28 fanout-score=18.80 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=4.4 sequence=TTCTTGGCGAACGTCTCTGGGTCAGCTGACAACCCCGCGGTGTCCCAGCCGTAGTCACCGGGGAACTCGCCGGTCAGGTACGACGGCGTCTGCTCGGAGAACGGGCCCAGGTACTTGGGACGGTCAGGGCCGTACCAGATGCTCTGGGGTGCGCTCTTGACAGTCCGGCGCATGGTGA criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=18 prefix-density=0.90 prefix-fanout=2.8 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCAGGCAGCCCGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=151.71 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=8.3 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804156 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:34:06 Started mapping on | Dec 07 17:34:11 Finished on | Dec 07 17:38:19 Mapping speed, Million of reads per hour | 487.44 Number of input reads | 33579078 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 32266982 Uniquely mapped reads % | 96.09% Average mapped length | 300.25 Number of splices: Total | 34087537 Number of splices: Annotated (sjdb) | 32167744 Number of splices: GT/AG | 33618395 Number of splices: GC/AG | 410895 Number of splices: AT/AC | 15027 Number of splices: Non-canonical | 43220 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.55 Insertion rate per base | 0.01% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 313485 % of reads mapped to multiple loci | 0.93% Number of reads mapped to too many loci | 28516 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.28% % of reads unmapped: other | 0.61% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 998611 998611 998611 N_multimapping 313485 313485 313485 N_noFeature 918085 31291013 1163092 N_ambiguous 881073 5248 151189 UnstrandedReadsAssigned:30467824 PositiveStrandReadsAssigned:970721 NegativeStrandReadsAssigned:30952701 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804156 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804156-trimmed-pair1.fastq SRR7804156-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,579,078 reads, 31,018,092 reads pseudoaligned [quant] estimated average fragment length: 336.383 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52973 SRR7804156.ke.tsv 35125 SRR7804156.se.tsv 88098 total ==> SRR7804156.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 601.811 0 0 PNS24247 1044 708.617 74.1831 4.25759 PNS24249 1928 1592.62 142.025 3.62679 PNS24246 1044 708.617 74.1831 4.25759 PNS24248 1044 708.617 74.1831 4.25759 PNS24244 1471 1135.62 74.4261 2.66541 PNS24243 293 70.0348 0 0 KQK14069 1603 1267.62 676.991 21.7203 KQK14071 474 186.789 8.04623 1.75191 ==> SRR7804156.se.tsv <== BRADI_1g14170v3 715 BRADI_1g53295v3 532 BRADI_1g59795v3 1006 BRADI_1g07683v3 0 BRADI_1g00485v3 38 BRADI_1g20270v3 4369 BRADI_1g74790v3 235 BRADI_1g09890v3 3 BRADI_1g77505v3 409 BRADI_1g48960v3 0 SRR7804156 completed mapping pipeline successfully