Starting /dee2/code/volunteer_pipeline.sh SRR7804157 current disk space = 1541313880064 free memory = 1600989500 SRR7804157 SRAfilesize 8ed80959ae6e31b8d45f59f348ff86a4 SRR7804157.sra SRR7804157.sra file validated SRR7804157 is paired end SRR7804157 is conventional basespace SRR7804157 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804157_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.207 37.0 37.0 37.0 37.0 37.0 2 36.247 37.0 37.0 37.0 37.0 37.0 3 36.4125 37.0 37.0 37.0 37.0 37.0 4 36.473 37.0 37.0 37.0 37.0 37.0 5 36.628 37.0 37.0 37.0 37.0 37.0 6 36.5675 37.0 37.0 37.0 37.0 37.0 7 36.3385 37.0 37.0 37.0 37.0 37.0 8 36.4325 37.0 37.0 37.0 37.0 37.0 9 36.415 37.0 37.0 37.0 37.0 37.0 10-14 36.5028 37.0 37.0 37.0 37.0 37.0 15-19 36.5031 37.0 37.0 37.0 37.0 37.0 20-24 36.4419 37.0 37.0 37.0 37.0 37.0 25-29 36.415800000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.359300000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.3505 37.0 37.0 37.0 37.0 37.0 40-44 36.2802 37.0 37.0 37.0 37.0 37.0 45-49 36.2863 37.0 37.0 37.0 37.0 37.0 50-54 36.2423 37.0 37.0 37.0 37.0 37.0 55-59 36.1884 37.0 37.0 37.0 37.0 37.0 60-64 36.1674 37.0 37.0 37.0 37.0 37.0 65-69 36.136199999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.0736 37.0 37.0 37.0 37.0 37.0 75-79 36.0893 37.0 37.0 37.0 37.0 37.0 80-84 36.113099999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.036199999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.9351 37.0 37.0 37.0 37.0 37.0 95-99 35.8672 37.0 37.0 37.0 37.0 37.0 100-104 35.8396 37.0 37.0 37.0 37.0 37.0 105-109 35.7779 37.0 37.0 37.0 37.0 37.0 110-114 35.8125 37.0 37.0 37.0 37.0 37.0 115-119 35.617200000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.572500000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.5981 37.0 37.0 37.0 37.0 37.0 130-134 35.3846 37.0 37.0 37.0 34.6 37.0 135-139 35.378699999999995 37.0 37.0 37.0 32.2 37.0 140-144 35.2509 37.0 37.0 37.0 32.2 37.0 145-149 35.187799999999996 37.0 37.0 37.0 27.4 37.0 150-151 34.57575 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 5.0 24 2.0 25 7.0 26 4.0 27 11.0 28 22.0 29 18.0 30 35.0 31 50.0 32 67.0 33 117.0 34 187.0 35 468.0 36 2786.0 37 221.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.12036108324975 12.16148445336008 10.180541624874625 37.53761283851554 2 27.150000000000002 16.425 33.25 23.175 3 23.275000000000002 24.025 22.525000000000002 30.175 4 28.050000000000004 28.1 19.85 24.0 5 28.199999999999996 30.65 21.099999999999998 20.05 6 21.2 32.65 22.3 23.849999999999998 7 17.625 18.45 42.225 21.7 8 20.925 19.625 26.474999999999998 32.975 9 22.15 19.075 32.0 26.775 10-14 24.36 25.474999999999998 23.474999999999998 26.69 15-19 24.825 24.65 24.104999999999997 26.419999999999998 20-24 24.404999999999998 24.715 24.185000000000002 26.695 25-29 24.884999999999998 24.13 24.279999999999998 26.705000000000002 30-34 24.555 24.275 24.195 26.974999999999998 35-39 24.64 23.880000000000003 24.265 27.215 40-44 24.240000000000002 24.14 24.52 27.1 45-49 24.965 23.919999999999998 24.47 26.645000000000003 50-54 25.03 24.03 24.03 26.91 55-59 24.375 24.349999999999998 23.93 27.345000000000002 60-64 25.740000000000002 23.79 23.68 26.790000000000003 65-69 24.709999999999997 23.86 23.955000000000002 27.474999999999998 70-74 25.485000000000003 24.099999999999998 23.46 26.955000000000002 75-79 25.75 24.09 23.11 27.05 80-84 25.7 23.575 23.46 27.265 85-89 25.669999999999998 23.380000000000003 23.44 27.51 90-94 25.66 23.95 23.645 26.745 95-99 25.729999999999997 23.51 23.61 27.150000000000002 100-104 26.229999999999997 23.400000000000002 23.925 26.445 105-109 26.125 23.580000000000002 23.79 26.505000000000003 110-114 25.814999999999998 22.555 23.76 27.87 115-119 25.94 23.03 23.855 27.175 120-124 26.56 23.0 23.805 26.634999999999998 125-129 26.224999999999998 23.05 23.415 27.310000000000002 130-134 26.405 23.165 23.66 26.77 135-139 26.064999999999998 23.075000000000003 23.395 27.465 140-144 26.224999999999998 23.380000000000003 23.375 27.02 145-149 26.375 22.67 23.755000000000003 27.200000000000003 150-151 26.687499999999996 22.05 23.4875 27.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 2.0 27 2.0 28 4.0 29 5.0 30 5.5 31 8.0 32 10.5 33 16.5 34 22.5 35 31.5 36 42.5 37 56.5 38 72.5 39 84.0 40 102.5 41 119.5 42 134.0 43 143.0 44 146.5 45 155.5 46 159.5 47 166.0 48 172.0 49 159.0 50 149.0 51 130.5 52 102.5 53 98.5 54 98.5 55 90.0 56 89.5 57 97.5 58 90.0 59 94.5 60 114.0 61 103.0 62 89.5 63 87.5 64 75.0 65 76.5 66 79.5 67 73.0 68 69.0 69 70.5 70 69.5 71 52.5 72 35.5 73 34.0 74 31.0 75 22.5 76 14.5 77 7.5 78 10.0 79 9.5 80 5.0 81 2.5 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.97172579354495 88.075 2 5.414777273939717 10.15 3 0.5868231528407575 1.6500000000000001 4 0.0 0.0 5 0.026673779674579887 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAAGCTGCCGCCGGGGTAGAGAGGGTCGACGATCTCACCGAGCGGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.5875 0.0 0.0 0.0 0.0 116-117 0.6625000000000001 0.0 0.0 0.0 0.0 118-119 0.7124999999999999 0.0 0.0 0.0 0.0 120-121 0.8 0.0 0.0 0.0 0.0 122-123 0.8625 0.0 0.0 0.0 0.0 124-125 0.925 0.0 0.0 0.0 0.0 126-127 0.975 0.0 0.0 0.0 0.0 128-129 1.0499999999999998 0.0 0.0 0.0 0.0 130-131 1.075 0.0 0.0 0.0 0.0 132-133 1.2125 0.0 0.0 0.0 0.0 134-135 1.3125 0.0 0.0 0.0 0.0 136-137 1.375 0.0 0.0 0.0 0.0 138-139 1.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804157 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804157_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.564 37.0 37.0 37.0 37.0 37.0 2 36.1325 37.0 37.0 37.0 37.0 37.0 3 36.2135 37.0 37.0 37.0 37.0 37.0 4 36.2705 37.0 37.0 37.0 37.0 37.0 5 36.336 37.0 37.0 37.0 37.0 37.0 6 36.214 37.0 37.0 37.0 37.0 37.0 7 36.188 37.0 37.0 37.0 37.0 37.0 8 36.448 37.0 37.0 37.0 37.0 37.0 9 36.333 37.0 37.0 37.0 37.0 37.0 10-14 36.3046 37.0 37.0 37.0 37.0 37.0 15-19 36.2664 37.0 37.0 37.0 37.0 37.0 20-24 36.2067 37.0 37.0 37.0 37.0 37.0 25-29 36.197500000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.10209999999999 37.0 37.0 37.0 37.0 37.0 35-39 35.990899999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.978699999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.9225 37.0 37.0 37.0 37.0 37.0 50-54 35.882400000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.8255 37.0 37.0 37.0 37.0 37.0 60-64 35.828599999999994 37.0 37.0 37.0 37.0 37.0 65-69 35.732800000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.6675 37.0 37.0 37.0 37.0 37.0 75-79 35.666999999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.588499999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.4834 37.0 37.0 37.0 37.0 37.0 90-94 35.424400000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.3452 37.0 37.0 37.0 37.0 37.0 100-104 35.278499999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.3313 37.0 37.0 37.0 37.0 37.0 110-114 35.1311 37.0 37.0 37.0 25.0 37.0 115-119 35.0667 37.0 37.0 37.0 25.0 37.0 120-124 34.9865 37.0 37.0 37.0 25.0 37.0 125-129 34.951800000000006 37.0 37.0 37.0 25.0 37.0 130-134 34.8858 37.0 37.0 37.0 25.0 37.0 135-139 34.6317 37.0 37.0 37.0 25.0 37.0 140-144 34.339299999999994 37.0 37.0 37.0 25.0 37.0 145-149 34.2946 37.0 37.0 37.0 25.0 37.0 150-151 33.64475 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 4.0 16 2.0 17 1.0 18 2.0 19 0.0 20 4.0 21 2.0 22 7.0 23 8.0 24 12.0 25 9.0 26 19.0 27 7.0 28 24.0 29 28.0 30 36.0 31 64.0 32 77.0 33 156.0 34 292.0 35 751.0 36 2387.0 37 105.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.375 14.2 12.075 37.35 2 29.625 18.8 28.775000000000002 22.8 3 24.95 22.25 26.375 26.424999999999997 4 28.125 28.65 17.25 25.974999999999998 5 29.125 32.025 17.2 21.65 6 24.125 32.074999999999996 18.5 25.3 7 22.0 15.6 35.525 26.875 8 23.95 19.725 21.075 35.25 9 24.775 21.275 24.15 29.799999999999997 10-14 26.275 23.974999999999998 21.435000000000002 28.315 15-19 26.640000000000004 23.79 22.134999999999998 27.435 20-24 26.455000000000002 23.845 22.400000000000002 27.3 25-29 26.334999999999997 23.735 22.355 27.575 30-34 26.900000000000002 23.395 22.32 27.384999999999998 35-39 26.950000000000003 23.735 22.145 27.169999999999998 40-44 27.034999999999997 23.200000000000003 22.13 27.634999999999998 45-49 27.175 22.745 22.295 27.785 50-54 27.675 22.925 21.91 27.49 55-59 27.13 22.73 22.400000000000002 27.74 60-64 27.250000000000004 23.07 22.040000000000003 27.639999999999997 65-69 26.810000000000002 23.080000000000002 21.94 28.17 70-74 27.644999999999996 23.02 22.040000000000003 27.295 75-79 27.845 22.919999999999998 22.189999999999998 27.045 80-84 27.525 22.835 21.845 27.794999999999998 85-89 27.6 22.884999999999998 21.959999999999997 27.555000000000003 90-94 27.644999999999996 22.835 22.16 27.36 95-99 27.810000000000002 22.84 22.095000000000002 27.255000000000003 100-104 27.465 22.945 22.08 27.51 105-109 28.294999999999998 22.545 21.82 27.339999999999996 110-114 28.265 23.355 22.0 26.38 115-119 27.694999999999997 22.805 21.745 27.755000000000003 120-124 27.750000000000004 23.505000000000003 21.69 27.055 125-129 28.110000000000003 23.335 21.785 26.77 130-134 27.205000000000002 23.26 22.555 26.979999999999997 135-139 27.689999999999998 24.14 22.295 25.874999999999996 140-144 28.505000000000003 23.84 21.755 25.900000000000002 145-149 28.64 23.685000000000002 21.61 26.064999999999998 150-151 28.7375 23.0 21.912499999999998 26.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.5 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 1.0 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 1.0 28 1.0 29 3.0 30 3.5 31 3.0 32 7.0 33 11.5 34 17.0 35 23.5 36 33.0 37 34.0 38 45.5 39 64.5 40 70.5 41 87.5 42 102.0 43 117.5 44 132.5 45 125.5 46 138.0 47 140.0 48 123.5 49 120.0 50 117.5 51 119.0 52 110.5 53 103.5 54 95.5 55 97.5 56 108.5 57 104.5 58 106.5 59 112.5 60 108.5 61 113.5 62 123.5 63 127.5 64 107.5 65 87.5 66 91.5 67 91.5 68 96.0 69 95.5 70 84.5 71 80.0 72 71.0 73 56.0 74 48.0 75 38.5 76 26.5 77 18.0 78 13.0 79 11.5 80 6.5 81 3.5 82 2.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.85894341646555 87.5 2 5.282917672298203 9.85 3 0.6704210244033253 1.875 4 0.16090104585679807 0.6 5 0.0 0.0 6 0.0 0.0 7 0.026816840976133013 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.6125 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.8375 0.0 0.0 0.0 0.0 122-123 0.9125000000000001 0.0 0.0 0.0 0.0 124-125 0.975 0.0 0.0 0.0 0.0 126-127 1.0125 0.0 0.0 0.0 0.0 128-129 1.0750000000000002 0.0 0.0 0.0 0.0 130-131 1.1 0.0 0.0 0.0 0.0 132-133 1.225 0.0 0.0 0.0 0.0 134-135 1.3375 0.0 0.0 0.0 0.0 136-137 1.375 0.0 0.0 0.0 0.0 138-139 1.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1492288 spots for SRR7804157.sra Written 1492288 spots for SRR7804157.sra Read 1492288 spots for SRR7804157.sra Written 1492288 spots for SRR7804157.sra Read 1492288 spots for SRR7804157.sra Written 1492288 spots for SRR7804157.sra Read 1492288 spots for SRR7804157.sra Written 1492288 spots for SRR7804157.sra Read 1492288 spots for SRR7804157.sra Written 1492288 spots for SRR7804157.sra Read 1492288 spots for SRR7804157.sra Written 1492288 spots for SRR7804157.sra Read 1492288 spots for SRR7804157.sra Written 1492288 spots for SRR7804157.sra Read 1492297 spots for SRR7804157.sra Written 1492297 spots for SRR7804157.sra Read 1492288 spots for SRR7804157.sra Written 1492288 spots for SRR7804157.sra Read 1492288 spots for SRR7804157.sra Written 1492288 spots for SRR7804157.sra Read 1492288 spots for SRR7804157.sra Written 1492288 spots for SRR7804157.sra Read 1492288 spots for SRR7804157.sra Written 1492288 spots for SRR7804157.sra Read 1492288 spots for SRR7804157.sra Written 1492288 spots for SRR7804157.sra Read 1492288 spots for SRR7804157.sra Written 1492288 spots for SRR7804157.sra Read 1492288 spots for SRR7804157.sra Written 1492288 spots for SRR7804157.sra Read 1492288 spots for SRR7804157.sra Written 1492288 spots for SRR7804157.sra Read 1492288 spots for SRR7804157.sra Written 1492288 spots for SRR7804157.sra Read 1492288 spots for SRR7804157.sra Written 1492288 spots for SRR7804157.sra Read 1492288 spots for SRR7804157.sra Written 1492288 spots for SRR7804157.sra Read 1492288 spots for SRR7804157.sra Written 1492288 spots for SRR7804157.sra SRR ids: ['SRR7804157.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l0tsx8x3 SRR7804157.sra spots: 29845769 blocks: [[1, 1492288], [1492289, 2984576], [2984577, 4476864], [4476865, 5969152], [5969153, 7461440], [7461441, 8953728], [8953729, 10446016], [10446017, 11938304], [11938305, 13430592], [13430593, 14922880], [14922881, 16415168], [16415169, 17907456], [17907457, 19399744], [19399745, 20892032], [20892033, 22384320], [22384321, 23876608], [23876609, 25368896], [25368897, 26861184], [26861185, 28353472], [28353473, 29845769]] SRR7804157 file size 10092051 SRR7804157 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804157 SRR7804157_1.fastq SRR7804157_2.fastq Input file: SRR7804157_1.fastq Paired file: SRR7804157_2.fastq trimmed: SRR7804157-trimmed-pair1.fastq, SRR7804157-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:34:44 2024 >> started Sat Dec 7 17:35:15 2024 >> done (31.003s) 29845769 read pairs processed; of these: 80 ( 0.00%) short read pairs filtered out after trimming by size control 1450 ( 0.00%) empty read pairs filtered out after trimming by size control 29844239 (99.99%) read pairs available; of these: 680008 ( 2.28%) trimmed read pairs available after processing 29164231 (97.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 22 0.00% 20 14 0.00% 21 18 0.00% 22 19 0.00% 23 18 0.00% 24 20 0.00% 25 20 0.00% 26 21 0.00% 27 27 0.00% 28 30 0.00% 29 32 0.00% 30 37 0.00% 31 32 0.00% 32 39 0.00% 33 48 0.00% 34 40 0.00% 35 57 0.00% 36 42 0.00% 37 54 0.00% 38 53 0.00% 39 47 0.00% 40 56 0.00% 41 51 0.00% 42 45 0.00% 43 57 0.00% 44 69 0.00% 45 66 0.00% 46 78 0.00% 47 69 0.00% 48 70 0.00% 49 65 0.00% 50 65 0.00% 51 80 0.00% 52 63 0.00% 53 81 0.00% 54 81 0.00% 55 98 0.00% 56 93 0.00% 57 91 0.00% 58 102 0.00% 59 97 0.00% 60 116 0.00% 61 102 0.00% 62 103 0.00% 63 113 0.00% 64 107 0.00% 65 123 0.00% 66 123 0.00% 67 106 0.00% 68 153 0.00% 69 144 0.00% 70 140 0.00% 71 169 0.00% 72 175 0.00% 73 217 0.00% 74 210 0.00% 75 227 0.00% 76 276 0.00% 77 280 0.00% 78 276 0.00% 79 328 0.00% 80 337 0.00% 81 407 0.00% 82 444 0.00% 83 485 0.00% 84 585 0.00% 85 618 0.00% 86 668 0.00% 87 719 0.00% 88 811 0.00% 89 890 0.00% 90 988 0.00% 91 1046 0.00% 92 1222 0.00% 93 1286 0.00% 94 1506 0.01% 95 1592 0.01% 96 1654 0.01% 97 1989 0.01% 98 2077 0.01% 99 2368 0.01% 100 2459 0.01% 101 2684 0.01% 102 2885 0.01% 103 3165 0.01% 104 3376 0.01% 105 3691 0.01% 106 3918 0.01% 107 4096 0.01% 108 4453 0.01% 109 4676 0.02% 110 4942 0.02% 111 5293 0.02% 112 5817 0.02% 113 5923 0.02% 114 6414 0.02% 115 6772 0.02% 116 7161 0.02% 117 7549 0.03% 118 7968 0.03% 119 8333 0.03% 120 8725 0.03% 121 9018 0.03% 122 9745 0.03% 123 10077 0.03% 124 10811 0.04% 125 11422 0.04% 126 11908 0.04% 127 12272 0.04% 128 12632 0.04% 129 13373 0.04% 130 13749 0.05% 131 14195 0.05% 132 15100 0.05% 133 15646 0.05% 134 16974 0.06% 135 17405 0.06% 136 18276 0.06% 137 18672 0.06% 138 19069 0.06% 139 19912 0.07% 140 20237 0.07% 141 21090 0.07% 142 21928 0.07% 143 22626 0.08% 144 23827 0.08% 145 24931 0.08% 146 25618 0.09% 147 26904 0.09% 148 27956 0.09% 149 28000 0.09% 150 28979 0.10% 151 29164231 97.72% 29844239 reads passed initial QC criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=18 prefix-density=0.98 prefix-fanout=2.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=11.03 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.2 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=3.11 fanout-score-rank=23 prefix-density=0.94 prefix-fanout=2.9 sequence=CCGCATCACCATGCGCAAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=159.40 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=8.3 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804157 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:36:12 Started mapping on | Dec 07 17:36:13 Finished on | Dec 07 17:40:36 Mapping speed, Million of reads per hour | 408.51 Number of input reads | 29844239 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 27902275 Uniquely mapped reads % | 93.49% Average mapped length | 300.09 Number of splices: Total | 28718180 Number of splices: Annotated (sjdb) | 27159716 Number of splices: GT/AG | 28320965 Number of splices: GC/AG | 347491 Number of splices: AT/AC | 12209 Number of splices: Non-canonical | 37515 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.59 Insertion rate per base | 0.01% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 315491 % of reads mapped to multiple loci | 1.06% Number of reads mapped to too many loci | 30210 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.55% % of reads unmapped: other | 0.80% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1626473 1626473 1626473 N_multimapping 315491 315491 315491 N_noFeature 711465 27083089 912810 N_ambiguous 765210 4361 148493 UnstrandedReadsAssigned:26425600 PositiveStrandReadsAssigned:814825 NegativeStrandReadsAssigned:26840972 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804157 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804157-trimmed-pair1.fastq SRR7804157-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,844,239 reads, 27,092,408 reads pseudoaligned [quant] estimated average fragment length: 335.412 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52973 SRR7804157.ke.tsv 35125 SRR7804157.se.tsv 88098 total ==> SRR7804157.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 602.853 0 0 PNS24247 1044 709.588 56.3508 3.60721 PNS24249 1928 1593.59 148.188 4.2239 PNS24246 1044 709.588 56.3508 3.60721 PNS24248 1044 709.588 56.3508 3.60721 PNS24244 1471 1136.59 51.7597 2.06855 PNS24243 293 70.4069 0 0 KQK14069 1603 1268.59 366.811 13.134 KQK14071 474 187.302 8.1871 1.98548 ==> SRR7804157.se.tsv <== BRADI_1g14170v3 397 BRADI_1g53295v3 258 BRADI_1g59795v3 676 BRADI_1g07683v3 0 BRADI_1g00485v3 49 BRADI_1g20270v3 4149 BRADI_1g74790v3 275 BRADI_1g09890v3 14 BRADI_1g77505v3 340 BRADI_1g48960v3 0 SRR7804157 completed mapping pipeline successfully