Starting /dee2/code/volunteer_pipeline.sh SRR7804158 current disk space = 1541242101760 free memory = 1447574712 SRR7804158 SRAfilesize 785953ca405229a6fd33417e23c31519 SRR7804158.sra SRR7804158.sra file validated SRR7804158 is paired end SRR7804158 is conventional basespace SRR7804158 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804158_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.11025 37.0 37.0 37.0 37.0 37.0 2 36.2525 37.0 37.0 37.0 37.0 37.0 3 36.4095 37.0 37.0 37.0 37.0 37.0 4 36.4605 37.0 37.0 37.0 37.0 37.0 5 36.5205 37.0 37.0 37.0 37.0 37.0 6 36.506 37.0 37.0 37.0 37.0 37.0 7 36.329 37.0 37.0 37.0 37.0 37.0 8 36.4405 37.0 37.0 37.0 37.0 37.0 9 36.4405 37.0 37.0 37.0 37.0 37.0 10-14 36.507600000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.471500000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.3997 37.0 37.0 37.0 37.0 37.0 25-29 36.3406 37.0 37.0 37.0 37.0 37.0 30-34 36.3192 37.0 37.0 37.0 37.0 37.0 35-39 36.3489 37.0 37.0 37.0 37.0 37.0 40-44 36.28529999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.228500000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.2665 37.0 37.0 37.0 37.0 37.0 55-59 36.21410000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.1734 37.0 37.0 37.0 37.0 37.0 65-69 36.117700000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.1267 37.0 37.0 37.0 37.0 37.0 75-79 36.080499999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.03530000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.9396 37.0 37.0 37.0 37.0 37.0 90-94 36.012 37.0 37.0 37.0 37.0 37.0 95-99 35.825 37.0 37.0 37.0 37.0 37.0 100-104 35.8189 37.0 37.0 37.0 37.0 37.0 105-109 35.731100000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.747699999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.6873 37.0 37.0 37.0 37.0 37.0 120-124 35.5455 37.0 37.0 37.0 37.0 37.0 125-129 35.5862 37.0 37.0 37.0 37.0 37.0 130-134 35.4835 37.0 37.0 37.0 37.0 37.0 135-139 35.341699999999996 37.0 37.0 37.0 34.6 37.0 140-144 35.277100000000004 37.0 37.0 37.0 32.2 37.0 145-149 34.964299999999994 37.0 37.0 37.0 25.0 37.0 150-151 34.58225 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 1.0 23 2.0 24 2.0 25 3.0 26 9.0 27 10.0 28 26.0 29 27.0 30 45.0 31 51.0 32 65.0 33 116.0 34 184.0 35 427.0 36 2779.0 37 251.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.3582351466533 12.684883429430934 11.05540235648032 36.90147906743545 2 26.0 16.275000000000002 32.4 25.324999999999996 3 21.575 22.8 25.7 29.925 4 27.675 28.95 20.474999999999998 22.900000000000002 5 26.775 29.875 21.575 21.775 6 21.575 31.924999999999997 23.925 22.575 7 18.25 19.7 41.099999999999994 20.95 8 21.2 19.75 25.7 33.35 9 21.4 19.1 31.225 28.275 10-14 23.93 25.569999999999997 24.465 26.035000000000004 15-19 24.154999999999998 24.145 24.415 27.284999999999997 20-24 23.599999999999998 24.560000000000002 24.975 26.865 25-29 23.9 24.195 24.93 26.974999999999998 30-34 24.135 24.11 25.264999999999997 26.490000000000002 35-39 23.965 24.47 24.635 26.93 40-44 24.19 24.43 25.064999999999998 26.314999999999998 45-49 24.365000000000002 24.095 24.6 26.939999999999998 50-54 24.455 24.215 24.125 27.205000000000002 55-59 24.555 23.974999999999998 24.08 27.389999999999997 60-64 24.63 23.97 24.005000000000003 27.395000000000003 65-69 24.355 23.76 24.095 27.79 70-74 24.7 23.630000000000003 24.32 27.35 75-79 24.240000000000002 23.825 24.13 27.805000000000003 80-84 24.57 24.255 24.104999999999997 27.07 85-89 24.9 23.125 24.485 27.49 90-94 25.25 24.265 23.64 26.845000000000002 95-99 24.805 23.935000000000002 24.11 27.150000000000002 100-104 25.145 23.705000000000002 23.89 27.26 105-109 25.009999999999998 23.41 23.885 27.694999999999997 110-114 25.405 23.385 24.895 26.314999999999998 115-119 24.89 23.28 23.95 27.88 120-124 25.89 23.07 23.845 27.195000000000004 125-129 25.115 22.8 24.175 27.91 130-134 25.629999999999995 23.474999999999998 23.425 27.47 135-139 25.745 22.905 23.965 27.384999999999998 140-144 26.38 23.145 23.56 26.915 145-149 25.8 22.275 24.285 27.639999999999997 150-151 26.200000000000003 22.900000000000002 22.6375 28.262500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 0.0 28 1.5 29 6.0 30 8.5 31 12.5 32 16.0 33 19.5 34 29.5 35 39.5 36 43.5 37 47.5 38 67.5 39 89.0 40 98.0 41 121.5 42 144.0 43 135.0 44 130.0 45 149.5 46 169.5 47 167.5 48 150.5 49 161.0 50 153.5 51 129.0 52 130.0 53 123.0 54 118.5 55 121.0 56 124.0 57 112.5 58 107.5 59 117.5 60 110.0 61 92.0 62 75.0 63 69.0 64 76.5 65 75.0 66 63.5 67 61.0 68 54.0 69 51.5 70 51.0 71 40.5 72 35.5 73 27.0 74 20.0 75 19.0 76 14.0 77 6.5 78 4.0 79 4.5 80 2.5 81 2.0 82 1.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.425 #Duplication Level Percentage of deduplicated Percentage of total 1 93.84533047899384 87.675 2 5.432164838105432 10.15 3 0.6422263848006422 1.7999999999999998 4 0.02675943270002676 0.1 5 0.02675943270002676 0.125 6 0.02675943270002676 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCGGAACCCA 6 0.15 No Hit TTTTTTTTTTGAGTCTTGATGAAAATGGTATTATAATTATATAGTTGATG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.4875 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.6625 0.0 0.0 0.0 0.0 126-127 0.7124999999999999 0.0 0.0 0.0 0.0 128-129 0.7875000000000001 0.0 0.0 0.0 0.0 130-131 0.85 0.0 0.0 0.0 0.0 132-133 0.95 0.0 0.0 0.0 0.0 134-135 1.0875 0.0 0.0 0.0 0.0 136-137 1.1875 0.0 0.0 0.0 0.0 138-139 1.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAGCA 10 0.006830828 145.0 8 TTAGGAC 10 0.006830828 145.0 7 AAGCTGG 10 0.006830828 145.0 5 >>END_MODULE SRR7804158 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804158_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9005 37.0 37.0 37.0 37.0 37.0 2 35.757 37.0 37.0 37.0 37.0 37.0 3 35.851 37.0 37.0 37.0 37.0 37.0 4 35.88 37.0 37.0 37.0 37.0 37.0 5 35.957 37.0 37.0 37.0 37.0 37.0 6 35.735 37.0 37.0 37.0 37.0 37.0 7 35.764 37.0 37.0 37.0 37.0 37.0 8 36.027 37.0 37.0 37.0 37.0 37.0 9 35.9405 37.0 37.0 37.0 37.0 37.0 10-14 35.8208 37.0 37.0 37.0 37.0 37.0 15-19 35.7195 37.0 37.0 37.0 37.0 37.0 20-24 35.7884 37.0 37.0 37.0 37.0 37.0 25-29 35.6654 37.0 37.0 37.0 37.0 37.0 30-34 35.6693 37.0 37.0 37.0 37.0 37.0 35-39 35.5318 37.0 37.0 37.0 37.0 37.0 40-44 35.49570000000001 37.0 37.0 37.0 37.0 37.0 45-49 35.445800000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.443 37.0 37.0 37.0 37.0 37.0 55-59 35.3476 37.0 37.0 37.0 34.6 37.0 60-64 35.254599999999996 37.0 37.0 37.0 34.6 37.0 65-69 35.2656 37.0 37.0 37.0 32.2 37.0 70-74 35.2614 37.0 37.0 37.0 32.2 37.0 75-79 35.188500000000005 37.0 37.0 37.0 32.2 37.0 80-84 35.0526 37.0 37.0 37.0 25.0 37.0 85-89 35.044500000000006 37.0 37.0 37.0 25.0 37.0 90-94 34.9398 37.0 37.0 37.0 25.0 37.0 95-99 34.884499999999996 37.0 37.0 37.0 25.0 37.0 100-104 34.7213 37.0 37.0 37.0 25.0 37.0 105-109 34.6714 37.0 37.0 37.0 25.0 37.0 110-114 34.519600000000004 37.0 37.0 37.0 25.0 37.0 115-119 34.5711 37.0 37.0 37.0 25.0 37.0 120-124 34.43820000000001 37.0 37.0 37.0 25.0 37.0 125-129 34.332100000000004 37.0 37.0 37.0 25.0 37.0 130-134 34.2449 37.0 37.0 37.0 25.0 37.0 135-139 34.0116 37.0 37.0 37.0 25.0 37.0 140-144 33.837599999999995 37.0 37.0 37.0 25.0 37.0 145-149 33.7766 37.0 37.0 37.0 25.0 37.0 150-151 33.1095 37.0 31.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 6.0 14 7.0 15 11.0 16 3.0 17 2.0 18 3.0 19 1.0 20 7.0 21 6.0 22 5.0 23 11.0 24 10.0 25 12.0 26 20.0 27 27.0 28 33.0 29 42.0 30 58.0 31 74.0 32 121.0 33 200.0 34 391.0 35 1000.0 36 1908.0 37 42.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.800000000000004 12.625 12.625 35.949999999999996 2 32.475 17.849999999999998 27.800000000000004 21.875 3 26.275 21.825 26.525 25.374999999999996 4 28.549999999999997 30.099999999999998 16.650000000000002 24.7 5 28.875 31.775 18.5 20.849999999999998 6 24.375 33.675 16.825000000000003 25.124999999999996 7 23.25 16.825000000000003 34.25 25.674999999999997 8 23.775 19.05 22.325 34.849999999999994 9 26.75 20.424999999999997 22.625 30.2 10-14 27.700000000000003 23.985 21.37 26.945000000000004 15-19 28.02 23.555 22.105 26.32 20-24 27.93 24.025 21.654999999999998 26.39 25-29 27.99 23.86 22.28 25.869999999999997 30-34 27.955000000000002 24.16 21.790000000000003 26.095000000000002 35-39 27.07 24.205 22.08 26.645000000000003 40-44 27.6 23.68 22.165000000000003 26.555 45-49 27.74 23.605 22.06 26.595000000000002 50-54 27.925 23.84 21.755 26.479999999999997 55-59 28.275 23.695 21.645 26.384999999999998 60-64 28.165000000000003 23.98 21.995 25.86 65-69 27.85 23.43 22.0 26.72 70-74 28.185 23.119999999999997 21.935 26.76 75-79 28.1 23.01 22.755 26.135 80-84 28.265 23.72 21.685 26.33 85-89 27.779999999999998 24.169999999999998 21.69 26.36 90-94 28.08 23.625 22.115000000000002 26.179999999999996 95-99 28.015 23.810000000000002 22.065 26.11 100-104 27.834999999999997 23.13 22.23 26.805 105-109 27.92 23.745 22.175 26.16 110-114 27.975 24.205 21.73 26.090000000000003 115-119 27.98 23.990000000000002 21.705 26.325 120-124 27.950000000000003 24.085 22.0 25.965 125-129 27.93 24.265 21.59 26.215 130-134 28.16 24.27 21.834999999999997 25.735000000000003 135-139 28.044999999999998 23.855 22.564999999999998 25.535000000000004 140-144 28.32 24.32 21.73 25.629999999999995 145-149 28.175 24.875 21.565 25.385 150-151 28.475 23.8375 21.987499999999997 25.7 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 1.5 17 1.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 1.0 24 1.0 25 0.0 26 0.0 27 0.5 28 2.5 29 2.5 30 3.0 31 4.0 32 4.5 33 6.5 34 11.0 35 19.5 36 26.0 37 36.5 38 55.0 39 69.5 40 69.0 41 72.0 42 87.5 43 99.5 44 111.5 45 127.5 46 132.5 47 139.0 48 146.5 49 141.0 50 145.0 51 145.0 52 127.0 53 120.0 54 136.0 55 143.5 56 134.5 57 126.0 58 121.5 59 115.5 60 100.0 61 89.0 62 95.5 63 97.0 64 96.0 65 90.0 66 87.5 67 87.0 68 77.0 69 70.5 70 71.5 71 64.0 72 57.5 73 54.5 74 38.0 75 31.5 76 22.5 77 17.0 78 14.5 79 8.5 80 7.5 81 4.5 82 2.0 83 2.0 84 2.0 85 1.0 86 0.0 87 1.0 88 2.0 89 1.0 90 1.5 91 2.5 92 2.0 93 1.5 94 1.5 95 1.5 96 0.5 97 0.0 98 1.0 99 1.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.925 #Duplication Level Percentage of deduplicated Percentage of total 1 93.67769706752757 87.05000000000001 2 5.380683346785042 10.0 3 0.7263922518159807 2.025 4 0.13451708366962603 0.5 5 0.026903416733925208 0.125 6 0.053806833467850416 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTCGATGACCAATGCGCCGTCTTGGAAAAGGAGGCCGTGAACGTGTCC 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit AGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAAGTATGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.4625 0.0 0.0 0.0 0.0 122-123 0.5125 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.6625000000000001 0.0 0.0 0.0 0.0 128-129 0.7375 0.0 0.0 0.0 0.0 130-131 0.8125 0.0 0.0 0.0 0.0 132-133 0.925 0.0 0.0 0.0 0.0 134-135 1.0625 0.0 0.0 0.0 0.0 136-137 1.1375000000000002 0.0 0.0 0.0 0.0 138-139 1.2625000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCGACT 10 0.006830828 145.0 6 ATGTTTT 10 0.006830828 145.0 145 >>END_MODULE Read 1206685 spots for SRR7804158.sra Written 1206685 spots for SRR7804158.sra Read 1206685 spots for SRR7804158.sra Written 1206685 spots for SRR7804158.sra Read 1206685 spots for SRR7804158.sra Written 1206685 spots for SRR7804158.sra Read 1206685 spots for SRR7804158.sra Written 1206685 spots for SRR7804158.sra Read 1206685 spots for SRR7804158.sra Written 1206685 spots for SRR7804158.sra Read 1206699 spots for SRR7804158.sra Written 1206699 spots for SRR7804158.sra Read 1206685 spots for SRR7804158.sra Written 1206685 spots for SRR7804158.sra Read 1206685 spots for SRR7804158.sra Written 1206685 spots for SRR7804158.sra Read 1206685 spots for SRR7804158.sra Written 1206685 spots for SRR7804158.sra Read 1206685 spots for SRR7804158.sra Written 1206685 spots for SRR7804158.sra Read 1206685 spots for SRR7804158.sra Written 1206685 spots for SRR7804158.sra Read 1206685 spots for SRR7804158.sra Written 1206685 spots for SRR7804158.sra Read 1206685 spots for SRR7804158.sra Written 1206685 spots for SRR7804158.sra Read 1206685 spots for SRR7804158.sra Written 1206685 spots for SRR7804158.sra Read 1206685 spots for SRR7804158.sra Written 1206685 spots for SRR7804158.sra Read 1206685 spots for SRR7804158.sra Written 1206685 spots for SRR7804158.sra Read 1206685 spots for SRR7804158.sra Written 1206685 spots for SRR7804158.sra Read 1206685 spots for SRR7804158.sra Written 1206685 spots for SRR7804158.sra Read 1206685 spots for SRR7804158.sra Written 1206685 spots for SRR7804158.sra Read 1206685 spots for SRR7804158.sra Written 1206685 spots for SRR7804158.sra SRR ids: ['SRR7804158.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zjca2xt7 SRR7804158.sra spots: 24133714 blocks: [[1, 1206685], [1206686, 2413370], [2413371, 3620055], [3620056, 4826740], [4826741, 6033425], [6033426, 7240110], [7240111, 8446795], [8446796, 9653480], [9653481, 10860165], [10860166, 12066850], [12066851, 13273535], [13273536, 14480220], [14480221, 15686905], [15686906, 16893590], [16893591, 18100275], [18100276, 19306960], [19306961, 20513645], [20513646, 21720330], [21720331, 22927015], [22927016, 24133714]] SRR7804158 file size 8156423 SRR7804158 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804158 SRR7804158_1.fastq SRR7804158_2.fastq Input file: SRR7804158_1.fastq Paired file: SRR7804158_2.fastq trimmed: SRR7804158-trimmed-pair1.fastq, SRR7804158-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:36:20 2024 >> started Sat Dec 7 17:36:47 2024 >> done (26.131s) 24133714 read pairs processed; of these: 50 ( 0.00%) short read pairs filtered out after trimming by size control 513 ( 0.00%) empty read pairs filtered out after trimming by size control 24133151 (100.00%) read pairs available; of these: 658442 ( 2.73%) trimmed read pairs available after processing 23474709 (97.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 12 0.00% 20 11 0.00% 21 16 0.00% 22 16 0.00% 23 23 0.00% 24 20 0.00% 25 15 0.00% 26 17 0.00% 27 21 0.00% 28 19 0.00% 29 29 0.00% 30 27 0.00% 31 35 0.00% 32 40 0.00% 33 29 0.00% 34 21 0.00% 35 40 0.00% 36 29 0.00% 37 29 0.00% 38 39 0.00% 39 44 0.00% 40 46 0.00% 41 33 0.00% 42 51 0.00% 43 50 0.00% 44 37 0.00% 45 45 0.00% 46 51 0.00% 47 45 0.00% 48 37 0.00% 49 53 0.00% 50 38 0.00% 51 37 0.00% 52 61 0.00% 53 46 0.00% 54 77 0.00% 55 83 0.00% 56 63 0.00% 57 67 0.00% 58 63 0.00% 59 72 0.00% 60 62 0.00% 61 65 0.00% 62 68 0.00% 63 79 0.00% 64 90 0.00% 65 79 0.00% 66 75 0.00% 67 83 0.00% 68 95 0.00% 69 100 0.00% 70 106 0.00% 71 126 0.00% 72 130 0.00% 73 155 0.00% 74 132 0.00% 75 212 0.00% 76 182 0.00% 77 216 0.00% 78 198 0.00% 79 234 0.00% 80 225 0.00% 81 289 0.00% 82 375 0.00% 83 372 0.00% 84 458 0.00% 85 427 0.00% 86 544 0.00% 87 573 0.00% 88 648 0.00% 89 676 0.00% 90 742 0.00% 91 871 0.00% 92 942 0.00% 93 1073 0.00% 94 1296 0.01% 95 1409 0.01% 96 1519 0.01% 97 1712 0.01% 98 1728 0.01% 99 1893 0.01% 100 1918 0.01% 101 2266 0.01% 102 2589 0.01% 103 2785 0.01% 104 3076 0.01% 105 3304 0.01% 106 3617 0.01% 107 3793 0.02% 108 3971 0.02% 109 4170 0.02% 110 4420 0.02% 111 4753 0.02% 112 5163 0.02% 113 5400 0.02% 114 6281 0.03% 115 6491 0.03% 116 6833 0.03% 117 7160 0.03% 118 7417 0.03% 119 7614 0.03% 120 7969 0.03% 121 8511 0.04% 122 9248 0.04% 123 9832 0.04% 124 10561 0.04% 125 11209 0.05% 126 11970 0.05% 127 12131 0.05% 128 12363 0.05% 129 12849 0.05% 130 13071 0.05% 131 13476 0.06% 132 14598 0.06% 133 15571 0.06% 134 16311 0.07% 135 17347 0.07% 136 18500 0.08% 137 18901 0.08% 138 19046 0.08% 139 19767 0.08% 140 19783 0.08% 141 20652 0.09% 142 21529 0.09% 143 22515 0.09% 144 23726 0.10% 145 25166 0.10% 146 25924 0.11% 147 26993 0.11% 148 28047 0.12% 149 27413 0.11% 150 28587 0.12% 151 23474709 97.27% 24133151 reads passed initial QC criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=35 prefix-density=0.80 prefix-fanout=2.0 sequence=GTATTTAGCCTTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=19.72 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.8 sequence=TTGATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCG criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=15 prefix-density=1.04 prefix-fanout=2.5 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=20.42 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.4 sequence=AGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAG SRR7804158 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:37:46 Started mapping on | Dec 07 17:37:46 Finished on | Dec 07 17:41:37 Mapping speed, Million of reads per hour | 376.10 Number of input reads | 24133151 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 20403876 Uniquely mapped reads % | 84.55% Average mapped length | 299.89 Number of splices: Total | 19914527 Number of splices: Annotated (sjdb) | 18860900 Number of splices: GT/AG | 19636974 Number of splices: GC/AG | 244195 Number of splices: AT/AC | 6718 Number of splices: Non-canonical | 26640 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.01% Deletion average length | 2.25 Insertion rate per base | 0.01% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1011254 % of reads mapped to multiple loci | 4.19% Number of reads mapped to too many loci | 152241 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.85% % of reads unmapped: other | 5.78% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2718021 2718021 2718021 N_multimapping 1011254 1011254 1011254 N_noFeature 1537158 19792039 1672015 N_ambiguous 590692 3111 114694 UnstrandedReadsAssigned:18276026 PositiveStrandReadsAssigned:608726 NegativeStrandReadsAssigned:18617167 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804158 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804158-trimmed-pair1.fastq SRR7804158-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,133,151 reads, 19,159,042 reads pseudoaligned [quant] estimated average fragment length: 319.604 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52973 SRR7804158.ke.tsv 35125 SRR7804158.se.tsv 88098 total ==> SRR7804158.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 618.136 0 0 PNS24247 1044 725.396 34.9455 2.74607 PNS24249 1928 1609.4 102.352 3.62518 PNS24246 1044 725.396 34.9455 2.74607 PNS24248 1044 725.396 34.9455 2.74607 PNS24244 1471 1152.4 73.8112 3.65103 PNS24243 293 72.6062 0 0 KQK14069 1603 1284.4 3818.86 169.485 KQK14071 474 194.244 48.9675 14.3699 ==> SRR7804158.se.tsv <== BRADI_1g14170v3 3998 BRADI_1g53295v3 90 BRADI_1g59795v3 300 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 214 BRADI_1g74790v3 327 BRADI_1g09890v3 0 BRADI_1g77505v3 370 BRADI_1g48960v3 0 SRR7804158 completed mapping pipeline successfully