Starting /dee2/code/volunteer_pipeline.sh SRR7804159 current disk space = 1525228544000 free memory = 1423533576 SRR7804159 SRAfilesize 2b1e262a94ff8d639441a62d58a73056 SRR7804159.sra SRR7804159.sra file validated SRR7804159 is paired end SRR7804159 is conventional basespace SRR7804159 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804159_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.024 37.0 37.0 37.0 37.0 37.0 2 36.204 37.0 37.0 37.0 37.0 37.0 3 36.388 37.0 37.0 37.0 37.0 37.0 4 36.4425 37.0 37.0 37.0 37.0 37.0 5 36.426 37.0 37.0 37.0 37.0 37.0 6 36.4455 37.0 37.0 37.0 37.0 37.0 7 36.2925 37.0 37.0 37.0 37.0 37.0 8 36.393 37.0 37.0 37.0 37.0 37.0 9 36.334 37.0 37.0 37.0 37.0 37.0 10-14 36.4452 37.0 37.0 37.0 37.0 37.0 15-19 36.4247 37.0 37.0 37.0 37.0 37.0 20-24 36.39059999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.360699999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.346500000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.2758 37.0 37.0 37.0 37.0 37.0 40-44 36.2793 37.0 37.0 37.0 37.0 37.0 45-49 36.2238 37.0 37.0 37.0 37.0 37.0 50-54 36.2898 37.0 37.0 37.0 37.0 37.0 55-59 36.1496 37.0 37.0 37.0 37.0 37.0 60-64 36.1519 37.0 37.0 37.0 37.0 37.0 65-69 36.1468 37.0 37.0 37.0 37.0 37.0 70-74 36.0509 37.0 37.0 37.0 37.0 37.0 75-79 35.9851 37.0 37.0 37.0 37.0 37.0 80-84 36.015499999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.9465 37.0 37.0 37.0 37.0 37.0 90-94 35.883799999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.7324 37.0 37.0 37.0 37.0 37.0 100-104 35.7867 37.0 37.0 37.0 37.0 37.0 105-109 35.7519 37.0 37.0 37.0 37.0 37.0 110-114 35.6967 37.0 37.0 37.0 37.0 37.0 115-119 35.6075 37.0 37.0 37.0 37.0 37.0 120-124 35.533 37.0 37.0 37.0 37.0 37.0 125-129 35.544799999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.4258 37.0 37.0 37.0 37.0 37.0 135-139 35.22430000000001 37.0 37.0 37.0 29.8 37.0 140-144 35.348699999999994 37.0 37.0 37.0 34.6 37.0 145-149 35.1567 37.0 37.0 37.0 29.8 37.0 150-151 34.50675 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 2.0 24 2.0 25 7.0 26 8.0 27 11.0 28 24.0 29 22.0 30 56.0 31 54.0 32 98.0 33 106.0 34 169.0 35 444.0 36 2746.0 37 250.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.324649298597194 11.848697394789578 11.097194388777556 39.72945891783567 2 26.775 15.725 34.275 23.225 3 23.35 23.599999999999998 21.775 31.275 4 27.775 30.099999999999998 18.25 23.875 5 27.6 31.825 20.375 20.200000000000003 6 21.3 32.4 23.125 23.175 7 17.625 19.275000000000002 41.175 21.925 8 22.875 18.925 26.525 31.674999999999997 9 20.674999999999997 19.225 29.95 30.15 10-14 23.72 25.995 23.724999999999998 26.56 15-19 24.240000000000002 24.465 24.23 27.065 20-24 24.515 24.18 24.545 26.76 25-29 24.41 23.905 24.845 26.840000000000003 30-34 24.01 24.22 24.67 27.1 35-39 24.345 24.54 23.995 27.12 40-44 24.73 24.27 24.03 26.97 45-49 24.43 23.625 24.47 27.474999999999998 50-54 24.145 23.89 24.044999999999998 27.92 55-59 24.43 24.349999999999998 23.805 27.415 60-64 24.255 23.985 24.04 27.72 65-69 24.665 23.435 24.32 27.58 70-74 25.14 23.21 23.82 27.83 75-79 24.975 23.25 24.05 27.725 80-84 24.695 23.345 24.224999999999998 27.735 85-89 25.145 23.605 23.505000000000003 27.744999999999997 90-94 24.975 23.72 24.195 27.11 95-99 25.324999999999996 23.355 23.599999999999998 27.72 100-104 25.480000000000004 23.11 23.799999999999997 27.61 105-109 25.72 23.02 23.785 27.474999999999998 110-114 24.990000000000002 23.075000000000003 24.205 27.73 115-119 25.724999999999998 22.855 23.674999999999997 27.744999999999997 120-124 25.6 22.994999999999997 23.46 27.944999999999997 125-129 25.759999999999998 23.16 23.235 27.845 130-134 26.405 22.770000000000003 23.74 27.084999999999997 135-139 25.6 22.895 23.635 27.87 140-144 26.790000000000003 22.28 23.419999999999998 27.51 145-149 25.885 22.855 23.385 27.875 150-151 26.087500000000002 22.475 23.35 28.0875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 3.0 26 3.0 27 0.0 28 3.0 29 6.5 30 7.0 31 8.5 32 14.0 33 21.5 34 27.0 35 35.5 36 35.5 37 38.5 38 63.0 39 87.5 40 103.0 41 113.5 42 121.0 43 137.0 44 154.0 45 158.0 46 146.5 47 138.0 48 138.0 49 135.5 50 142.5 51 152.5 52 140.0 53 122.5 54 136.0 55 140.5 56 131.0 57 118.0 58 106.5 59 104.5 60 99.5 61 92.5 62 72.0 63 69.5 64 83.0 65 77.0 66 66.0 67 62.5 68 58.5 69 60.0 70 54.5 71 39.5 72 34.0 73 30.5 74 27.5 75 25.5 76 20.0 77 13.5 78 7.5 79 4.5 80 3.0 81 1.0 82 1.0 83 0.5 84 1.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.975 #Duplication Level Percentage of deduplicated Percentage of total 1 94.36020218143123 88.675 2 5.001330140994945 9.4 3 0.5320563979781857 1.5 4 0.07980845969672785 0.3 5 0.026602819898909287 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGCAGGCTCCACGCCTGGTGGTGCCCTTCCGTCAATTCCTTTAAGTTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.32499999999999996 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.55 0.0 0.0 0.0 0.0 124-125 0.6375 0.0 0.0 0.0 0.0 126-127 0.775 0.0 0.0 0.0 0.0 128-129 0.85 0.0 0.0 0.0 0.0 130-131 0.9125 0.0 0.0 0.0 0.0 132-133 0.9874999999999999 0.0 0.0 0.0 0.0 134-135 1.0750000000000002 0.0 0.0 0.0 0.0 136-137 1.2000000000000002 0.0 0.0 0.0 0.0 138-139 1.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACCCA 10 0.006830828 145.0 4 AACTAGG 10 0.006830828 145.0 5 AAGTCTA 10 0.006830828 145.0 2 AACATAT 10 0.006830828 145.0 5 >>END_MODULE SRR7804159 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804159_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4695 37.0 37.0 37.0 37.0 37.0 2 36.268 37.0 37.0 37.0 37.0 37.0 3 36.313 37.0 37.0 37.0 37.0 37.0 4 36.3305 37.0 37.0 37.0 37.0 37.0 5 36.4385 37.0 37.0 37.0 37.0 37.0 6 36.3245 37.0 37.0 37.0 37.0 37.0 7 36.2345 37.0 37.0 37.0 37.0 37.0 8 36.3195 37.0 37.0 37.0 37.0 37.0 9 36.3295 37.0 37.0 37.0 37.0 37.0 10-14 36.315999999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.3023 37.0 37.0 37.0 37.0 37.0 20-24 36.2432 37.0 37.0 37.0 37.0 37.0 25-29 36.201499999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.2055 37.0 37.0 37.0 37.0 37.0 35-39 36.1402 37.0 37.0 37.0 37.0 37.0 40-44 36.1188 37.0 37.0 37.0 37.0 37.0 45-49 36.04690000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.0891 37.0 37.0 37.0 37.0 37.0 55-59 35.965999999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.9765 37.0 37.0 37.0 37.0 37.0 65-69 35.9122 37.0 37.0 37.0 37.0 37.0 70-74 35.9106 37.0 37.0 37.0 37.0 37.0 75-79 35.8737 37.0 37.0 37.0 37.0 37.0 80-84 35.8177 37.0 37.0 37.0 37.0 37.0 85-89 35.822 37.0 37.0 37.0 37.0 37.0 90-94 35.727999999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.624900000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.60170000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.484899999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.4476 37.0 37.0 37.0 37.0 37.0 115-119 35.339299999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.347699999999996 37.0 37.0 37.0 34.6 37.0 125-129 35.2118 37.0 37.0 37.0 27.4 37.0 130-134 35.2222 37.0 37.0 37.0 32.2 37.0 135-139 35.0743 37.0 37.0 37.0 27.4 37.0 140-144 34.8932 37.0 37.0 37.0 25.0 37.0 145-149 34.7705 37.0 37.0 37.0 25.0 37.0 150-151 34.01675 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 1.0 16 2.0 17 1.0 18 2.0 19 2.0 20 3.0 21 5.0 22 4.0 23 14.0 24 11.0 25 5.0 26 10.0 27 8.0 28 15.0 29 25.0 30 29.0 31 45.0 32 66.0 33 127.0 34 204.0 35 625.0 36 2659.0 37 134.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.975 12.15 12.174999999999999 39.7 2 30.575000000000003 17.175 28.425 23.825 3 26.724999999999998 22.05 24.3 26.924999999999997 4 30.275000000000002 27.650000000000002 16.85 25.224999999999998 5 30.599999999999998 30.0 17.025000000000002 22.375 6 23.200000000000003 32.525 17.65 26.625 7 21.7 14.475 35.75 28.075 8 23.825 21.099999999999998 20.125 34.949999999999996 9 24.95 21.05 24.375 29.625 10-14 27.200000000000003 24.025 21.04 27.735 15-19 26.974999999999998 24.495 21.55 26.979999999999997 20-24 27.034999999999997 24.125 21.555 27.284999999999997 25-29 27.01 24.145 22.040000000000003 26.805 30-34 27.425 23.89 21.905 26.779999999999998 35-39 27.245 24.135 21.46 27.16 40-44 27.02 24.104999999999997 21.355 27.52 45-49 28.189999999999998 23.405 21.7 26.705000000000002 50-54 28.060000000000002 23.73 21.52 26.69 55-59 27.955000000000002 23.885 21.404999999999998 26.755000000000003 60-64 27.66 23.815 22.264999999999997 26.26 65-69 27.375 23.715 21.654999999999998 27.255000000000003 70-74 27.79 22.99 22.415 26.805 75-79 28.7 22.994999999999997 21.6 26.705000000000002 80-84 27.395000000000003 23.62 21.875 27.11 85-89 28.194999999999997 24.34 21.12 26.345000000000002 90-94 27.165 24.07 21.785 26.979999999999997 95-99 27.76 23.630000000000003 21.759999999999998 26.85 100-104 27.834999999999997 23.369999999999997 21.84 26.955000000000002 105-109 27.73 23.26 22.14 26.87 110-114 27.825 23.615 21.790000000000003 26.77 115-119 27.339999999999996 24.025 21.625 27.01 120-124 27.200000000000003 23.955000000000002 21.6 27.245 125-129 28.144999999999996 24.065 21.26 26.529999999999998 130-134 28.634999999999998 23.915 21.745 25.705 135-139 28.74 24.09 21.875 25.295 140-144 28.645 23.97 21.485000000000003 25.900000000000002 145-149 28.439999999999998 24.154999999999998 21.93 25.474999999999998 150-151 27.800000000000004 25.05 21.2625 25.887500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.0 8 0.5 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 0.5 17 2.0 18 3.0 19 1.5 20 2.5 21 2.5 22 0.5 23 0.0 24 1.5 25 2.0 26 1.0 27 1.5 28 1.5 29 3.0 30 5.0 31 4.5 32 5.0 33 6.5 34 9.5 35 15.0 36 24.5 37 33.0 38 46.5 39 66.5 40 70.5 41 78.0 42 95.5 43 99.5 44 98.0 45 107.5 46 121.0 47 139.5 48 146.5 49 142.0 50 134.5 51 124.0 52 122.0 53 117.0 54 122.0 55 129.0 56 127.5 57 128.5 58 129.0 59 118.5 60 108.5 61 102.5 62 106.0 63 101.5 64 90.0 65 102.0 66 101.5 67 87.5 68 92.0 69 92.0 70 76.5 71 63.5 72 57.0 73 57.0 74 48.5 75 26.0 76 20.0 77 24.5 78 17.0 79 9.0 80 4.5 81 5.5 82 6.5 83 2.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.425 #Duplication Level Percentage of deduplicated Percentage of total 1 93.95236820979396 87.775 2 5.351886540005352 10.0 3 0.5084292213005084 1.425 4 0.1337971635001338 0.5 5 0.02675943270002676 0.125 6 0.0 0.0 7 0.02675943270002676 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 7 0.17500000000000002 No Hit GTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTTGATTCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.32499999999999996 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.675 0.0 0.0 0.0 0.0 126-127 0.8 0.0 0.0 0.0 0.0 128-129 0.9 0.0 0.0 0.0 0.0 130-131 0.9625 0.0 0.0 0.0 0.0 132-133 1.0375 0.0 0.0 0.0 0.0 134-135 1.125 0.0 0.0 0.0 0.0 136-137 1.275 0.0 0.0 0.0 0.0 138-139 1.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1295732 spots for SRR7804159.sra Written 1295732 spots for SRR7804159.sra Read 1295732 spots for SRR7804159.sra Written 1295732 spots for SRR7804159.sra Read 1295732 spots for SRR7804159.sra Written 1295732 spots for SRR7804159.sra Read 1295732 spots for SRR7804159.sra Written 1295732 spots for SRR7804159.sra Read 1295732 spots for SRR7804159.sra Written 1295732 spots for SRR7804159.sra Read 1295732 spots for SRR7804159.sra Written 1295732 spots for SRR7804159.sra Read 1295732 spots for SRR7804159.sra Written 1295732 spots for SRR7804159.sra Read 1295732 spots for SRR7804159.sra Written 1295732 spots for SRR7804159.sra Read 1295732 spots for SRR7804159.sra Written 1295732 spots for SRR7804159.sra Read 1295732 spots for SRR7804159.sra Written 1295732 spots for SRR7804159.sra Read 1295732 spots for SRR7804159.sra Written 1295732 spots for SRR7804159.sra Read 1295732 spots for SRR7804159.sra Written 1295732 spots for SRR7804159.sra Read 1295732 spots for SRR7804159.sra Written 1295732 spots for SRR7804159.sra Read 1295732 spots for SRR7804159.sra Written 1295732 spots for SRR7804159.sra Read 1295732 spots for SRR7804159.sra Written 1295732 spots for SRR7804159.sra Read 1295732 spots for SRR7804159.sra Written 1295732 spots for SRR7804159.sra Read 1295732 spots for SRR7804159.sra Written 1295732 spots for SRR7804159.sra Read 1295732 spots for SRR7804159.sra Written 1295732 spots for SRR7804159.sra Read 1295744 spots for SRR7804159.sra Written 1295744 spots for SRR7804159.sra Read 1295732 spots for SRR7804159.sra Written 1295732 spots for SRR7804159.sra SRR ids: ['SRR7804159.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__wufokkx SRR7804159.sra spots: 25914652 blocks: [[1, 1295732], [1295733, 2591464], [2591465, 3887196], [3887197, 5182928], [5182929, 6478660], [6478661, 7774392], [7774393, 9070124], [9070125, 10365856], [10365857, 11661588], [11661589, 12957320], [12957321, 14253052], [14253053, 15548784], [15548785, 16844516], [16844517, 18140248], [18140249, 19435980], [19435981, 20731712], [20731713, 22027444], [22027445, 23323176], [23323177, 24618908], [24618909, 25914652]] SRR7804159 file size 8759924 SRR7804159 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804159 SRR7804159_1.fastq SRR7804159_2.fastq Input file: SRR7804159_1.fastq Paired file: SRR7804159_2.fastq trimmed: SRR7804159-trimmed-pair1.fastq, SRR7804159-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 02:59:45 2024 >> started Tue Dec 10 03:00:21 2024 >> done (36.755s) 25914652 read pairs processed; of these: 50 ( 0.00%) short read pairs filtered out after trimming by size control 485 ( 0.00%) empty read pairs filtered out after trimming by size control 25914117 (100.00%) read pairs available; of these: 664485 ( 2.56%) trimmed read pairs available after processing 25249632 (97.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 6 0.00% 20 10 0.00% 21 10 0.00% 22 19 0.00% 23 15 0.00% 24 12 0.00% 25 13 0.00% 26 14 0.00% 27 19 0.00% 28 27 0.00% 29 14 0.00% 30 41 0.00% 31 34 0.00% 32 27 0.00% 33 33 0.00% 34 28 0.00% 35 24 0.00% 36 33 0.00% 37 29 0.00% 38 38 0.00% 39 39 0.00% 40 44 0.00% 41 35 0.00% 42 36 0.00% 43 38 0.00% 44 38 0.00% 45 63 0.00% 46 64 0.00% 47 50 0.00% 48 57 0.00% 49 54 0.00% 50 49 0.00% 51 50 0.00% 52 68 0.00% 53 90 0.00% 54 59 0.00% 55 72 0.00% 56 59 0.00% 57 65 0.00% 58 66 0.00% 59 78 0.00% 60 55 0.00% 61 87 0.00% 62 88 0.00% 63 80 0.00% 64 75 0.00% 65 119 0.00% 66 93 0.00% 67 90 0.00% 68 121 0.00% 69 101 0.00% 70 124 0.00% 71 125 0.00% 72 132 0.00% 73 148 0.00% 74 159 0.00% 75 170 0.00% 76 188 0.00% 77 186 0.00% 78 226 0.00% 79 239 0.00% 80 244 0.00% 81 320 0.00% 82 332 0.00% 83 389 0.00% 84 429 0.00% 85 434 0.00% 86 506 0.00% 87 576 0.00% 88 664 0.00% 89 692 0.00% 90 780 0.00% 91 820 0.00% 92 967 0.00% 93 1063 0.00% 94 1168 0.00% 95 1430 0.01% 96 1498 0.01% 97 1595 0.01% 98 1694 0.01% 99 1867 0.01% 100 2029 0.01% 101 2313 0.01% 102 2428 0.01% 103 2747 0.01% 104 3048 0.01% 105 3281 0.01% 106 3477 0.01% 107 3708 0.01% 108 3970 0.02% 109 4213 0.02% 110 4435 0.02% 111 4878 0.02% 112 5135 0.02% 113 5546 0.02% 114 6054 0.02% 115 6402 0.02% 116 6755 0.03% 117 7152 0.03% 118 7359 0.03% 119 7995 0.03% 120 8249 0.03% 121 8669 0.03% 122 9310 0.04% 123 9776 0.04% 124 10401 0.04% 125 11296 0.04% 126 11668 0.05% 127 11817 0.05% 128 12335 0.05% 129 13001 0.05% 130 13348 0.05% 131 14047 0.05% 132 14724 0.06% 133 15638 0.06% 134 16581 0.06% 135 17174 0.07% 136 18085 0.07% 137 18578 0.07% 138 19249 0.07% 139 20031 0.08% 140 20808 0.08% 141 20966 0.08% 142 22033 0.09% 143 22930 0.09% 144 24174 0.09% 145 25448 0.10% 146 25938 0.10% 147 27153 0.10% 148 28239 0.11% 149 28671 0.11% 150 29515 0.11% 151 25249632 97.44% 25914117 reads passed initial QC criterion=sequence-density sequence-density=1.30 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=14 prefix-density=1.33 prefix-fanout=2.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.20 sequence-density-rank=32 fanout-score=5.23 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=1.9 sequence=ATCAGTGAGCTATTACGCACTCTTTAAAGGGTGGCTGCTTCTAGGCAAACCTCCTGGCTGTCTTTGCACCCCCACCTCCTTTATCACTGAGCGGTCATTTAGGGGCCTTAGCTGGTGATCCGGGCTGTTTCCCTCTCGACGATGAAGCTTATCCCCCATCGTCTCACTGGCCGACCTTGACCCCTGTTATTTTGGGGTCATATCTAGTATTCAGAGTTTGCCTCGATTTGGTACCGCTCGCGCAGCCCGCACCGAAACAGTGCTTTACCCCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCAGCTAGCTCTGGGTTCGAGTGGCATTTCACCCCTAACCACAACTCATCCGCTGATTCTTCAACATCAGTCGGTTCGGACCTCTGCTTAGTTTCATCCAAGCTTCATCCTGGTCATGGATAGATCACCCAGGTTCGGGTCCATAAGCAGTGACAATCGCCCTATGAAGACTCGCTTTCGCTACGGCTCCGGTGG criterion=sequence-density sequence-density=0.98 sequence-density-rank=1 fanout-score=3.38 fanout-score-rank=10 prefix-density=1.05 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=17.44 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.4 sequence=AGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAG SRR7804159 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:01:16 Started mapping on | Dec 10 03:01:16 Finished on | Dec 10 03:05:31 Mapping speed, Million of reads per hour | 365.85 Number of input reads | 25914117 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 22203242 Uniquely mapped reads % | 85.68% Average mapped length | 300.16 Number of splices: Total | 21178223 Number of splices: Annotated (sjdb) | 20069157 Number of splices: GT/AG | 20885479 Number of splices: GC/AG | 256343 Number of splices: AT/AC | 7543 Number of splices: Non-canonical | 28858 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.37 Insertion rate per base | 0.01% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 946521 % of reads mapped to multiple loci | 3.65% Number of reads mapped to too many loci | 170055 % of reads mapped to too many loci | 0.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.39% % of reads unmapped: other | 5.62% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2764354 2764354 2764354 N_multimapping 946521 946521 946521 N_noFeature 1438624 21552558 1575206 N_ambiguous 643670 3319 130229 UnstrandedReadsAssigned:20120948 PositiveStrandReadsAssigned:647365 NegativeStrandReadsAssigned:20497807 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804159 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804159-trimmed-pair1.fastq SRR7804159-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,914,117 reads, 20,943,505 reads pseudoaligned [quant] estimated average fragment length: 323.754 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,197 rounds 52973 SRR7804159.ke.tsv 35125 SRR7804159.se.tsv 88098 total ==> SRR7804159.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 613.913 0 0 PNS24247 1044 721.246 40.5023 2.89968 PNS24249 1928 1605.25 168.889 5.43267 PNS24246 1044 721.246 40.5023 2.89968 PNS24248 1044 721.246 40.5023 2.89968 PNS24244 1471 1148.25 49.6044 2.23069 PNS24243 293 71.5041 0 0 KQK14069 1603 1280.25 3137.35 126.539 KQK14071 474 190.554 17.6799 4.79089 ==> SRR7804159.se.tsv <== BRADI_1g14170v3 3216 BRADI_1g53295v3 100 BRADI_1g59795v3 263 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 253 BRADI_1g74790v3 500 BRADI_1g09890v3 0 BRADI_1g77505v3 353 BRADI_1g48960v3 0 SRR7804159 completed mapping pipeline successfully