Starting /dee2/code/volunteer_pipeline.sh SRR7804160 current disk space = 1525383299072 free memory = 1565560812 SRR7804160 SRAfilesize 63b4009883b5f324c4cc524788823254 SRR7804160.sra SRR7804160.sra file validated SRR7804160 is paired end SRR7804160 is conventional basespace SRR7804160 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804160_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2125 37.0 37.0 37.0 37.0 37.0 2 36.369 37.0 37.0 37.0 37.0 37.0 3 36.486 37.0 37.0 37.0 37.0 37.0 4 36.491 37.0 37.0 37.0 37.0 37.0 5 36.487 37.0 37.0 37.0 37.0 37.0 6 36.5725 37.0 37.0 37.0 37.0 37.0 7 36.268 37.0 37.0 37.0 37.0 37.0 8 36.5325 37.0 37.0 37.0 37.0 37.0 9 36.5045 37.0 37.0 37.0 37.0 37.0 10-14 36.55499999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.46999999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.4314 37.0 37.0 37.0 37.0 37.0 25-29 36.4754 37.0 37.0 37.0 37.0 37.0 30-34 36.4126 37.0 37.0 37.0 37.0 37.0 35-39 36.3966 37.0 37.0 37.0 37.0 37.0 40-44 36.3053 37.0 37.0 37.0 37.0 37.0 45-49 36.235 37.0 37.0 37.0 37.0 37.0 50-54 36.2521 37.0 37.0 37.0 37.0 37.0 55-59 36.2077 37.0 37.0 37.0 37.0 37.0 60-64 36.2007 37.0 37.0 37.0 37.0 37.0 65-69 36.15259999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.062799999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.045300000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.0848 37.0 37.0 37.0 37.0 37.0 85-89 36.0075 37.0 37.0 37.0 37.0 37.0 90-94 35.9576 37.0 37.0 37.0 37.0 37.0 95-99 35.8352 37.0 37.0 37.0 37.0 37.0 100-104 35.8936 37.0 37.0 37.0 37.0 37.0 105-109 35.8207 37.0 37.0 37.0 37.0 37.0 110-114 35.805899999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.7419 37.0 37.0 37.0 37.0 37.0 120-124 35.6736 37.0 37.0 37.0 37.0 37.0 125-129 35.6047 37.0 37.0 37.0 37.0 37.0 130-134 35.520799999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.3448 37.0 37.0 37.0 32.2 37.0 140-144 35.366200000000006 37.0 37.0 37.0 34.6 37.0 145-149 35.2054 37.0 37.0 37.0 27.4 37.0 150-151 34.57575 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 4.0 25 2.0 26 7.0 27 8.0 28 19.0 29 24.0 30 33.0 31 56.0 32 65.0 33 120.0 34 166.0 35 475.0 36 2768.0 37 251.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.01555444054189 11.54039136979428 11.891620672353238 43.55243351731058 2 25.525 18.575 34.075 21.825 3 22.575 25.724999999999998 21.224999999999998 30.475 4 26.0 31.424999999999997 18.05 24.525 5 26.674999999999997 31.85 21.3 20.175 6 18.875 34.2 23.325000000000003 23.599999999999998 7 17.599999999999998 17.95 42.699999999999996 21.75 8 21.725 18.95 26.150000000000002 33.175 9 20.75 18.15 32.1 28.999999999999996 10-14 23.48 25.985000000000003 24.315 26.22 15-19 23.645 24.6 25.629999999999995 26.125 20-24 23.72 24.915000000000003 25.759999999999998 25.605 25-29 23.135 25.19 24.805 26.87 30-34 23.905 24.995 24.64 26.46 35-39 23.885 24.67 25.31 26.135 40-44 23.415 25.055 24.560000000000002 26.97 45-49 23.95 24.490000000000002 25.324999999999996 26.235000000000003 50-54 23.95 24.779999999999998 24.93 26.340000000000003 55-59 23.94 24.965 24.27 26.825 60-64 24.13 24.990000000000002 24.395 26.484999999999996 65-69 24.32 24.94 24.865000000000002 25.874999999999996 70-74 24.75 24.765 24.22 26.265 75-79 23.830000000000002 24.805 24.355 27.01 80-84 24.73 24.36 24.44 26.47 85-89 24.42 24.395 24.635 26.55 90-94 24.73 24.529999999999998 24.47 26.27 95-99 24.490000000000002 24.355 24.895 26.26 100-104 24.755 24.535 24.185000000000002 26.525 105-109 24.715 23.845 24.235 27.205000000000002 110-114 24.66 24.09 24.97 26.279999999999998 115-119 24.79 23.59 24.75 26.87 120-124 25.14 24.25 24.185000000000002 26.424999999999997 125-129 25.19 24.305 24.305 26.200000000000003 130-134 26.345000000000002 24.02 24.035 25.6 135-139 25.095 23.835 24.32 26.75 140-144 25.314999999999998 23.44 24.8 26.445 145-149 25.45 24.32 23.544999999999998 26.685 150-151 25.7625 23.2875 23.45 27.500000000000004 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 1.5 26 2.5 27 2.5 28 3.0 29 4.0 30 9.0 31 14.5 32 16.0 33 23.5 34 31.5 35 32.0 36 44.5 37 60.0 38 75.0 39 94.0 40 124.0 41 143.0 42 143.5 43 150.0 44 165.0 45 172.5 46 159.5 47 163.5 48 168.0 49 158.0 50 155.5 51 153.5 52 139.5 53 128.0 54 120.5 55 112.5 56 105.0 57 102.5 58 91.5 59 78.5 60 83.0 61 87.5 62 83.0 63 72.5 64 70.5 65 62.5 66 56.5 67 55.0 68 49.0 69 44.0 70 40.5 71 35.5 72 26.5 73 21.5 74 18.5 75 13.5 76 10.0 77 9.0 78 4.5 79 1.5 80 1.0 81 0.5 82 1.0 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.575 #Duplication Level Percentage of deduplicated Percentage of total 1 94.79249273063705 89.64999999999999 2 4.810996563573884 9.1 3 0.3700766587364525 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.026434047052603753 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATG 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1125 0.0 0.0 0.0 0.0 110-111 0.1375 0.0 0.0 0.0 0.0 112-113 0.16249999999999998 0.0 0.0 0.0 0.0 114-115 0.23750000000000002 0.0 0.0 0.0 0.0 116-117 0.36250000000000004 0.0 0.0 0.0 0.0 118-119 0.44999999999999996 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.55 0.0 0.0 0.0 0.0 124-125 0.65 0.0 0.0 0.0 0.0 126-127 0.8 0.0 0.0 0.0 0.0 128-129 0.9375 0.0 0.0 0.0 0.0 130-131 1.0875 0.0 0.0 0.0 0.0 132-133 1.225 0.0 0.0 0.0 0.0 134-135 1.3250000000000002 0.0 0.0 0.0 0.0 136-137 1.375 0.0 0.0 0.0 0.0 138-139 1.4249999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804160 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804160_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2485 37.0 37.0 37.0 37.0 37.0 2 35.9135 37.0 37.0 37.0 37.0 37.0 3 36.121 37.0 37.0 37.0 37.0 37.0 4 36.104 37.0 37.0 37.0 37.0 37.0 5 36.207 37.0 37.0 37.0 37.0 37.0 6 35.8955 37.0 37.0 37.0 37.0 37.0 7 35.903 37.0 37.0 37.0 37.0 37.0 8 36.213 37.0 37.0 37.0 37.0 37.0 9 36.1955 37.0 37.0 37.0 37.0 37.0 10-14 36.1004 37.0 37.0 37.0 37.0 37.0 15-19 36.036 37.0 37.0 37.0 37.0 37.0 20-24 36.015699999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.004 37.0 37.0 37.0 37.0 37.0 30-34 35.933800000000005 37.0 37.0 37.0 37.0 37.0 35-39 35.8581 37.0 37.0 37.0 37.0 37.0 40-44 35.8083 37.0 37.0 37.0 37.0 37.0 45-49 35.730599999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.7648 37.0 37.0 37.0 37.0 37.0 55-59 35.6709 37.0 37.0 37.0 37.0 37.0 60-64 35.5984 37.0 37.0 37.0 37.0 37.0 65-69 35.537800000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.5175 37.0 37.0 37.0 37.0 37.0 75-79 35.4761 37.0 37.0 37.0 37.0 37.0 80-84 35.38590000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.309000000000005 37.0 37.0 37.0 29.8 37.0 90-94 35.2855 37.0 37.0 37.0 34.6 37.0 95-99 35.1315 37.0 37.0 37.0 25.0 37.0 100-104 35.14020000000001 37.0 37.0 37.0 25.0 37.0 105-109 35.0412 37.0 37.0 37.0 25.0 37.0 110-114 34.85209999999999 37.0 37.0 37.0 25.0 37.0 115-119 34.8714 37.0 37.0 37.0 25.0 37.0 120-124 34.7524 37.0 37.0 37.0 25.0 37.0 125-129 34.7484 37.0 37.0 37.0 25.0 37.0 130-134 34.552200000000006 37.0 37.0 37.0 25.0 37.0 135-139 34.373900000000006 37.0 37.0 37.0 25.0 37.0 140-144 34.2534 37.0 37.0 37.0 25.0 37.0 145-149 34.195100000000004 37.0 37.0 37.0 25.0 37.0 150-151 33.52175 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 2.0 16 4.0 17 0.0 18 2.0 19 1.0 20 0.0 21 2.0 22 9.0 23 5.0 24 6.0 25 15.0 26 13.0 27 21.0 28 24.0 29 40.0 30 58.0 31 69.0 32 104.0 33 191.0 34 354.0 35 883.0 36 2143.0 37 52.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.2 10.825 13.775 42.199999999999996 2 27.950000000000003 18.75 31.35 21.95 3 24.25 22.1 26.35 27.3 4 26.974999999999998 29.75 17.125 26.150000000000002 5 28.549999999999997 31.424999999999997 19.725 20.3 6 21.025 35.25 18.9 24.825 7 20.825 13.8 36.525 28.849999999999998 8 23.65 19.525000000000002 22.975 33.85 9 24.675 20.200000000000003 25.424999999999997 29.7 10-14 25.619999999999997 24.85 22.78 26.75 15-19 26.240000000000002 24.48 22.765 26.515 20-24 26.465 23.794999999999998 22.835 26.905 25-29 26.700000000000003 24.415 22.605 26.279999999999998 30-34 25.765 24.055 23.150000000000002 27.029999999999998 35-39 26.640000000000004 23.62 22.84 26.900000000000002 40-44 26.155 23.655 23.11 27.08 45-49 26.5 23.48 23.39 26.63 50-54 26.75 23.43 22.875 26.945000000000004 55-59 26.674999999999997 24.345 22.605 26.375 60-64 26.63 24.265 22.745 26.36 65-69 27.1 23.93 22.99 25.979999999999997 70-74 27.389999999999997 23.705000000000002 22.685 26.22 75-79 27.01 23.78 23.35 25.86 80-84 26.43 23.875 22.97 26.724999999999998 85-89 27.455000000000002 23.685000000000002 22.675 26.185000000000002 90-94 27.145000000000003 23.630000000000003 23.155 26.07 95-99 26.939999999999998 23.630000000000003 22.8 26.63 100-104 26.88 23.87 23.380000000000003 25.869999999999997 105-109 26.6 24.735 22.585 26.08 110-114 27.544999999999998 24.285 22.845 25.324999999999996 115-119 27.35 23.880000000000003 22.43 26.340000000000003 120-124 27.075 24.415 22.71 25.8 125-129 26.484999999999996 24.67 22.275 26.57 130-134 27.49 24.135 23.085 25.290000000000003 135-139 27.565 24.515 23.23 24.69 140-144 27.315 24.075 23.169999999999998 25.44 145-149 27.46 24.01 23.11 25.419999999999998 150-151 27.287499999999998 25.0375 23.4125 24.2625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 0.5 25 1.0 26 0.5 27 0.5 28 3.0 29 4.5 30 5.0 31 7.0 32 9.0 33 12.5 34 22.0 35 29.0 36 35.5 37 47.5 38 52.5 39 64.0 40 85.5 41 105.5 42 124.5 43 144.5 44 153.5 45 148.5 46 147.0 47 143.0 48 130.0 49 132.5 50 128.0 51 126.0 52 127.5 53 114.5 54 103.0 55 94.5 56 106.5 57 124.0 58 117.5 59 100.5 60 96.0 61 92.0 62 99.5 63 97.0 64 84.5 65 87.0 66 85.0 67 76.5 68 79.5 69 80.5 70 72.0 71 58.5 72 48.0 73 54.5 74 44.0 75 27.0 76 19.5 77 10.0 78 7.5 79 7.5 80 5.0 81 2.5 82 2.0 83 1.5 84 0.5 85 0.5 86 0.5 87 0.5 88 1.0 89 0.5 90 0.0 91 0.5 92 0.5 93 1.0 94 1.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.69214437367303 89.2 2 4.697452229299364 8.85 3 0.45116772823779194 1.275 4 0.10615711252653928 0.4 5 0.02653927813163482 0.125 6 0.02653927813163482 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTC 6 0.15 No Hit GCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTTAAGGCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.16249999999999998 0.0 0.0 0.0 0.0 112-113 0.1875 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.38749999999999996 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.675 0.0 0.0 0.0 0.0 126-127 0.825 0.0 0.0 0.0 0.0 128-129 0.9625 0.0 0.0 0.0 0.0 130-131 1.1124999999999998 0.0 0.0 0.0 0.0 132-133 1.25 0.0 0.0 0.0 0.0 134-135 1.35 0.0 0.0 0.0 0.0 136-137 1.4 0.0 0.0 0.0 0.0 138-139 1.4500000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCCTTC 10 0.006830828 145.0 4 >>END_MODULE Read 2069288 spots for SRR7804160.sra Written 2069288 spots for SRR7804160.sra Read 2069288 spots for SRR7804160.sra Written 2069288 spots for SRR7804160.sra Read 2069288 spots for SRR7804160.sra Written 2069288 spots for SRR7804160.sra Read 2069288 spots for SRR7804160.sra Written 2069288 spots for SRR7804160.sra Read 2069288 spots for SRR7804160.sra Written 2069288 spots for SRR7804160.sra Read 2069288 spots for SRR7804160.sra Written 2069288 spots for SRR7804160.sra Read 2069288 spots for SRR7804160.sra Written 2069288 spots for SRR7804160.sra Read 2069288 spots for SRR7804160.sra Written 2069288 spots for SRR7804160.sra Read 2069288 spots for SRR7804160.sra Written 2069288 spots for SRR7804160.sra Read 2069288 spots for SRR7804160.sra Written 2069288 spots for SRR7804160.sra Read 2069288 spots for SRR7804160.sra Written 2069288 spots for SRR7804160.sra Read 2069288 spots for SRR7804160.sra Written 2069288 spots for SRR7804160.sra Read 2069288 spots for SRR7804160.sra Written 2069288 spots for SRR7804160.sra Read 2069288 spots for SRR7804160.sra Written 2069288 spots for SRR7804160.sra Read 2069291 spots for SRR7804160.sra Written 2069291 spots for SRR7804160.sra Read 2069288 spots for SRR7804160.sra Written 2069288 spots for SRR7804160.sra Read 2069288 spots for SRR7804160.sra Written 2069288 spots for SRR7804160.sra Read 2069288 spots for SRR7804160.sra Written 2069288 spots for SRR7804160.sra Read 2069288 spots for SRR7804160.sra Written 2069288 spots for SRR7804160.sra Read 2069288 spots for SRR7804160.sra Written 2069288 spots for SRR7804160.sra SRR ids: ['SRR7804160.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_57chlvsh SRR7804160.sra spots: 41385763 blocks: [[1, 2069288], [2069289, 4138576], [4138577, 6207864], [6207865, 8277152], [8277153, 10346440], [10346441, 12415728], [12415729, 14485016], [14485017, 16554304], [16554305, 18623592], [18623593, 20692880], [20692881, 22762168], [22762169, 24831456], [24831457, 26900744], [26900745, 28970032], [28970033, 31039320], [31039321, 33108608], [33108609, 35177896], [35177897, 37247184], [37247185, 39316472], [39316473, 41385763]] SRR7804160 file size 14002576 SRR7804160 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804160 SRR7804160_1.fastq SRR7804160_2.fastq Input file: SRR7804160_1.fastq Paired file: SRR7804160_2.fastq trimmed: SRR7804160-trimmed-pair1.fastq, SRR7804160-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:07:14 2024 >> started Tue Dec 10 03:08:02 2024 >> done (47.618s) 41385763 read pairs processed; of these: 96 ( 0.00%) short read pairs filtered out after trimming by size control 1081 ( 0.00%) empty read pairs filtered out after trimming by size control 41384586 (100.00%) read pairs available; of these: 998507 ( 2.41%) trimmed read pairs available after processing 40386079 (97.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 18 0.00% 20 26 0.00% 21 16 0.00% 22 25 0.00% 23 19 0.00% 24 38 0.00% 25 32 0.00% 26 28 0.00% 27 36 0.00% 28 51 0.00% 29 37 0.00% 30 44 0.00% 31 47 0.00% 32 56 0.00% 33 53 0.00% 34 50 0.00% 35 67 0.00% 36 54 0.00% 37 72 0.00% 38 67 0.00% 39 77 0.00% 40 60 0.00% 41 73 0.00% 42 73 0.00% 43 84 0.00% 44 86 0.00% 45 101 0.00% 46 94 0.00% 47 75 0.00% 48 89 0.00% 49 89 0.00% 50 113 0.00% 51 100 0.00% 52 115 0.00% 53 118 0.00% 54 114 0.00% 55 124 0.00% 56 106 0.00% 57 126 0.00% 58 131 0.00% 59 123 0.00% 60 132 0.00% 61 138 0.00% 62 168 0.00% 63 125 0.00% 64 193 0.00% 65 172 0.00% 66 190 0.00% 67 198 0.00% 68 194 0.00% 69 214 0.00% 70 198 0.00% 71 264 0.00% 72 278 0.00% 73 297 0.00% 74 325 0.00% 75 329 0.00% 76 357 0.00% 77 378 0.00% 78 412 0.00% 79 490 0.00% 80 550 0.00% 81 597 0.00% 82 626 0.00% 83 731 0.00% 84 802 0.00% 85 902 0.00% 86 1035 0.00% 87 1032 0.00% 88 1229 0.00% 89 1337 0.00% 90 1409 0.00% 91 1585 0.00% 92 1807 0.00% 93 1928 0.00% 94 2178 0.01% 95 2446 0.01% 96 2564 0.01% 97 2846 0.01% 98 3143 0.01% 99 3339 0.01% 100 3535 0.01% 101 3974 0.01% 102 4193 0.01% 103 4701 0.01% 104 4792 0.01% 105 5333 0.01% 106 5758 0.01% 107 6049 0.01% 108 6476 0.02% 109 6899 0.02% 110 7384 0.02% 111 7781 0.02% 112 8331 0.02% 113 8917 0.02% 114 9348 0.02% 115 10204 0.02% 116 10537 0.03% 117 11175 0.03% 118 11816 0.03% 119 12227 0.03% 120 12703 0.03% 121 13521 0.03% 122 14200 0.03% 123 14888 0.04% 124 15926 0.04% 125 16544 0.04% 126 17081 0.04% 127 18076 0.04% 128 18373 0.04% 129 19490 0.05% 130 20327 0.05% 131 21049 0.05% 132 22506 0.05% 133 22920 0.06% 134 24483 0.06% 135 25168 0.06% 136 26725 0.06% 137 27503 0.07% 138 28292 0.07% 139 29329 0.07% 140 30161 0.07% 141 31167 0.08% 142 32920 0.08% 143 33557 0.08% 144 34639 0.08% 145 36320 0.09% 146 37646 0.09% 147 39042 0.09% 148 40655 0.10% 149 41066 0.10% 150 42743 0.10% 151 40386079 97.59% 41384586 reads passed initial QC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=3.18 fanout-score-rank=14 prefix-density=0.87 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=20.51 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=2.1 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=22 prefix-density=0.52 prefix-fanout=2.4 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=143.88 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=8.7 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR7804160 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:08:57 Started mapping on | Dec 10 03:08:57 Finished on | Dec 10 03:14:18 Mapping speed, Million of reads per hour | 464.13 Number of input reads | 41384586 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 39768027 Uniquely mapped reads % | 96.09% Average mapped length | 300.08 Number of splices: Total | 43133058 Number of splices: Annotated (sjdb) | 40657251 Number of splices: GT/AG | 42539999 Number of splices: GC/AG | 525795 Number of splices: AT/AC | 14435 Number of splices: Non-canonical | 52829 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.62 Insertion rate per base | 0.01% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 426385 % of reads mapped to multiple loci | 1.03% Number of reads mapped to too many loci | 23976 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.38% % of reads unmapped: other | 0.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1190174 1190174 1190174 N_multimapping 426385 426385 426385 N_noFeature 1153109 38516443 1499549 N_ambiguous 1090527 6915 187370 UnstrandedReadsAssigned:37524391 PositiveStrandReadsAssigned:1244669 NegativeStrandReadsAssigned:38081108 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804160 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804160-trimmed-pair1.fastq SRR7804160-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,384,586 reads, 38,253,587 reads pseudoaligned [quant] estimated average fragment length: 332.181 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,309 rounds 52973 SRR7804160.ke.tsv 35125 SRR7804160.se.tsv 88098 total ==> SRR7804160.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 606.139 0 0 PNS24247 1044 712.819 131.243 6.17174 PNS24249 1928 1596.82 145.876 3.06222 PNS24246 1044 712.819 131.243 6.17174 PNS24248 1044 712.819 131.243 6.17174 PNS24244 1471 1139.82 159.394 4.68756 PNS24243 293 70.4604 0 0 KQK14069 1603 1271.82 2552.94 67.286 KQK14071 474 189.47 85.3124 15.0932 ==> SRR7804160.se.tsv <== BRADI_1g14170v3 3169 BRADI_1g53295v3 260 BRADI_1g59795v3 1701 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 800 BRADI_1g74790v3 391 BRADI_1g09890v3 0 BRADI_1g77505v3 466 BRADI_1g48960v3 0 SRR7804160 completed mapping pipeline successfully