Starting /dee2/code/volunteer_pipeline.sh SRR7804161 current disk space = 1525380935680 free memory = 1565421148 SRR7804161 SRAfilesize 8a7c8be782c95c081c954b13ec183389 SRR7804161.sra SRR7804161.sra file validated SRR7804161 is paired end SRR7804161 is conventional basespace SRR7804161 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804161_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.99925 37.0 37.0 37.0 37.0 37.0 2 36.1515 37.0 37.0 37.0 37.0 37.0 3 36.422 37.0 37.0 37.0 37.0 37.0 4 36.3805 37.0 37.0 37.0 37.0 37.0 5 36.4095 37.0 37.0 37.0 37.0 37.0 6 36.503 37.0 37.0 37.0 37.0 37.0 7 36.3475 37.0 37.0 37.0 37.0 37.0 8 36.5285 37.0 37.0 37.0 37.0 37.0 9 36.4165 37.0 37.0 37.0 37.0 37.0 10-14 36.452999999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.4507 37.0 37.0 37.0 37.0 37.0 20-24 36.4228 37.0 37.0 37.0 37.0 37.0 25-29 36.3826 37.0 37.0 37.0 37.0 37.0 30-34 36.407 37.0 37.0 37.0 37.0 37.0 35-39 36.342 37.0 37.0 37.0 37.0 37.0 40-44 36.276500000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.2481 37.0 37.0 37.0 37.0 37.0 50-54 36.243700000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.1577 37.0 37.0 37.0 37.0 37.0 60-64 36.1755 37.0 37.0 37.0 37.0 37.0 65-69 36.1711 37.0 37.0 37.0 37.0 37.0 70-74 36.0727 37.0 37.0 37.0 37.0 37.0 75-79 36.031 37.0 37.0 37.0 37.0 37.0 80-84 36.0864 37.0 37.0 37.0 37.0 37.0 85-89 36.001999999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.002 37.0 37.0 37.0 37.0 37.0 95-99 35.852599999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.7838 37.0 37.0 37.0 37.0 37.0 105-109 35.6806 37.0 37.0 37.0 37.0 37.0 110-114 35.7749 37.0 37.0 37.0 37.0 37.0 115-119 35.597 37.0 37.0 37.0 37.0 37.0 120-124 35.5359 37.0 37.0 37.0 37.0 37.0 125-129 35.5567 37.0 37.0 37.0 37.0 37.0 130-134 35.4724 37.0 37.0 37.0 34.6 37.0 135-139 35.319500000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.29729999999999 37.0 37.0 37.0 29.8 37.0 145-149 35.0903 37.0 37.0 37.0 27.4 37.0 150-151 34.429500000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 1.0 23 0.0 24 2.0 25 7.0 26 11.0 27 10.0 28 16.0 29 23.0 30 48.0 31 54.0 32 77.0 33 120.0 34 175.0 35 466.0 36 2741.0 37 248.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.38703191756723 12.314651922593617 10.153304850464941 37.14501130937421 2 25.624999999999996 17.474999999999998 34.0 22.900000000000002 3 23.799999999999997 25.3 22.55 28.349999999999998 4 27.0 30.7 19.8 22.5 5 25.674999999999997 32.5 21.0 20.825 6 21.725 32.5 22.125 23.65 7 17.0 19.55 42.25 21.2 8 21.175 20.075000000000003 26.450000000000003 32.300000000000004 9 20.575 19.425 31.1 28.9 10-14 23.86 25.805 24.47 25.865 15-19 24.3 24.985 25.069999999999997 25.645 20-24 24.060000000000002 24.935 24.52 26.484999999999996 25-29 24.39 25.005 23.855 26.75 30-34 24.5 25.335 23.72 26.445 35-39 24.235 24.445 24.490000000000002 26.83 40-44 24.490000000000002 24.560000000000002 24.66 26.290000000000003 45-49 24.46 24.65 24.45 26.44 50-54 24.490000000000002 24.975 24.285 26.25 55-59 24.42 24.75 24.83 26.0 60-64 25.040000000000003 24.349999999999998 24.335 26.275 65-69 24.455 24.55 24.279999999999998 26.715 70-74 24.34 24.560000000000002 24.485 26.615 75-79 25.09 24.245 24.01 26.655 80-84 24.85 24.12 24.51 26.52 85-89 24.58 24.29 24.45 26.68 90-94 25.495 23.75 24.104999999999997 26.650000000000002 95-99 24.935 23.665 24.279999999999998 27.12 100-104 24.195 24.015 24.825 26.965 105-109 24.985 23.7 24.185000000000002 27.13 110-114 25.215 24.425 24.085 26.275 115-119 24.95 24.185000000000002 23.97 26.895000000000003 120-124 25.11 24.560000000000002 23.94 26.39 125-129 25.605 23.525 23.5 27.37 130-134 26.040000000000003 23.47 23.555 26.935 135-139 25.22 23.785 24.11 26.884999999999998 140-144 25.905 23.685000000000002 23.855 26.555 145-149 25.955000000000002 23.474999999999998 24.295 26.275 150-151 25.624999999999996 23.25 23.525 27.6 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 2.0 24 1.5 25 0.5 26 0.5 27 1.0 28 4.0 29 9.5 30 12.0 31 11.5 32 10.0 33 15.5 34 29.5 35 37.5 36 41.5 37 58.5 38 73.5 39 90.0 40 111.5 41 134.0 42 149.5 43 158.5 44 179.0 45 186.0 46 178.5 47 180.0 48 154.0 49 146.5 50 161.0 51 144.5 52 125.5 53 109.5 54 95.5 55 89.5 56 100.0 57 92.5 58 79.5 59 83.5 60 76.5 61 74.0 62 71.5 63 75.5 64 83.0 65 65.5 66 60.5 67 63.5 68 56.0 69 47.5 70 45.5 71 41.5 72 31.0 73 27.0 74 30.0 75 28.5 76 18.5 77 13.5 78 14.5 79 10.5 80 4.0 81 1.0 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.25 #Duplication Level Percentage of deduplicated Percentage of total 1 95.30183727034121 90.77499999999999 2 4.435695538057742 8.450000000000001 3 0.23622047244094488 0.675 4 0.026246719160104987 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0125 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.525 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.8625 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 0.975 0.0 0.0 0.0 0.0 130-131 1.0625 0.0 0.0 0.0 0.0 132-133 1.15 0.0 0.0 0.0 0.0 134-135 1.2625000000000002 0.0 0.0 0.0 0.0 136-137 1.3375 0.0 0.0 0.0 0.0 138-139 1.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804161 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804161_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2855 37.0 37.0 37.0 37.0 37.0 2 35.9415 37.0 37.0 37.0 37.0 37.0 3 36.063 37.0 37.0 37.0 37.0 37.0 4 36.2085 37.0 37.0 37.0 37.0 37.0 5 36.27 37.0 37.0 37.0 37.0 37.0 6 36.012 37.0 37.0 37.0 37.0 37.0 7 35.9565 37.0 37.0 37.0 37.0 37.0 8 36.1665 37.0 37.0 37.0 37.0 37.0 9 36.244 37.0 37.0 37.0 37.0 37.0 10-14 36.0407 37.0 37.0 37.0 37.0 37.0 15-19 36.021100000000004 37.0 37.0 37.0 37.0 37.0 20-24 35.976299999999995 37.0 37.0 37.0 37.0 37.0 25-29 35.913 37.0 37.0 37.0 37.0 37.0 30-34 35.9487 37.0 37.0 37.0 37.0 37.0 35-39 35.830600000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.7787 37.0 37.0 37.0 37.0 37.0 45-49 35.71 37.0 37.0 37.0 37.0 37.0 50-54 35.7415 37.0 37.0 37.0 37.0 37.0 55-59 35.7252 37.0 37.0 37.0 37.0 37.0 60-64 35.5697 37.0 37.0 37.0 37.0 37.0 65-69 35.4983 37.0 37.0 37.0 37.0 37.0 70-74 35.5471 37.0 37.0 37.0 37.0 37.0 75-79 35.4384 37.0 37.0 37.0 37.0 37.0 80-84 35.3704 37.0 37.0 37.0 37.0 37.0 85-89 35.290800000000004 37.0 37.0 37.0 34.6 37.0 90-94 35.2171 37.0 37.0 37.0 32.2 37.0 95-99 35.053999999999995 37.0 37.0 37.0 25.0 37.0 100-104 35.067600000000006 37.0 37.0 37.0 27.4 37.0 105-109 34.976299999999995 37.0 37.0 37.0 25.0 37.0 110-114 34.8969 37.0 37.0 37.0 25.0 37.0 115-119 34.81 37.0 37.0 37.0 25.0 37.0 120-124 34.7169 37.0 37.0 37.0 25.0 37.0 125-129 34.5954 37.0 37.0 37.0 25.0 37.0 130-134 34.5591 37.0 37.0 37.0 25.0 37.0 135-139 34.3556 37.0 37.0 37.0 25.0 37.0 140-144 34.1481 37.0 37.0 37.0 25.0 37.0 145-149 34.08720000000001 37.0 37.0 37.0 25.0 37.0 150-151 33.292500000000004 37.0 31.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 1.0 14 4.0 15 1.0 16 1.0 17 2.0 18 2.0 19 0.0 20 2.0 21 4.0 22 8.0 23 7.0 24 17.0 25 10.0 26 17.0 27 14.0 28 27.0 29 28.0 30 52.0 31 75.0 32 118.0 33 190.0 34 335.0 35 901.0 36 2126.0 37 55.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.050000000000004 12.75 12.875 35.325 2 29.275000000000002 18.725 29.375 22.625 3 24.099999999999998 22.400000000000002 26.625 26.875 4 28.875 28.499999999999996 16.975 25.650000000000002 5 27.375 33.675 17.1 21.85 6 20.349999999999998 33.825 19.950000000000003 25.874999999999996 7 20.674999999999997 15.024999999999999 37.4 26.900000000000002 8 24.3 19.35 21.075 35.275 9 24.175 19.5 26.025 30.3 10-14 25.835 24.54 22.259999999999998 27.365000000000002 15-19 26.915 23.93 22.825 26.33 20-24 26.805 24.154999999999998 22.64 26.400000000000002 25-29 25.755 24.0 22.97 27.275 30-34 26.365 24.33 22.655 26.650000000000002 35-39 26.674999999999997 24.02 22.564999999999998 26.740000000000002 40-44 27.01 23.849999999999998 22.85 26.290000000000003 45-49 27.229999999999997 23.73 22.564999999999998 26.474999999999998 50-54 26.765 23.78 22.765 26.69 55-59 27.42 22.985 22.314999999999998 27.279999999999998 60-64 26.69 23.205000000000002 22.720000000000002 27.384999999999998 65-69 26.790000000000003 24.0 22.255 26.955000000000002 70-74 27.165 23.325000000000003 22.81 26.700000000000003 75-79 26.76 23.405 22.845 26.99 80-84 26.845000000000002 23.605 22.78 26.77 85-89 27.77 23.255 22.42 26.555 90-94 26.995 24.015 22.05 26.939999999999998 95-99 27.435 24.07 22.305 26.19 100-104 27.169999999999998 23.395 22.775000000000002 26.66 105-109 27.41 23.945 22.245 26.400000000000002 110-114 27.375 23.775 23.04 25.81 115-119 27.800000000000004 23.494999999999997 22.61 26.095000000000002 120-124 27.224999999999998 23.695 22.64 26.44 125-129 27.66 23.400000000000002 22.775000000000002 26.165 130-134 27.439999999999998 23.974999999999998 22.535 26.05 135-139 27.505000000000003 24.295 22.52 25.679999999999996 140-144 27.925 24.37 22.375 25.330000000000002 145-149 27.36 24.035 23.16 25.445 150-151 27.750000000000004 25.374999999999996 21.975 24.9 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 1.0 11 1.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 2.0 23 1.5 24 0.0 25 0.0 26 1.0 27 1.5 28 3.0 29 4.5 30 5.5 31 8.0 32 9.0 33 12.5 34 18.0 35 22.0 36 31.0 37 44.0 38 56.5 39 74.5 40 94.0 41 114.0 42 115.5 43 110.5 44 134.0 45 140.5 46 139.5 47 145.0 48 145.0 49 142.5 50 126.5 51 122.5 52 117.0 53 115.0 54 110.5 55 91.5 56 83.0 57 89.5 58 89.5 59 98.5 60 113.5 61 105.0 62 103.5 63 105.0 64 96.0 65 91.0 66 90.5 67 82.0 68 77.5 69 79.5 70 75.5 71 73.5 72 70.0 73 55.5 74 38.5 75 29.0 76 25.5 77 18.5 78 12.0 79 9.5 80 9.0 81 6.0 82 2.5 83 1.5 84 0.5 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.675 #Duplication Level Percentage of deduplicated Percentage of total 1 94.9300237655136 89.875 2 4.5946659625033 8.7 3 0.39609189331925004 1.125 4 0.07921837866385001 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.48750000000000004 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.8 0.0 0.0 0.0 0.0 124-125 0.9125000000000001 0.0 0.0 0.0 0.0 126-127 0.95 0.0 0.0 0.0 0.0 128-129 1.025 0.0 0.0 0.0 0.0 130-131 1.0875 0.0 0.0 0.0 0.0 132-133 1.175 0.0 0.0 0.0 0.0 134-135 1.3 0.0 0.0 0.0 0.0 136-137 1.3875 0.0 0.0 0.0 0.0 138-139 1.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGATTC 10 0.006830828 145.0 2 TTCTATG 10 0.006830828 145.0 6 AAAAAAA 25 4.977651E-4 29.0 65-69 >>END_MODULE Read 1999790 spots for SRR7804161.sra Written 1999790 spots for SRR7804161.sra Read 1999790 spots for SRR7804161.sra Written 1999790 spots for SRR7804161.sra Read 1999790 spots for SRR7804161.sra Written 1999790 spots for SRR7804161.sra Read 1999790 spots for SRR7804161.sra Written 1999790 spots for SRR7804161.sra Read 1999790 spots for SRR7804161.sra Written 1999790 spots for SRR7804161.sra Read 1999790 spots for SRR7804161.sra Written 1999790 spots for SRR7804161.sra Read 1999790 spots for SRR7804161.sra Written 1999790 spots for SRR7804161.sra Read 1999790 spots for SRR7804161.sra Written 1999790 spots for SRR7804161.sra Read 1999790 spots for SRR7804161.sra Written 1999790 spots for SRR7804161.sra Read 1999790 spots for SRR7804161.sra Written 1999790 spots for SRR7804161.sra Read 1999790 spots for SRR7804161.sra Written 1999790 spots for SRR7804161.sra Read 1999790 spots for SRR7804161.sra Written 1999790 spots for SRR7804161.sra Read 1999790 spots for SRR7804161.sra Written 1999790 spots for SRR7804161.sra Read 1999797 spots for SRR7804161.sra Written 1999797 spots for SRR7804161.sra Read 1999790 spots for SRR7804161.sra Written 1999790 spots for SRR7804161.sra Read 1999790 spots for SRR7804161.sra Written 1999790 spots for SRR7804161.sra Read 1999790 spots for SRR7804161.sra Written 1999790 spots for SRR7804161.sra Read 1999790 spots for SRR7804161.sra Written 1999790 spots for SRR7804161.sra Read 1999790 spots for SRR7804161.sra Written 1999790 spots for SRR7804161.sra Read 1999790 spots for SRR7804161.sra Written 1999790 spots for SRR7804161.sra SRR ids: ['SRR7804161.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zxqxg1cg SRR7804161.sra spots: 39995807 blocks: [[1, 1999790], [1999791, 3999580], [3999581, 5999370], [5999371, 7999160], [7999161, 9998950], [9998951, 11998740], [11998741, 13998530], [13998531, 15998320], [15998321, 17998110], [17998111, 19997900], [19997901, 21997690], [21997691, 23997480], [23997481, 25997270], [25997271, 27997060], [27997061, 29996850], [29996851, 31996640], [31996641, 33996430], [33996431, 35996220], [35996221, 37996010], [37996011, 39995807]] SRR7804161 file size 13531566 SRR7804161 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804161 SRR7804161_1.fastq SRR7804161_2.fastq Input file: SRR7804161_1.fastq Paired file: SRR7804161_2.fastq trimmed: SRR7804161-trimmed-pair1.fastq, SRR7804161-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:04:29 2024 >> started Tue Dec 10 03:05:12 2024 >> done (43.471s) 39995807 read pairs processed; of these: 125 ( 0.00%) short read pairs filtered out after trimming by size control 1574 ( 0.00%) empty read pairs filtered out after trimming by size control 39994108 (100.00%) read pairs available; of these: 997861 ( 2.50%) trimmed read pairs available after processing 38996247 (97.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 23 0.00% 20 31 0.00% 21 24 0.00% 22 32 0.00% 23 30 0.00% 24 34 0.00% 25 43 0.00% 26 39 0.00% 27 40 0.00% 28 57 0.00% 29 51 0.00% 30 58 0.00% 31 49 0.00% 32 73 0.00% 33 44 0.00% 34 68 0.00% 35 86 0.00% 36 65 0.00% 37 65 0.00% 38 83 0.00% 39 55 0.00% 40 77 0.00% 41 79 0.00% 42 85 0.00% 43 92 0.00% 44 52 0.00% 45 76 0.00% 46 82 0.00% 47 88 0.00% 48 99 0.00% 49 102 0.00% 50 95 0.00% 51 106 0.00% 52 105 0.00% 53 134 0.00% 54 121 0.00% 55 112 0.00% 56 132 0.00% 57 119 0.00% 58 145 0.00% 59 124 0.00% 60 141 0.00% 61 153 0.00% 62 156 0.00% 63 158 0.00% 64 188 0.00% 65 156 0.00% 66 204 0.00% 67 199 0.00% 68 210 0.00% 69 217 0.00% 70 231 0.00% 71 282 0.00% 72 318 0.00% 73 342 0.00% 74 302 0.00% 75 346 0.00% 76 381 0.00% 77 400 0.00% 78 447 0.00% 79 549 0.00% 80 550 0.00% 81 613 0.00% 82 693 0.00% 83 755 0.00% 84 842 0.00% 85 882 0.00% 86 1026 0.00% 87 1171 0.00% 88 1235 0.00% 89 1407 0.00% 90 1495 0.00% 91 1635 0.00% 92 1892 0.00% 93 2143 0.01% 94 2370 0.01% 95 2430 0.01% 96 2751 0.01% 97 3054 0.01% 98 3150 0.01% 99 3386 0.01% 100 3750 0.01% 101 4104 0.01% 102 4494 0.01% 103 4771 0.01% 104 5029 0.01% 105 5475 0.01% 106 5943 0.01% 107 6292 0.02% 108 6670 0.02% 109 7070 0.02% 110 7479 0.02% 111 8168 0.02% 112 8547 0.02% 113 9242 0.02% 114 9736 0.02% 115 10353 0.03% 116 10625 0.03% 117 11124 0.03% 118 11708 0.03% 119 12379 0.03% 120 13023 0.03% 121 13674 0.03% 122 14625 0.04% 123 15299 0.04% 124 15989 0.04% 125 17106 0.04% 126 17618 0.04% 127 18151 0.05% 128 18403 0.05% 129 19225 0.05% 130 20342 0.05% 131 21065 0.05% 132 22265 0.06% 133 23048 0.06% 134 24259 0.06% 135 25361 0.06% 136 26818 0.07% 137 26822 0.07% 138 28298 0.07% 139 28928 0.07% 140 29303 0.07% 141 31024 0.08% 142 32260 0.08% 143 32481 0.08% 144 34527 0.09% 145 36036 0.09% 146 37129 0.09% 147 38423 0.10% 148 39363 0.10% 149 40154 0.10% 150 41930 0.10% 151 38996247 97.50% 39994108 reads passed initial QC criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=17 prefix-density=0.88 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=22.19 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=2.4 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=21 prefix-density=0.72 prefix-fanout=2.8 sequence=CCGCATCACCATGCGCAAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=142.08 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.3 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR7804161 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:06:05 Started mapping on | Dec 10 03:06:05 Finished on | Dec 10 03:10:46 Mapping speed, Million of reads per hour | 512.38 Number of input reads | 39994108 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 38144500 Uniquely mapped reads % | 95.38% Average mapped length | 299.94 Number of splices: Total | 39740037 Number of splices: Annotated (sjdb) | 37499962 Number of splices: GT/AG | 39190684 Number of splices: GC/AG | 484063 Number of splices: AT/AC | 13237 Number of splices: Non-canonical | 52053 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.60 Insertion rate per base | 0.01% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 390443 % of reads mapped to multiple loci | 0.98% Number of reads mapped to too many loci | 19067 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.25% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1459165 1459165 1459165 N_multimapping 390443 390443 390443 N_noFeature 1063470 36941343 1426505 N_ambiguous 1028080 6600 189135 UnstrandedReadsAssigned:36052950 PositiveStrandReadsAssigned:1196557 NegativeStrandReadsAssigned:36528860 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804161 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804161-trimmed-pair1.fastq SRR7804161-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,994,108 reads, 36,816,431 reads pseudoaligned [quant] estimated average fragment length: 333.893 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52973 SRR7804161.ke.tsv 35125 SRR7804161.se.tsv 88098 total ==> SRR7804161.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 604.343 0 0 PNS24247 1044 711.107 115.499 5.58254 PNS24249 1928 1595.11 194.641 4.19404 PNS24246 1044 711.107 115.499 5.58254 PNS24248 1044 711.107 115.499 5.58254 PNS24244 1471 1138.11 137.862 4.16344 PNS24243 293 71.6129 0 0 KQK14069 1603 1270.11 2155.85 58.34 KQK14071 474 188.633 93.5322 17.0425 ==> SRR7804161.se.tsv <== BRADI_1g14170v3 2625 BRADI_1g53295v3 180 BRADI_1g59795v3 1681 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 811 BRADI_1g74790v3 483 BRADI_1g09890v3 0 BRADI_1g77505v3 483 BRADI_1g48960v3 0 SRR7804161 completed mapping pipeline successfully