Starting /dee2/code/volunteer_pipeline.sh SRR7804162 current disk space = 1525376286720 free memory = 1565489484 SRR7804162 SRAfilesize 2b0db1fcbe98a9d5687ff78c0b7e9d2a SRR7804162.sra SRR7804162.sra file validated SRR7804162 is paired end SRR7804162 is conventional basespace SRR7804162 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804162_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.106 37.0 37.0 37.0 37.0 37.0 2 36.2405 37.0 37.0 37.0 37.0 37.0 3 36.418 37.0 37.0 37.0 37.0 37.0 4 36.422 37.0 37.0 37.0 37.0 37.0 5 36.5245 37.0 37.0 37.0 37.0 37.0 6 36.455 37.0 37.0 37.0 37.0 37.0 7 36.2875 37.0 37.0 37.0 37.0 37.0 8 36.43 37.0 37.0 37.0 37.0 37.0 9 36.3815 37.0 37.0 37.0 37.0 37.0 10-14 36.5052 37.0 37.0 37.0 37.0 37.0 15-19 36.522 37.0 37.0 37.0 37.0 37.0 20-24 36.4865 37.0 37.0 37.0 37.0 37.0 25-29 36.4342 37.0 37.0 37.0 37.0 37.0 30-34 36.381099999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.33579999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.336200000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.292899999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.216899999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.216899999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.231700000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.2281 37.0 37.0 37.0 37.0 37.0 70-74 36.1483 37.0 37.0 37.0 37.0 37.0 75-79 36.076299999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.119600000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.9611 37.0 37.0 37.0 37.0 37.0 90-94 35.9951 37.0 37.0 37.0 37.0 37.0 95-99 35.8725 37.0 37.0 37.0 37.0 37.0 100-104 35.8467 37.0 37.0 37.0 37.0 37.0 105-109 35.8248 37.0 37.0 37.0 37.0 37.0 110-114 35.8035 37.0 37.0 37.0 37.0 37.0 115-119 35.7413 37.0 37.0 37.0 37.0 37.0 120-124 35.5683 37.0 37.0 37.0 37.0 37.0 125-129 35.622 37.0 37.0 37.0 37.0 37.0 130-134 35.431400000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.311099999999996 37.0 37.0 37.0 34.6 37.0 140-144 35.363099999999996 37.0 37.0 37.0 32.2 37.0 145-149 35.1075 37.0 37.0 37.0 27.4 37.0 150-151 34.40475 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 2.0 25 1.0 26 7.0 27 5.0 28 23.0 29 29.0 30 36.0 31 47.0 32 72.0 33 124.0 34 185.0 35 436.0 36 2805.0 37 225.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.28686058174524 12.41223671013039 11.108324974924773 39.1925777331996 2 25.324999999999996 18.625 33.800000000000004 22.25 3 22.55 24.349999999999998 23.3 29.799999999999997 4 27.425 30.049999999999997 19.775000000000002 22.75 5 25.974999999999998 31.874999999999996 21.349999999999998 20.8 6 21.349999999999998 33.975 23.125 21.55 7 17.0 18.425 42.075 22.5 8 20.974999999999998 18.7 27.275 33.050000000000004 9 22.05 19.75 28.299999999999997 29.9 10-14 23.674999999999997 26.179999999999996 24.375 25.77 15-19 24.97 24.59 24.18 26.26 20-24 24.185000000000002 24.88 24.745 26.19 25-29 24.765 24.755 24.834999999999997 25.645 30-34 23.925 25.074999999999996 24.015 26.985 35-39 24.32 24.474999999999998 24.625 26.58 40-44 24.175 24.77 24.85 26.205000000000002 45-49 24.815 23.655 24.935 26.595000000000002 50-54 23.915 24.09 25.035 26.96 55-59 25.080000000000002 24.505 24.12 26.295 60-64 24.555 24.959999999999997 23.935000000000002 26.55 65-69 25.380000000000003 24.165 23.974999999999998 26.479999999999997 70-74 25.069999999999997 24.44 23.895 26.595000000000002 75-79 24.95 24.115000000000002 24.08 26.855 80-84 24.81 24.205 24.23 26.755000000000003 85-89 24.9 23.880000000000003 24.005000000000003 27.215 90-94 25.424999999999997 23.885 23.805 26.884999999999998 95-99 25.130000000000003 24.005000000000003 24.099999999999998 26.765 100-104 25.39 24.125 24.035 26.450000000000003 105-109 25.169999999999998 24.044999999999998 24.095 26.69 110-114 25.424999999999997 24.005000000000003 23.630000000000003 26.939999999999998 115-119 25.424999999999997 24.224999999999998 23.575 26.775 120-124 25.324999999999996 23.56 23.575 27.54 125-129 25.72 23.815 23.635 26.83 130-134 25.855 23.200000000000003 24.04 26.905 135-139 25.86 23.525 23.985 26.63 140-144 26.029999999999998 23.369999999999997 23.525 27.075 145-149 26.405 23.919999999999998 22.564999999999998 27.11 150-151 26.1 22.7375 23.7375 27.425 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.5 26 2.5 27 1.5 28 1.0 29 5.0 30 7.0 31 8.5 32 16.0 33 24.0 34 32.0 35 33.5 36 47.0 37 64.5 38 73.5 39 85.5 40 93.0 41 124.0 42 146.5 43 151.0 44 161.5 45 157.0 46 170.0 47 178.0 48 164.5 49 149.5 50 137.0 51 145.5 52 132.0 53 113.0 54 110.0 55 105.5 56 110.0 57 101.0 58 92.5 59 96.0 60 89.5 61 89.5 62 88.0 63 70.5 64 73.5 65 79.5 66 68.0 67 60.5 68 57.5 69 53.5 70 48.5 71 39.0 72 32.5 73 27.0 74 18.5 75 14.0 76 13.0 77 12.0 78 10.0 79 7.0 80 2.5 81 1.5 82 2.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.175 #Duplication Level Percentage of deduplicated Percentage of total 1 95.16679800367743 90.575 2 4.596795376937221 8.75 3 0.2364066193853428 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.30000000000000004 0.0 0.0 0.0 0.0 118-119 0.4375 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.7375 0.0 0.0 0.0 0.025 126-127 0.85 0.0 0.0 0.0 0.025 128-129 0.9125000000000001 0.0 0.0 0.0 0.025 130-131 0.9875 0.0 0.0 0.0 0.025 132-133 1.075 0.0 0.0 0.0 0.025 134-135 1.2125 0.0 0.0 0.0 0.025 136-137 1.2875 0.0 0.0 0.0 0.025 138-139 1.4375 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGGTAG 10 0.006830828 145.0 3 AGGGTAC 10 0.006830828 145.0 5 CAGAGAG 10 0.006830828 145.0 1 CAGGGTA 10 0.006830828 145.0 4 GTTGTTT 10 0.006830828 145.0 1 AAGTTCA 10 0.006830828 145.0 4 >>END_MODULE SRR7804162 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804162_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4775 37.0 37.0 37.0 37.0 37.0 2 36.0825 37.0 37.0 37.0 37.0 37.0 3 36.196 37.0 37.0 37.0 37.0 37.0 4 36.296 37.0 37.0 37.0 37.0 37.0 5 36.285 37.0 37.0 37.0 37.0 37.0 6 36.2 37.0 37.0 37.0 37.0 37.0 7 36.167 37.0 37.0 37.0 37.0 37.0 8 36.335 37.0 37.0 37.0 37.0 37.0 9 36.207 37.0 37.0 37.0 37.0 37.0 10-14 36.2371 37.0 37.0 37.0 37.0 37.0 15-19 36.175599999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.137 37.0 37.0 37.0 37.0 37.0 25-29 36.0604 37.0 37.0 37.0 37.0 37.0 30-34 36.0137 37.0 37.0 37.0 37.0 37.0 35-39 35.9871 37.0 37.0 37.0 37.0 37.0 40-44 35.9903 37.0 37.0 37.0 37.0 37.0 45-49 35.8552 37.0 37.0 37.0 37.0 37.0 50-54 35.84929999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.8308 37.0 37.0 37.0 37.0 37.0 60-64 35.738600000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.6971 37.0 37.0 37.0 37.0 37.0 70-74 35.677099999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.637600000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.4893 37.0 37.0 37.0 37.0 37.0 85-89 35.4142 37.0 37.0 37.0 37.0 37.0 90-94 35.482600000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.2422 37.0 37.0 37.0 32.2 37.0 100-104 35.1746 37.0 37.0 37.0 27.4 37.0 105-109 35.1928 37.0 37.0 37.0 27.4 37.0 110-114 35.060500000000005 37.0 37.0 37.0 25.0 37.0 115-119 35.0357 37.0 37.0 37.0 25.0 37.0 120-124 34.9482 37.0 37.0 37.0 25.0 37.0 125-129 34.8022 37.0 37.0 37.0 25.0 37.0 130-134 34.773199999999996 37.0 37.0 37.0 25.0 37.0 135-139 34.616699999999994 37.0 37.0 37.0 25.0 37.0 140-144 34.3708 37.0 37.0 37.0 25.0 37.0 145-149 34.2743 37.0 37.0 37.0 25.0 37.0 150-151 33.449 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 4.0 15 5.0 16 1.0 17 0.0 18 2.0 19 1.0 20 3.0 21 4.0 22 3.0 23 4.0 24 10.0 25 10.0 26 19.0 27 17.0 28 21.0 29 29.0 30 45.0 31 51.0 32 82.0 33 161.0 34 319.0 35 846.0 36 2281.0 37 82.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.675000000000004 13.0 12.75 38.574999999999996 2 27.6 19.925 30.7 21.775 3 24.325 21.775 26.650000000000002 27.250000000000004 4 27.474999999999998 30.8 16.975 24.75 5 28.449999999999996 31.275 18.3 21.975 6 23.875 32.6 18.099999999999998 25.424999999999997 7 21.575 14.45 35.775 28.199999999999996 8 22.1 20.0 21.8 36.1 9 23.849999999999998 19.75 25.5 30.9 10-14 26.195 23.849999999999998 21.575 28.38 15-19 26.46 23.549999999999997 22.869999999999997 27.12 20-24 26.35 23.615 22.09 27.944999999999997 25-29 26.314999999999998 23.544999999999998 22.755 27.384999999999998 30-34 26.490000000000002 24.075 22.055 27.38 35-39 26.465 23.935000000000002 22.384999999999998 27.215 40-44 27.11 23.565 21.990000000000002 27.334999999999997 45-49 27.38 23.24 22.255 27.125 50-54 27.389999999999997 23.69 22.085 26.834999999999997 55-59 26.91 23.135 22.43 27.525 60-64 27.985 23.315 22.17 26.529999999999998 65-69 27.04 24.255 22.335 26.369999999999997 70-74 27.46 23.28 22.134999999999998 27.125 75-79 27.21 23.22 22.465 27.105 80-84 26.790000000000003 24.05 22.3 26.86 85-89 27.02 23.265 22.259999999999998 27.455000000000002 90-94 26.669999999999998 23.655 22.46 27.215 95-99 28.01 23.44 21.935 26.615 100-104 27.74 23.345 22.314999999999998 26.6 105-109 26.61 24.05 22.205 27.134999999999998 110-114 27.49 23.845 22.585 26.08 115-119 27.089999999999996 23.94 22.314999999999998 26.655 120-124 27.875 23.97 21.865000000000002 26.290000000000003 125-129 27.495000000000005 23.765 22.755 25.985000000000003 130-134 27.66 23.669999999999998 22.555 26.115 135-139 27.43 24.025 22.564999999999998 25.979999999999997 140-144 27.495000000000005 23.985 22.21 26.31 145-149 27.744999999999997 24.385 22.15 25.72 150-151 27.6 24.4125 22.1375 25.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 2.5 28 2.5 29 2.5 30 4.0 31 6.0 32 9.0 33 10.0 34 13.0 35 19.5 36 28.0 37 35.5 38 50.0 39 60.0 40 68.0 41 91.5 42 112.0 43 124.5 44 127.0 45 143.5 46 156.5 47 152.5 48 157.5 49 138.0 50 120.0 51 122.5 52 113.0 53 104.0 54 100.0 55 107.0 56 110.0 57 99.5 58 106.0 59 105.0 60 96.0 61 109.5 62 111.0 63 107.5 64 103.0 65 92.5 66 89.0 67 89.0 68 94.0 69 80.0 70 71.5 71 73.5 72 61.0 73 51.0 74 42.0 75 31.5 76 18.5 77 9.5 78 11.0 79 12.5 80 12.0 81 8.5 82 5.5 83 4.5 84 1.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 1.0 95 1.0 96 1.0 97 1.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.67690677966102 89.375 2 4.819915254237288 9.1 3 0.423728813559322 1.2 4 0.05296610169491525 0.2 5 0.026483050847457626 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.2875 0.0 0.0 0.0 0.0 116-117 0.32499999999999996 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.6000000000000001 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.875 0.0 0.0 0.0 0.0 128-129 0.9375 0.0 0.0 0.0 0.0 130-131 1.0125 0.0 0.0 0.0 0.0 132-133 1.1 0.0 0.0 0.0 0.0 134-135 1.2374999999999998 0.0 0.0 0.0 0.0 136-137 1.3125 0.0 0.0 0.0 0.0 138-139 1.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1415142 spots for SRR7804162.sra Written 1415142 spots for SRR7804162.sra Read 1415142 spots for SRR7804162.sra Written 1415142 spots for SRR7804162.sra Read 1415142 spots for SRR7804162.sra Written 1415142 spots for SRR7804162.sra Read 1415142 spots for SRR7804162.sra Written 1415142 spots for SRR7804162.sra Read 1415142 spots for SRR7804162.sra Written 1415142 spots for SRR7804162.sra Read 1415142 spots for SRR7804162.sra Written 1415142 spots for SRR7804162.sra Read 1415142 spots for SRR7804162.sra Written 1415142 spots for SRR7804162.sra Read 1415142 spots for SRR7804162.sra Written 1415142 spots for SRR7804162.sra Read 1415142 spots for SRR7804162.sra Written 1415142 spots for SRR7804162.sra Read 1415142 spots for SRR7804162.sra Written 1415142 spots for SRR7804162.sra Read 1415142 spots for SRR7804162.sra Written 1415142 spots for SRR7804162.sra Read 1415142 spots for SRR7804162.sra Written 1415142 spots for SRR7804162.sra Read 1415142 spots for SRR7804162.sra Written 1415142 spots for SRR7804162.sra Read 1415142 spots for SRR7804162.sra Written 1415142 spots for SRR7804162.sra Read 1415142 spots for SRR7804162.sra Written 1415142 spots for SRR7804162.sra Read 1415151 spots for SRR7804162.sra Written 1415151 spots for SRR7804162.sra Read 1415142 spots for SRR7804162.sra Written 1415142 spots for SRR7804162.sra Read 1415142 spots for SRR7804162.sra Written 1415142 spots for SRR7804162.sra Read 1415142 spots for SRR7804162.sra Written 1415142 spots for SRR7804162.sra Read 1415142 spots for SRR7804162.sra Written 1415142 spots for SRR7804162.sra SRR ids: ['SRR7804162.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3r2ugxjn SRR7804162.sra spots: 28302849 blocks: [[1, 1415142], [1415143, 2830284], [2830285, 4245426], [4245427, 5660568], [5660569, 7075710], [7075711, 8490852], [8490853, 9905994], [9905995, 11321136], [11321137, 12736278], [12736279, 14151420], [14151421, 15566562], [15566563, 16981704], [16981705, 18396846], [18396847, 19811988], [19811989, 21227130], [21227131, 22642272], [22642273, 24057414], [24057415, 25472556], [25472557, 26887698], [26887699, 28302849]] SRR7804162 file size 9569206 SRR7804162 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804162 SRR7804162_1.fastq SRR7804162_2.fastq Input file: SRR7804162_1.fastq Paired file: SRR7804162_2.fastq trimmed: SRR7804162-trimmed-pair1.fastq, SRR7804162-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:15:34 2024 >> started Tue Dec 10 03:16:07 2024 >> done (32.679s) 28302849 read pairs processed; of these: 71 ( 0.00%) short read pairs filtered out after trimming by size control 558 ( 0.00%) empty read pairs filtered out after trimming by size control 28302220 (100.00%) read pairs available; of these: 645564 ( 2.28%) trimmed read pairs available after processing 27656656 (97.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 16 0.00% 20 7 0.00% 21 15 0.00% 22 28 0.00% 23 30 0.00% 24 22 0.00% 25 31 0.00% 26 20 0.00% 27 24 0.00% 28 30 0.00% 29 25 0.00% 30 34 0.00% 31 46 0.00% 32 44 0.00% 33 38 0.00% 34 38 0.00% 35 43 0.00% 36 33 0.00% 37 48 0.00% 38 51 0.00% 39 40 0.00% 40 42 0.00% 41 45 0.00% 42 46 0.00% 43 60 0.00% 44 52 0.00% 45 54 0.00% 46 59 0.00% 47 49 0.00% 48 65 0.00% 49 52 0.00% 50 60 0.00% 51 67 0.00% 52 60 0.00% 53 54 0.00% 54 66 0.00% 55 61 0.00% 56 75 0.00% 57 65 0.00% 58 75 0.00% 59 84 0.00% 60 100 0.00% 61 95 0.00% 62 120 0.00% 63 113 0.00% 64 101 0.00% 65 104 0.00% 66 88 0.00% 67 100 0.00% 68 105 0.00% 69 109 0.00% 70 144 0.00% 71 159 0.00% 72 185 0.00% 73 177 0.00% 74 178 0.00% 75 211 0.00% 76 236 0.00% 77 272 0.00% 78 281 0.00% 79 278 0.00% 80 283 0.00% 81 344 0.00% 82 408 0.00% 83 440 0.00% 84 509 0.00% 85 571 0.00% 86 590 0.00% 87 626 0.00% 88 682 0.00% 89 805 0.00% 90 815 0.00% 91 1019 0.00% 92 1106 0.00% 93 1294 0.00% 94 1475 0.01% 95 1429 0.01% 96 1761 0.01% 97 1842 0.01% 98 1908 0.01% 99 2068 0.01% 100 2214 0.01% 101 2496 0.01% 102 2736 0.01% 103 2973 0.01% 104 3201 0.01% 105 3458 0.01% 106 3609 0.01% 107 3937 0.01% 108 4181 0.01% 109 4406 0.02% 110 4628 0.02% 111 4907 0.02% 112 5479 0.02% 113 5728 0.02% 114 6218 0.02% 115 6672 0.02% 116 6886 0.02% 117 7144 0.03% 118 7393 0.03% 119 7775 0.03% 120 8115 0.03% 121 8675 0.03% 122 9044 0.03% 123 9440 0.03% 124 10387 0.04% 125 10860 0.04% 126 11236 0.04% 127 11839 0.04% 128 12205 0.04% 129 12726 0.04% 130 12917 0.05% 131 13596 0.05% 132 14037 0.05% 133 14976 0.05% 134 16117 0.06% 135 16452 0.06% 136 17068 0.06% 137 17898 0.06% 138 18564 0.07% 139 19172 0.07% 140 19192 0.07% 141 19737 0.07% 142 20615 0.07% 143 21567 0.08% 144 22934 0.08% 145 23984 0.08% 146 24842 0.09% 147 25568 0.09% 148 26543 0.09% 149 26458 0.09% 150 27766 0.10% 151 27656656 97.72% 28302220 reads passed initial QC criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=3.30 fanout-score-rank=9 prefix-density=0.92 prefix-fanout=3.1 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.30 sequence-density-rank=25 fanout-score=6.48 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=4.0 sequence=GCGCCGAGCATGGCCCA criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=3.79 fanout-score-rank=9 prefix-density=0.97 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=189.22 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=10.3 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804162 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:16:58 Started mapping on | Dec 10 03:16:58 Finished on | Dec 10 03:20:56 Mapping speed, Million of reads per hour | 428.10 Number of input reads | 28302220 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 26807990 Uniquely mapped reads % | 94.72% Average mapped length | 300.13 Number of splices: Total | 28176975 Number of splices: Annotated (sjdb) | 26651358 Number of splices: GT/AG | 27795459 Number of splices: GC/AG | 335938 Number of splices: AT/AC | 12201 Number of splices: Non-canonical | 33377 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.59 Insertion rate per base | 0.01% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 295337 % of reads mapped to multiple loci | 1.04% Number of reads mapped to too many loci | 22008 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.58% % of reads unmapped: other | 0.58% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1198893 1198893 1198893 N_multimapping 295337 295337 295337 N_noFeature 624684 26059646 804903 N_ambiguous 702413 3897 135249 UnstrandedReadsAssigned:25480893 PositiveStrandReadsAssigned:744447 NegativeStrandReadsAssigned:25867838 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804162 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804162-trimmed-pair1.fastq SRR7804162-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,302,220 reads, 26,086,737 reads pseudoaligned [quant] estimated average fragment length: 333.226 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52973 SRR7804162.ke.tsv 35125 SRR7804162.se.tsv 88098 total ==> SRR7804162.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 604.686 0 0 PNS24247 1044 711.774 50.5279 3.31923 PNS24249 1928 1595.77 168.889 4.94856 PNS24246 1044 711.774 50.5279 3.31923 PNS24248 1044 711.774 50.5279 3.31923 PNS24244 1471 1138.77 70.5271 2.89579 PNS24243 293 70.1374 0 0 KQK14069 1603 1270.77 498.629 18.3467 KQK14071 474 187.44 13.5743 3.38613 ==> SRR7804162.se.tsv <== BRADI_1g14170v3 548 BRADI_1g53295v3 143 BRADI_1g59795v3 709 BRADI_1g07683v3 0 BRADI_1g00485v3 38 BRADI_1g20270v3 3255 BRADI_1g74790v3 254 BRADI_1g09890v3 10 BRADI_1g77505v3 361 BRADI_1g48960v3 0 SRR7804162 completed mapping pipeline successfully