Starting /dee2/code/volunteer_pipeline.sh SRR7804163 current disk space = 1525365493760 free memory = 1601828064 SRR7804163 SRAfilesize a77731652d2eb18faf1f9d3d7ab9f5f4 SRR7804163.sra SRR7804163.sra file validated SRR7804163 is paired end SRR7804163 is conventional basespace SRR7804163 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804163_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.085 37.0 37.0 37.0 37.0 37.0 2 36.109 37.0 37.0 37.0 37.0 37.0 3 36.375 37.0 37.0 37.0 37.0 37.0 4 36.422 37.0 37.0 37.0 37.0 37.0 5 36.46 37.0 37.0 37.0 37.0 37.0 6 36.486 37.0 37.0 37.0 37.0 37.0 7 36.296 37.0 37.0 37.0 37.0 37.0 8 36.446 37.0 37.0 37.0 37.0 37.0 9 36.3685 37.0 37.0 37.0 37.0 37.0 10-14 36.51089999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.4379 37.0 37.0 37.0 37.0 37.0 20-24 36.430600000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.4094 37.0 37.0 37.0 37.0 37.0 30-34 36.3564 37.0 37.0 37.0 37.0 37.0 35-39 36.326 37.0 37.0 37.0 37.0 37.0 40-44 36.3595 37.0 37.0 37.0 37.0 37.0 45-49 36.2471 37.0 37.0 37.0 37.0 37.0 50-54 36.194100000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.1792 37.0 37.0 37.0 37.0 37.0 60-64 36.21 37.0 37.0 37.0 37.0 37.0 65-69 36.1652 37.0 37.0 37.0 37.0 37.0 70-74 36.0789 37.0 37.0 37.0 37.0 37.0 75-79 36.056200000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.0663 37.0 37.0 37.0 37.0 37.0 85-89 35.969 37.0 37.0 37.0 37.0 37.0 90-94 35.8418 37.0 37.0 37.0 37.0 37.0 95-99 35.862100000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.7861 37.0 37.0 37.0 37.0 37.0 105-109 35.7492 37.0 37.0 37.0 37.0 37.0 110-114 35.7586 37.0 37.0 37.0 37.0 37.0 115-119 35.723 37.0 37.0 37.0 37.0 37.0 120-124 35.5224 37.0 37.0 37.0 37.0 37.0 125-129 35.597699999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.508500000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.361999999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.360400000000006 37.0 37.0 37.0 34.6 37.0 145-149 35.2179 37.0 37.0 37.0 32.2 37.0 150-151 34.438 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 3.0 25 3.0 26 9.0 27 13.0 28 12.0 29 28.0 30 41.0 31 39.0 32 87.0 33 112.0 34 216.0 35 466.0 36 2725.0 37 244.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.60280842527583 12.637913741223672 10.255767301905717 34.503510531594785 2 25.775 16.950000000000003 33.050000000000004 24.224999999999998 3 23.849999999999998 25.2 23.75 27.200000000000003 4 28.249999999999996 30.325000000000003 19.45 21.975 5 26.724999999999998 30.275000000000002 21.275 21.725 6 20.5 34.475 21.375 23.65 7 17.625 19.85 40.400000000000006 22.125 8 21.375 19.5 26.325 32.800000000000004 9 22.2 18.4 30.0 29.4 10-14 24.205 25.27 24.15 26.375 15-19 24.654999999999998 24.73 24.305 26.31 20-24 24.365000000000002 23.905 24.834999999999997 26.895000000000003 25-29 24.665 24.154999999999998 24.015 27.165 30-34 24.41 24.43 24.555 26.605 35-39 24.8 23.805 24.535 26.86 40-44 25.195 24.145 24.455 26.205000000000002 45-49 25.4 24.29 23.655 26.655 50-54 24.665 24.240000000000002 24.41 26.685 55-59 24.465 24.03 24.22 27.284999999999997 60-64 25.924999999999997 23.549999999999997 23.805 26.72 65-69 25.395 23.765 23.855 26.985 70-74 25.11 23.61 23.97 27.310000000000002 75-79 25.52 23.82 23.97 26.69 80-84 24.42 23.494999999999997 23.715 28.37 85-89 25.615 23.7 23.87 26.815 90-94 25.82 23.865 23.645 26.669999999999998 95-99 25.775 23.43 23.849999999999998 26.945000000000004 100-104 26.005 23.285 23.69 27.02 105-109 25.66 23.53 23.48 27.33 110-114 25.755 24.11 23.115 27.02 115-119 26.02 23.07 23.880000000000003 27.029999999999998 120-124 26.025 23.849999999999998 23.01 27.115000000000002 125-129 25.435000000000002 23.125 23.435 28.005000000000003 130-134 26.695 23.105 23.294999999999998 26.905 135-139 26.045 23.044999999999998 24.275 26.634999999999998 140-144 26.745 23.03 23.025000000000002 27.200000000000003 145-149 26.095000000000002 23.175 23.635 27.095000000000002 150-151 26.724999999999998 22.5125 22.7375 28.025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 2.5 27 2.5 28 3.5 29 8.5 30 10.0 31 8.5 32 12.5 33 17.5 34 23.5 35 30.5 36 37.5 37 46.0 38 66.5 39 82.0 40 98.0 41 112.0 42 122.0 43 150.5 44 167.5 45 158.0 46 159.0 47 166.5 48 154.0 49 141.5 50 140.5 51 133.0 52 123.0 53 116.5 54 108.0 55 106.0 56 111.0 57 106.5 58 103.5 59 99.0 60 95.5 61 92.5 62 77.0 63 87.5 64 91.5 65 85.5 66 88.0 67 78.0 68 68.0 69 59.5 70 51.5 71 40.0 72 28.5 73 22.5 74 20.5 75 22.5 76 18.0 77 13.0 78 15.0 79 9.0 80 1.5 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.65 #Duplication Level Percentage of deduplicated Percentage of total 1 94.66455361859482 89.60000000000001 2 5.071315372424722 9.6 3 0.21130480718436345 0.6 4 0.05282620179609086 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.037500000000000006 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.2875 0.0 0.0 0.0 0.0 118-119 0.3125 0.0 0.0 0.0 0.0 120-121 0.3625 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.5125 0.0 0.0 0.0 0.0 126-127 0.575 0.0 0.0 0.0 0.0 128-129 0.6375 0.0 0.0 0.0 0.0 130-131 0.75 0.0 0.0 0.0 0.0 132-133 0.825 0.0 0.0 0.0 0.0 134-135 0.95 0.0 0.0 0.0 0.0 136-137 1.0375 0.0 0.0 0.0 0.0 138-139 1.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTCAAG 15 1.1411342E-4 145.0 9 >>END_MODULE SRR7804163 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804163_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4515 37.0 37.0 37.0 37.0 37.0 2 36.2335 37.0 37.0 37.0 37.0 37.0 3 36.294 37.0 37.0 37.0 37.0 37.0 4 36.3115 37.0 37.0 37.0 37.0 37.0 5 36.3895 37.0 37.0 37.0 37.0 37.0 6 36.252 37.0 37.0 37.0 37.0 37.0 7 36.206 37.0 37.0 37.0 37.0 37.0 8 36.436 37.0 37.0 37.0 37.0 37.0 9 36.335 37.0 37.0 37.0 37.0 37.0 10-14 36.30030000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.246300000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.2218 37.0 37.0 37.0 37.0 37.0 25-29 36.1145 37.0 37.0 37.0 37.0 37.0 30-34 36.1412 37.0 37.0 37.0 37.0 37.0 35-39 36.0697 37.0 37.0 37.0 37.0 37.0 40-44 36.0315 37.0 37.0 37.0 37.0 37.0 45-49 35.985200000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.9938 37.0 37.0 37.0 37.0 37.0 55-59 35.9346 37.0 37.0 37.0 37.0 37.0 60-64 35.825 37.0 37.0 37.0 37.0 37.0 65-69 35.772800000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.7333 37.0 37.0 37.0 37.0 37.0 75-79 35.7432 37.0 37.0 37.0 37.0 37.0 80-84 35.685199999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.5269 37.0 37.0 37.0 37.0 37.0 90-94 35.5059 37.0 37.0 37.0 37.0 37.0 95-99 35.35600000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.3817 37.0 37.0 37.0 37.0 37.0 105-109 35.306200000000004 37.0 37.0 37.0 34.6 37.0 110-114 35.135600000000004 37.0 37.0 37.0 25.0 37.0 115-119 35.067600000000006 37.0 37.0 37.0 25.0 37.0 120-124 35.073 37.0 37.0 37.0 25.0 37.0 125-129 34.8559 37.0 37.0 37.0 25.0 37.0 130-134 34.874199999999995 37.0 37.0 37.0 25.0 37.0 135-139 34.714299999999994 37.0 37.0 37.0 25.0 37.0 140-144 34.5234 37.0 37.0 37.0 25.0 37.0 145-149 34.437200000000004 37.0 37.0 37.0 25.0 37.0 150-151 33.67675 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 3.0 15 6.0 16 1.0 17 1.0 18 0.0 19 1.0 20 6.0 21 6.0 22 5.0 23 7.0 24 11.0 25 8.0 26 11.0 27 16.0 28 14.0 29 23.0 30 35.0 31 58.0 32 74.0 33 139.0 34 273.0 35 719.0 36 2471.0 37 108.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.275 13.350000000000001 10.75 34.625 2 28.449999999999996 18.75 28.549999999999997 24.25 3 26.174999999999997 21.85 26.85 25.124999999999996 4 27.375 30.349999999999998 16.475 25.8 5 27.725 31.525 17.275 23.474999999999998 6 22.625 33.525 17.575 26.275 7 21.75 14.725 36.525 27.0 8 23.525 18.475 21.4 36.6 9 24.15 19.925 23.95 31.974999999999998 10-14 26.905 23.625 21.490000000000002 27.98 15-19 26.91 23.330000000000002 22.11 27.650000000000002 20-24 26.105 23.57 22.065 28.26 25-29 26.979999999999997 23.765 20.915 28.34 30-34 27.565 23.44 21.675 27.32 35-39 26.205000000000002 23.695 21.91 28.189999999999998 40-44 27.495000000000005 23.395 21.795 27.315 45-49 27.32 23.04 21.695 27.944999999999997 50-54 26.919999999999998 23.115 22.0 27.965 55-59 27.189999999999998 22.535 22.32 27.955000000000002 60-64 26.784999999999997 22.845 22.275 28.095 65-69 27.58 23.025000000000002 21.82 27.575 70-74 26.950000000000003 22.31 22.21 28.53 75-79 27.015 22.770000000000003 22.035 28.18 80-84 27.500000000000004 22.775000000000002 21.5 28.225 85-89 27.089999999999996 22.8 22.09 28.02 90-94 27.325 23.27 21.95 27.455000000000002 95-99 27.43 22.905 22.18 27.485 100-104 27.985 23.115 21.605 27.295 105-109 27.150000000000002 23.494999999999997 21.95 27.405 110-114 27.82 23.549999999999997 21.65 26.979999999999997 115-119 27.22 23.35 21.634999999999998 27.794999999999998 120-124 27.700000000000003 22.6 22.34 27.36 125-129 27.805000000000003 23.075000000000003 22.134999999999998 26.985 130-134 27.235 23.52 22.0 27.245 135-139 27.765 23.599999999999998 21.709999999999997 26.924999999999997 140-144 27.66 23.035 22.235 27.07 145-149 27.48 23.76 22.18 26.58 150-151 27.55 23.5375 22.6 26.3125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 1.0 9 1.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 1.5 27 1.0 28 1.5 29 4.5 30 5.5 31 6.5 32 9.5 33 12.0 34 14.0 35 17.0 36 19.0 37 31.5 38 44.5 39 55.0 40 74.5 41 86.5 42 101.5 43 121.0 44 128.0 45 126.0 46 118.0 47 120.5 48 127.0 49 119.0 50 130.0 51 118.0 52 106.0 53 118.0 54 99.5 55 95.0 56 107.5 57 104.0 58 102.0 59 114.0 60 102.5 61 94.5 62 120.5 63 135.5 64 115.5 65 96.5 66 102.5 67 105.0 68 104.5 69 97.0 70 91.5 71 86.0 72 67.0 73 57.5 74 54.5 75 43.5 76 24.5 77 13.5 78 9.0 79 7.0 80 7.5 81 4.5 82 2.0 83 1.5 84 2.0 85 1.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 1.0 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 94.85274608649509 89.375 2 4.563544706818785 8.6 3 0.371451313345715 1.05 4 0.15919342000530645 0.6 5 0.0 0.0 6 0.0 0.0 7 0.02653223666755107 0.17500000000000002 8 0.02653223666755107 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 8 0.2 No Hit GATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.025 14-15 0.0 0.0 0.0 0.0 0.025 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0 0.0 0.0 0.0 0.025 86-87 0.0 0.0 0.0 0.0 0.025 88-89 0.0 0.0 0.0 0.0 0.025 90-91 0.0 0.0 0.0 0.0 0.025 92-93 0.0 0.0 0.0 0.0 0.025 94-95 0.0 0.0 0.0 0.0 0.025 96-97 0.0 0.0 0.0 0.0 0.025 98-99 0.025 0.0 0.0 0.0 0.025 100-101 0.037500000000000006 0.0 0.0 0.0 0.025 102-103 0.0625 0.0 0.0 0.0 0.025 104-105 0.075 0.0 0.0 0.0 0.025 106-107 0.125 0.0 0.0 0.0 0.025 108-109 0.15 0.0 0.0 0.0 0.025 110-111 0.1875 0.0 0.0 0.0 0.025 112-113 0.2 0.0 0.0 0.0 0.025 114-115 0.25 0.0 0.0 0.0 0.025 116-117 0.2875 0.0 0.0 0.0 0.025 118-119 0.3125 0.0 0.0 0.0 0.025 120-121 0.3625 0.0 0.0 0.0 0.025 122-123 0.4625 0.0 0.0 0.0 0.025 124-125 0.5375 0.0 0.0 0.0 0.025 126-127 0.6 0.0 0.0 0.0 0.025 128-129 0.65 0.0 0.0 0.0 0.025 130-131 0.75 0.0 0.0 0.0 0.025 132-133 0.85 0.0 0.0 0.0 0.025 134-135 0.975 0.0 0.0 0.0 0.025 136-137 1.05 0.0 0.0 0.0 0.025 138-139 1.2125 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1692229 spots for SRR7804163.sra Written 1692229 spots for SRR7804163.sra Read 1692229 spots for SRR7804163.sra Written 1692229 spots for SRR7804163.sra Read 1692229 spots for SRR7804163.sra Written 1692229 spots for SRR7804163.sra Read 1692229 spots for SRR7804163.sra Written 1692229 spots for SRR7804163.sra Read 1692229 spots for SRR7804163.sra Written 1692229 spots for SRR7804163.sra Read 1692229 spots for SRR7804163.sra Written 1692229 spots for SRR7804163.sra Read 1692229 spots for SRR7804163.sra Written 1692229 spots for SRR7804163.sra Read 1692229 spots for SRR7804163.sra Written 1692229 spots for SRR7804163.sra Read 1692229 spots for SRR7804163.sra Written 1692229 spots for SRR7804163.sra Read 1692247 spots for SRR7804163.sra Written 1692247 spots for SRR7804163.sra Read 1692229 spots for SRR7804163.sra Written 1692229 spots for SRR7804163.sra Read 1692229 spots for SRR7804163.sra Written 1692229 spots for SRR7804163.sra Read 1692229 spots for SRR7804163.sra Written 1692229 spots for SRR7804163.sra Read 1692229 spots for SRR7804163.sra Written 1692229 spots for SRR7804163.sra Read 1692229 spots for SRR7804163.sra Written 1692229 spots for SRR7804163.sra Read 1692229 spots for SRR7804163.sra Written 1692229 spots for SRR7804163.sra Read 1692229 spots for SRR7804163.sra Written 1692229 spots for SRR7804163.sra Read 1692229 spots for SRR7804163.sra Written 1692229 spots for SRR7804163.sra Read 1692229 spots for SRR7804163.sra Written 1692229 spots for SRR7804163.sra Read 1692229 spots for SRR7804163.sra Written 1692229 spots for SRR7804163.sra SRR ids: ['SRR7804163.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lr7m_vjv SRR7804163.sra spots: 33844598 blocks: [[1, 1692229], [1692230, 3384458], [3384459, 5076687], [5076688, 6768916], [6768917, 8461145], [8461146, 10153374], [10153375, 11845603], [11845604, 13537832], [13537833, 15230061], [15230062, 16922290], [16922291, 18614519], [18614520, 20306748], [20306749, 21998977], [21998978, 23691206], [23691207, 25383435], [25383436, 27075664], [27075665, 28767893], [28767894, 30460122], [30460123, 32152351], [32152352, 33844598]] SRR7804163 file size 11447123 SRR7804163 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804163 SRR7804163_1.fastq SRR7804163_2.fastq Input file: SRR7804163_1.fastq Paired file: SRR7804163_2.fastq trimmed: SRR7804163-trimmed-pair1.fastq, SRR7804163-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:05:00 2024 >> started Tue Dec 10 03:05:41 2024 >> done (40.754s) 33844598 read pairs processed; of these: 81 ( 0.00%) short read pairs filtered out after trimming by size control 1010 ( 0.00%) empty read pairs filtered out after trimming by size control 33843507 (100.00%) read pairs available; of these: 791866 ( 2.34%) trimmed read pairs available after processing 33051641 (97.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 23 0.00% 20 26 0.00% 21 21 0.00% 22 27 0.00% 23 34 0.00% 24 24 0.00% 25 36 0.00% 26 35 0.00% 27 32 0.00% 28 38 0.00% 29 47 0.00% 30 41 0.00% 31 64 0.00% 32 56 0.00% 33 36 0.00% 34 42 0.00% 35 61 0.00% 36 50 0.00% 37 49 0.00% 38 69 0.00% 39 60 0.00% 40 39 0.00% 41 77 0.00% 42 57 0.00% 43 66 0.00% 44 65 0.00% 45 86 0.00% 46 73 0.00% 47 73 0.00% 48 56 0.00% 49 73 0.00% 50 80 0.00% 51 84 0.00% 52 82 0.00% 53 85 0.00% 54 86 0.00% 55 85 0.00% 56 105 0.00% 57 103 0.00% 58 109 0.00% 59 106 0.00% 60 101 0.00% 61 99 0.00% 62 102 0.00% 63 136 0.00% 64 134 0.00% 65 115 0.00% 66 158 0.00% 67 151 0.00% 68 141 0.00% 69 156 0.00% 70 155 0.00% 71 185 0.00% 72 195 0.00% 73 203 0.00% 74 215 0.00% 75 265 0.00% 76 277 0.00% 77 268 0.00% 78 316 0.00% 79 337 0.00% 80 383 0.00% 81 426 0.00% 82 477 0.00% 83 570 0.00% 84 603 0.00% 85 701 0.00% 86 727 0.00% 87 782 0.00% 88 922 0.00% 89 1024 0.00% 90 1074 0.00% 91 1166 0.00% 92 1454 0.00% 93 1465 0.00% 94 1718 0.01% 95 1893 0.01% 96 2000 0.01% 97 2146 0.01% 98 2355 0.01% 99 2550 0.01% 100 2711 0.01% 101 3101 0.01% 102 3382 0.01% 103 3693 0.01% 104 3880 0.01% 105 4142 0.01% 106 4514 0.01% 107 4853 0.01% 108 4939 0.01% 109 5338 0.02% 110 5869 0.02% 111 5952 0.02% 112 6638 0.02% 113 7146 0.02% 114 7322 0.02% 115 7955 0.02% 116 8358 0.02% 117 8820 0.03% 118 8929 0.03% 119 9438 0.03% 120 9982 0.03% 121 10642 0.03% 122 11144 0.03% 123 11839 0.03% 124 12663 0.04% 125 13308 0.04% 126 14038 0.04% 127 14309 0.04% 128 14749 0.04% 129 15443 0.05% 130 15897 0.05% 131 16510 0.05% 132 17622 0.05% 133 18310 0.05% 134 19397 0.06% 135 20463 0.06% 136 21030 0.06% 137 21617 0.06% 138 22736 0.07% 139 23143 0.07% 140 24052 0.07% 141 24343 0.07% 142 25761 0.08% 143 26624 0.08% 144 27660 0.08% 145 29075 0.09% 146 30172 0.09% 147 31395 0.09% 148 32820 0.10% 149 33229 0.10% 150 34295 0.10% 151 33051641 97.66% 33843507 reads passed initial QC criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=28 prefix-density=0.95 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=30 fanout-score=11.05 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=3.9 sequence=ACAACACCAACTCCTCATCTCTGACTTTCACATGCAACATCTATCAGTCCTGACTCCTGACTCAATCTCGACACATGCAGCAGCATCCATCATCAACAATGACGTCGTCGGCCAAGCGCCTCAGCATAGAGCAGGCGCTGGAGCTTGCTAACTAAGCTCACTTGCCGGGGACGAAGTTGGTGGC criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=3.82 fanout-score-rank=11 prefix-density=1.04 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=119.22 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=8.0 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804163 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:06:29 Started mapping on | Dec 10 03:06:30 Finished on | Dec 10 03:12:21 Mapping speed, Million of reads per hour | 347.11 Number of input reads | 33843507 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 31378046 Uniquely mapped reads % | 92.72% Average mapped length | 300.09 Number of splices: Total | 32517369 Number of splices: Annotated (sjdb) | 30812280 Number of splices: GT/AG | 32077857 Number of splices: GC/AG | 386182 Number of splices: AT/AC | 13079 Number of splices: Non-canonical | 40251 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.58 Insertion rate per base | 0.01% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 338277 % of reads mapped to multiple loci | 1.00% Number of reads mapped to too many loci | 29199 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.56% % of reads unmapped: other | 0.64% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2127184 2127184 2127184 N_multimapping 338277 338277 338277 N_noFeature 711106 30489685 911662 N_ambiguous 853740 4601 166790 UnstrandedReadsAssigned:29813200 PositiveStrandReadsAssigned:883760 NegativeStrandReadsAssigned:30299594 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804163 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804163-trimmed-pair1.fastq SRR7804163-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,843,507 reads, 30,655,684 reads pseudoaligned [quant] estimated average fragment length: 339.203 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52973 SRR7804163.ke.tsv 35125 SRR7804163.se.tsv 88098 total ==> SRR7804163.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 598.852 0 0 PNS24247 1044 705.797 51.904 2.92259 PNS24249 1928 1589.8 162.73 4.06794 PNS24246 1044 705.797 51.904 2.92259 PNS24248 1044 705.797 51.904 2.92259 PNS24244 1471 1132.8 68.5576 2.4052 PNS24243 293 72.1314 0 0 KQK14069 1603 1264.8 793.861 24.9443 KQK14071 474 187.255 9.38019 1.99079 ==> SRR7804163.se.tsv <== BRADI_1g14170v3 854 BRADI_1g53295v3 143 BRADI_1g59795v3 700 BRADI_1g07683v3 0 BRADI_1g00485v3 51 BRADI_1g20270v3 3952 BRADI_1g74790v3 225 BRADI_1g09890v3 18 BRADI_1g77505v3 377 BRADI_1g48960v3 1 SRR7804163 completed mapping pipeline successfully