Starting /dee2/code/volunteer_pipeline.sh SRR7804164 current disk space = 1525414760448 free memory = 1562903092 SRR7804164 SRAfilesize 963665a9689c7890a13d8182c3b66ac5 SRR7804164.sra SRR7804164.sra file validated SRR7804164 is paired end SRR7804164 is conventional basespace SRR7804164 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804164_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.14525 37.0 37.0 37.0 37.0 37.0 2 36.158 37.0 37.0 37.0 37.0 37.0 3 36.278 37.0 37.0 37.0 37.0 37.0 4 36.5085 37.0 37.0 37.0 37.0 37.0 5 36.499 37.0 37.0 37.0 37.0 37.0 6 36.514 37.0 37.0 37.0 37.0 37.0 7 36.333 37.0 37.0 37.0 37.0 37.0 8 36.488 37.0 37.0 37.0 37.0 37.0 9 36.4365 37.0 37.0 37.0 37.0 37.0 10-14 36.4735 37.0 37.0 37.0 37.0 37.0 15-19 36.4634 37.0 37.0 37.0 37.0 37.0 20-24 36.44709999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.33540000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.336099999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.3592 37.0 37.0 37.0 37.0 37.0 40-44 36.257000000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.182 37.0 37.0 37.0 37.0 37.0 50-54 36.229099999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.1361 37.0 37.0 37.0 37.0 37.0 60-64 36.1171 37.0 37.0 37.0 37.0 37.0 65-69 36.06519999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.977900000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.992399999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.04440000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.955799999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.964999999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.772299999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.7694 37.0 37.0 37.0 37.0 37.0 105-109 35.7125 37.0 37.0 37.0 37.0 37.0 110-114 35.7752 37.0 37.0 37.0 37.0 37.0 115-119 35.63549999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.532199999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.5672 37.0 37.0 37.0 37.0 37.0 130-134 35.442899999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.3082 37.0 37.0 37.0 32.2 37.0 140-144 35.3357 37.0 37.0 37.0 34.6 37.0 145-149 35.0988 37.0 37.0 37.0 25.0 37.0 150-151 34.4825 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 0.0 23 1.0 24 2.0 25 7.0 26 12.0 27 14.0 28 21.0 29 29.0 30 37.0 31 51.0 32 76.0 33 119.0 34 184.0 35 456.0 36 2760.0 37 229.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.113004259584066 11.525933350037585 10.373340015033826 38.987722375344525 2 26.6 17.724999999999998 31.35 24.325 3 24.125 24.175 20.95 30.75 4 30.175 29.225 18.2 22.400000000000002 5 26.950000000000003 32.5 20.1 20.45 6 21.85 33.2 22.925 22.025 7 18.525 19.625 40.475 21.375 8 21.475 19.55 25.95 33.025 9 21.9 18.625 30.45 29.025000000000002 10-14 23.810000000000002 25.91 23.825 26.455000000000002 15-19 24.795 24.355 24.32 26.529999999999998 20-24 24.21 24.75 23.745 27.295 25-29 24.705 24.845 23.9 26.55 30-34 25.385 23.65 24.205 26.76 35-39 25.230000000000004 24.099999999999998 24.02 26.650000000000002 40-44 24.975 24.175 23.815 27.034999999999997 45-49 25.009999999999998 24.275 24.23 26.484999999999996 50-54 25.11 24.03 23.54 27.32 55-59 25.435000000000002 24.055 23.244999999999997 27.265 60-64 25.835 24.345 23.23 26.590000000000003 65-69 25.009999999999998 24.395 23.79 26.805 70-74 25.419999999999998 23.95 23.195 27.435 75-79 25.85 23.625 24.015 26.51 80-84 25.869999999999997 23.59 23.69 26.85 85-89 25.965 23.345 23.805 26.884999999999998 90-94 26.169999999999998 23.575 23.200000000000003 27.055 95-99 26.31 23.955000000000002 23.69 26.045 100-104 26.295 23.49 23.11 27.105 105-109 26.179999999999996 22.97 23.865 26.985 110-114 26.5 23.41 22.919999999999998 27.169999999999998 115-119 26.700000000000003 23.32 23.075000000000003 26.905 120-124 26.55 23.425 22.935 27.089999999999996 125-129 26.625 22.689999999999998 23.61 27.075 130-134 27.389999999999997 22.564999999999998 23.085 26.96 135-139 26.38 23.36 23.48 26.779999999999998 140-144 27.384999999999998 23.044999999999998 23.150000000000002 26.419999999999998 145-149 26.805 23.385 22.2 27.61 150-151 27.35 22.3875 23.474999999999998 26.787499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.5 28 3.5 29 3.5 30 6.0 31 9.5 32 11.5 33 16.0 34 19.5 35 30.5 36 45.5 37 54.0 38 67.0 39 76.5 40 97.5 41 125.5 42 142.5 43 151.0 44 151.0 45 157.0 46 163.5 47 160.5 48 157.5 49 148.5 50 137.5 51 128.0 52 114.5 53 100.0 54 86.0 55 89.5 56 89.5 57 91.5 58 100.0 59 106.0 60 116.0 61 113.0 62 96.0 63 90.0 64 93.0 65 79.5 66 70.5 67 75.5 68 76.5 69 68.5 70 63.0 71 53.0 72 42.5 73 33.0 74 23.0 75 22.0 76 17.0 77 9.5 78 5.5 79 4.0 80 2.5 81 2.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.975 #Duplication Level Percentage of deduplicated Percentage of total 1 93.33154073675719 86.775 2 5.915568701263781 11.0 3 0.6722237160527024 1.875 4 0.026888948642108095 0.1 5 0.05377789728421619 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAGGCCGCCCTCGCTGAAGATCTGGGAGCCGGCCTTGAACCAGACGG 5 0.125 No Hit CGAAGAAGCCGAACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.0875 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.16249999999999998 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.5125 0.0 0.0 0.0 0.0 126-127 0.5874999999999999 0.0 0.0 0.0 0.0 128-129 0.6625000000000001 0.0 0.0 0.0 0.0 130-131 0.8125 0.0 0.0 0.0 0.0 132-133 0.875 0.0 0.0 0.0 0.0 134-135 0.95 0.0 0.0 0.0 0.0 136-137 1.0750000000000002 0.0 0.0 0.0 0.0 138-139 1.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTCCAG 10 0.006830828 145.0 5 >>END_MODULE SRR7804164 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804164_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9345 37.0 37.0 37.0 37.0 37.0 2 35.493 37.0 37.0 37.0 37.0 37.0 3 35.824 37.0 37.0 37.0 37.0 37.0 4 35.851 37.0 37.0 37.0 37.0 37.0 5 36.0475 37.0 37.0 37.0 37.0 37.0 6 35.8135 37.0 37.0 37.0 37.0 37.0 7 35.721 37.0 37.0 37.0 37.0 37.0 8 35.913 37.0 37.0 37.0 37.0 37.0 9 35.825 37.0 37.0 37.0 37.0 37.0 10-14 35.860800000000005 37.0 37.0 37.0 37.0 37.0 15-19 35.8095 37.0 37.0 37.0 37.0 37.0 20-24 35.7646 37.0 37.0 37.0 37.0 37.0 25-29 35.714600000000004 37.0 37.0 37.0 37.0 37.0 30-34 35.720600000000005 37.0 37.0 37.0 37.0 37.0 35-39 35.54619999999999 37.0 37.0 37.0 37.0 37.0 40-44 35.541399999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.4317 37.0 37.0 37.0 37.0 37.0 50-54 35.488600000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.38250000000001 37.0 37.0 37.0 37.0 37.0 60-64 35.2759 37.0 37.0 37.0 32.2 37.0 65-69 35.25070000000001 37.0 37.0 37.0 32.2 37.0 70-74 35.219100000000005 37.0 37.0 37.0 32.2 37.0 75-79 35.1894 37.0 37.0 37.0 27.4 37.0 80-84 35.0312 37.0 37.0 37.0 25.0 37.0 85-89 35.008500000000005 37.0 37.0 37.0 25.0 37.0 90-94 34.9611 37.0 37.0 37.0 25.0 37.0 95-99 34.78679999999999 37.0 37.0 37.0 25.0 37.0 100-104 34.7445 37.0 37.0 37.0 25.0 37.0 105-109 34.638999999999996 37.0 37.0 37.0 25.0 37.0 110-114 34.5014 37.0 37.0 37.0 25.0 37.0 115-119 34.4019 37.0 37.0 37.0 25.0 37.0 120-124 34.248400000000004 37.0 37.0 37.0 25.0 37.0 125-129 34.2463 37.0 37.0 37.0 25.0 37.0 130-134 34.1556 37.0 37.0 37.0 25.0 37.0 135-139 33.9173 37.0 37.0 37.0 25.0 37.0 140-144 33.690200000000004 37.0 37.0 37.0 25.0 37.0 145-149 33.6748 37.0 37.0 37.0 25.0 37.0 150-151 32.974000000000004 37.0 31.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 6.0 16 1.0 17 3.0 18 3.0 19 2.0 20 2.0 21 9.0 22 10.0 23 10.0 24 11.0 25 11.0 26 18.0 27 22.0 28 35.0 29 36.0 30 65.0 31 88.0 32 131.0 33 246.0 34 480.0 35 1050.0 36 1722.0 37 36.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.449999999999996 13.05 12.35 39.15 2 29.875 18.224999999999998 28.325 23.575 3 24.75 22.2 25.85 27.200000000000003 4 28.025 28.849999999999998 15.525 27.6 5 28.725 32.025 17.125 22.125 6 22.125 34.2 17.849999999999998 25.825 7 21.65 13.450000000000001 37.025000000000006 27.875 8 22.45 18.65 21.575 37.325 9 24.5 19.5 24.8 31.2 10-14 26.784999999999997 23.415 21.26 28.54 15-19 26.450000000000003 22.93 22.63 27.99 20-24 26.91 22.98 21.685 28.425 25-29 26.85 23.400000000000002 21.385 28.365000000000002 30-34 27.105 22.884999999999998 21.555 28.455000000000002 35-39 27.084999999999997 23.52 21.47 27.925 40-44 27.12 23.365 21.6 27.915 45-49 27.145000000000003 22.835 21.529999999999998 28.49 50-54 27.889999999999997 22.74 21.535 27.834999999999997 55-59 27.85 22.634999999999998 21.240000000000002 28.275 60-64 27.105 23.125 21.845 27.925 65-69 27.065 22.935 21.965 28.035 70-74 27.16 22.03 21.709999999999997 29.099999999999998 75-79 26.924999999999997 22.465 22.17 28.439999999999998 80-84 27.939999999999998 22.855 21.58 27.625 85-89 28.475 22.63 20.974999999999998 27.92 90-94 27.229999999999997 22.95 21.675 28.144999999999996 95-99 27.775 22.07 22.355 27.800000000000004 100-104 27.93 22.259999999999998 21.905 27.905 105-109 27.615000000000002 22.470000000000002 21.85 28.065 110-114 28.165000000000003 22.465 21.82 27.55 115-119 28.455000000000002 22.505 21.46 27.58 120-124 27.415 22.314999999999998 21.63 28.64 125-129 27.755000000000003 23.64 21.675 26.93 130-134 28.42 22.395 21.740000000000002 27.445000000000004 135-139 28.07 23.34 21.755 26.834999999999997 140-144 27.875 23.595 21.43 27.1 145-149 28.22 23.48 21.625 26.674999999999997 150-151 29.299999999999997 23.962500000000002 21.099999999999998 25.637500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 1.0 27 2.5 28 4.5 29 4.0 30 4.0 31 4.0 32 5.0 33 9.0 34 14.5 35 17.5 36 19.0 37 35.5 38 50.5 39 62.0 40 86.0 41 95.0 42 99.0 43 104.0 44 107.5 45 114.5 46 118.5 47 114.5 48 123.0 49 125.0 50 112.0 51 110.5 52 99.0 53 89.5 54 94.0 55 94.0 56 99.5 57 103.0 58 108.0 59 119.5 60 117.5 61 114.5 62 134.0 63 139.0 64 122.5 65 105.5 66 93.5 67 103.5 68 116.5 69 113.0 70 98.5 71 80.0 72 70.0 73 62.0 74 47.0 75 38.5 76 24.5 77 17.0 78 15.0 79 8.5 80 4.5 81 3.0 82 2.0 83 2.5 84 1.5 85 0.5 86 0.0 87 0.0 88 0.0 89 1.0 90 1.0 91 0.0 92 1.5 93 1.5 94 0.5 95 1.0 96 0.5 97 0.5 98 2.0 99 1.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.025 #Duplication Level Percentage of deduplicated Percentage of total 1 93.0453681064928 85.625 2 5.840804129312687 10.75 3 0.7334963325183375 2.025 4 0.24449877750611246 0.8999999999999999 5 0.08149959250203749 0.375 6 0.027166530834012496 0.15 7 0.027166530834012496 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 7 0.17500000000000002 No Hit CTCATCTCTCACTGACCTTACCACTTGAATTGGGATCGAAATGGCCGCGT 6 0.15 No Hit CTTGAATTGGGATCGAAATGGCCGCGTCGGCGCTGCACCAGACCACCAGC 5 0.125 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.0875 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.16249999999999998 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.5375000000000001 0.0 0.0 0.0 0.0 126-127 0.5874999999999999 0.0 0.0 0.0 0.0 128-129 0.6625000000000001 0.0 0.0 0.0 0.0 130-131 0.8 0.0 0.0 0.0 0.0 132-133 0.875 0.0 0.0 0.0 0.0 134-135 0.975 0.0 0.0 0.0 0.0 136-137 1.125 0.0 0.0 0.0 0.0 138-139 1.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAATTC 10 0.006830828 145.0 3 AATTGGG 10 0.006830828 145.0 5 >>END_MODULE Read 1567035 spots for SRR7804164.sra Written 1567035 spots for SRR7804164.sra Read 1567035 spots for SRR7804164.sra Written 1567035 spots for SRR7804164.sra Read 1567035 spots for SRR7804164.sra Written 1567035 spots for SRR7804164.sra Read 1567035 spots for SRR7804164.sra Written 1567035 spots for SRR7804164.sra Read 1567035 spots for SRR7804164.sra Written 1567035 spots for SRR7804164.sra Read 1567035 spots for SRR7804164.sra Written 1567035 spots for SRR7804164.sra Read 1567035 spots for SRR7804164.sra Written 1567035 spots for SRR7804164.sra Read 1567035 spots for SRR7804164.sra Written 1567035 spots for SRR7804164.sra Read 1567035 spots for SRR7804164.sra Written 1567035 spots for SRR7804164.sra Read 1567035 spots for SRR7804164.sra Written 1567035 spots for SRR7804164.sra Read 1567035 spots for SRR7804164.sra Written 1567035 spots for SRR7804164.sra Read 1567035 spots for SRR7804164.sra Written 1567035 spots for SRR7804164.sra Read 1567035 spots for SRR7804164.sra Written 1567035 spots for SRR7804164.sra Read 1567035 spots for SRR7804164.sra Written 1567035 spots for SRR7804164.sra Read 1567035 spots for SRR7804164.sra Written 1567035 spots for SRR7804164.sra Read 1567035 spots for SRR7804164.sra Written 1567035 spots for SRR7804164.sra Read 1567035 spots for SRR7804164.sra Written 1567035 spots for SRR7804164.sra Read 1567035 spots for SRR7804164.sra Written 1567035 spots for SRR7804164.sra Read 1567035 spots for SRR7804164.sra Written 1567035 spots for SRR7804164.sra Read 1567035 spots for SRR7804164.sra Written 1567035 spots for SRR7804164.sra SRR ids: ['SRR7804164.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h21qdp43 SRR7804164.sra spots: 31340700 blocks: [[1, 1567035], [1567036, 3134070], [3134071, 4701105], [4701106, 6268140], [6268141, 7835175], [7835176, 9402210], [9402211, 10969245], [10969246, 12536280], [12536281, 14103315], [14103316, 15670350], [15670351, 17237385], [17237386, 18804420], [18804421, 20371455], [20371456, 21938490], [21938491, 23505525], [23505526, 25072560], [25072561, 26639595], [26639596, 28206630], [28206631, 29773665], [29773666, 31340700]] SRR7804164 file size 10598634 SRR7804164 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804164 SRR7804164_1.fastq SRR7804164_2.fastq Input file: SRR7804164_1.fastq Paired file: SRR7804164_2.fastq trimmed: SRR7804164-trimmed-pair1.fastq, SRR7804164-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:06:16 2024 >> started Tue Dec 10 03:08:26 2024 >> done (130.038s) 31340700 read pairs processed; of these: 104 ( 0.00%) short read pairs filtered out after trimming by size control 22985 ( 0.07%) empty read pairs filtered out after trimming by size control 31317611 (99.93%) read pairs available; of these: 714240 ( 2.28%) trimmed read pairs available after processing 30603371 (97.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 11 0.00% 20 20 0.00% 21 19 0.00% 22 22 0.00% 23 23 0.00% 24 18 0.00% 25 18 0.00% 26 27 0.00% 27 33 0.00% 28 35 0.00% 29 32 0.00% 30 36 0.00% 31 57 0.00% 32 56 0.00% 33 52 0.00% 34 37 0.00% 35 38 0.00% 36 37 0.00% 37 48 0.00% 38 54 0.00% 39 74 0.00% 40 52 0.00% 41 57 0.00% 42 48 0.00% 43 58 0.00% 44 49 0.00% 45 90 0.00% 46 49 0.00% 47 55 0.00% 48 68 0.00% 49 48 0.00% 50 79 0.00% 51 64 0.00% 52 87 0.00% 53 65 0.00% 54 71 0.00% 55 85 0.00% 56 94 0.00% 57 88 0.00% 58 104 0.00% 59 95 0.00% 60 116 0.00% 61 90 0.00% 62 119 0.00% 63 116 0.00% 64 110 0.00% 65 133 0.00% 66 104 0.00% 67 118 0.00% 68 145 0.00% 69 125 0.00% 70 146 0.00% 71 160 0.00% 72 179 0.00% 73 178 0.00% 74 162 0.00% 75 253 0.00% 76 246 0.00% 77 265 0.00% 78 289 0.00% 79 335 0.00% 80 368 0.00% 81 389 0.00% 82 421 0.00% 83 487 0.00% 84 552 0.00% 85 579 0.00% 86 644 0.00% 87 681 0.00% 88 850 0.00% 89 885 0.00% 90 914 0.00% 91 1060 0.00% 92 1213 0.00% 93 1361 0.00% 94 1510 0.00% 95 1559 0.00% 96 1697 0.01% 97 1956 0.01% 98 2253 0.01% 99 2369 0.01% 100 2475 0.01% 101 2775 0.01% 102 2971 0.01% 103 3185 0.01% 104 3500 0.01% 105 3748 0.01% 106 4143 0.01% 107 4295 0.01% 108 4558 0.01% 109 4871 0.02% 110 5193 0.02% 111 5417 0.02% 112 6060 0.02% 113 6345 0.02% 114 6806 0.02% 115 7399 0.02% 116 7641 0.02% 117 7930 0.03% 118 8320 0.03% 119 8814 0.03% 120 9200 0.03% 121 9771 0.03% 122 9959 0.03% 123 10748 0.03% 124 11743 0.04% 125 11944 0.04% 126 12634 0.04% 127 13076 0.04% 128 13406 0.04% 129 13922 0.04% 130 14342 0.05% 131 14841 0.05% 132 16040 0.05% 133 16343 0.05% 134 17623 0.06% 135 18715 0.06% 136 18979 0.06% 137 19707 0.06% 138 19994 0.06% 139 20922 0.07% 140 21678 0.07% 141 21994 0.07% 142 23015 0.07% 143 23790 0.08% 144 24894 0.08% 145 26103 0.08% 146 27305 0.09% 147 28256 0.09% 148 29511 0.09% 149 29526 0.09% 150 30505 0.10% 151 30603371 97.72% 31317611 reads passed initial QC criterion=sequence-density sequence-density=1.51 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=19 prefix-density=1.55 prefix-fanout=2.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=17.48 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=1.8 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=1.31 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=20 prefix-density=1.40 prefix-fanout=2.4 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCAGGCAGCCCGTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=67.00 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=6.5 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804164 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:09:31 Started mapping on | Dec 10 03:09:31 Finished on | Dec 10 03:14:07 Mapping speed, Million of reads per hour | 408.49 Number of input reads | 31317611 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 29862749 Uniquely mapped reads % | 95.35% Average mapped length | 299.99 Number of splices: Total | 31265725 Number of splices: Annotated (sjdb) | 29666078 Number of splices: GT/AG | 30851921 Number of splices: GC/AG | 371472 Number of splices: AT/AC | 7151 Number of splices: Non-canonical | 35181 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.01% Deletion average length | 2.40 Insertion rate per base | 0.01% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 265118 % of reads mapped to multiple loci | 0.85% Number of reads mapped to too many loci | 31289 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.00% % of reads unmapped: other | 0.70% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1189744 1189744 1189744 N_multimapping 265118 265118 265118 N_noFeature 752056 28922835 957790 N_ambiguous 893135 4435 161224 UnstrandedReadsAssigned:28217558 PositiveStrandReadsAssigned:935479 NegativeStrandReadsAssigned:28743735 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804164 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804164-trimmed-pair1.fastq SRR7804164-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,317,611 reads, 28,879,845 reads pseudoaligned [quant] estimated average fragment length: 333.503 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,113 rounds 52973 SRR7804164.ke.tsv 35125 SRR7804164.se.tsv 88098 total ==> SRR7804164.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 604.752 0 0 PNS24247 1044 711.497 46.3453 2.70554 PNS24249 1928 1595.5 72.3841 1.88438 PNS24246 1044 711.497 46.3453 2.70554 PNS24248 1044 711.497 46.3453 2.70554 PNS24244 1471 1138.5 71.5801 2.61145 PNS24243 293 70.8081 0 0 KQK14069 1603 1270.5 5235.88 171.174 KQK14071 474 187.629 72.1211 15.9655 ==> SRR7804164.se.tsv <== BRADI_1g14170v3 5690 BRADI_1g53295v3 139 BRADI_1g59795v3 1344 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 257 BRADI_1g74790v3 108 BRADI_1g09890v3 0 BRADI_1g77505v3 273 BRADI_1g48960v3 0 SRR7804164 completed mapping pipeline successfully