Starting /dee2/code/volunteer_pipeline.sh SRR7804165 current disk space = 1525406851072 free memory = 1601814044 SRR7804165 SRAfilesize 0ea5b9c5f45a243cf23922f9f75b3d8a SRR7804165.sra SRR7804165.sra file validated SRR7804165 is paired end SRR7804165 is conventional basespace SRR7804165 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804165_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.18425 37.0 37.0 37.0 37.0 37.0 2 36.116 37.0 37.0 37.0 37.0 37.0 3 36.2585 37.0 37.0 37.0 37.0 37.0 4 36.4 37.0 37.0 37.0 37.0 37.0 5 36.4115 37.0 37.0 37.0 37.0 37.0 6 36.4525 37.0 37.0 37.0 37.0 37.0 7 36.3275 37.0 37.0 37.0 37.0 37.0 8 36.4505 37.0 37.0 37.0 37.0 37.0 9 36.38 37.0 37.0 37.0 37.0 37.0 10-14 36.4759 37.0 37.0 37.0 37.0 37.0 15-19 36.4941 37.0 37.0 37.0 37.0 37.0 20-24 36.4073 37.0 37.0 37.0 37.0 37.0 25-29 36.38779999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.3697 37.0 37.0 37.0 37.0 37.0 35-39 36.277499999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.262499999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.179700000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.264 37.0 37.0 37.0 37.0 37.0 55-59 36.168099999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.12089999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.141200000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.0399 37.0 37.0 37.0 37.0 37.0 75-79 36.02219999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.0404 37.0 37.0 37.0 37.0 37.0 85-89 35.962 37.0 37.0 37.0 37.0 37.0 90-94 35.90990000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.7802 37.0 37.0 37.0 37.0 37.0 100-104 35.7522 37.0 37.0 37.0 37.0 37.0 105-109 35.7204 37.0 37.0 37.0 37.0 37.0 110-114 35.769600000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.6265 37.0 37.0 37.0 37.0 37.0 120-124 35.5631 37.0 37.0 37.0 37.0 37.0 125-129 35.529900000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.4668 37.0 37.0 37.0 37.0 37.0 135-139 35.2896 37.0 37.0 37.0 32.2 37.0 140-144 35.3652 37.0 37.0 37.0 34.6 37.0 145-149 35.1645 37.0 37.0 37.0 25.0 37.0 150-151 34.455749999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 2.0 24 2.0 25 4.0 26 7.0 27 15.0 28 5.0 29 26.0 30 36.0 31 59.0 32 82.0 33 122.0 34 216.0 35 493.0 36 2727.0 37 202.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.337597190870326 13.945322297466767 9.957361424630047 33.759719087032856 2 23.375 18.55 35.5 22.575 3 22.375 24.875 24.6 28.15 4 25.5 31.5 20.4 22.6 5 25.324999999999996 32.125 22.325 20.225 6 20.674999999999997 32.35 22.85 24.125 7 16.975 20.175 41.675000000000004 21.175 8 19.125 21.55 27.625 31.7 9 20.125 19.975 30.775000000000002 29.125 10-14 23.52 26.025 25.11 25.345000000000002 15-19 23.35 25.2 25.685000000000002 25.765 20-24 23.115 25.72 25.174999999999997 25.990000000000002 25-29 23.535 25.34 25.35 25.775 30-34 23.425 24.955 25.66 25.96 35-39 23.525 25.540000000000003 25.259999999999998 25.674999999999997 40-44 23.345 25.324999999999996 25.11 26.22 45-49 24.04 25.83 24.605 25.525 50-54 23.235 25.66 24.86 26.245 55-59 24.065 24.834999999999997 24.55 26.55 60-64 24.05 25.485000000000003 24.335 26.13 65-69 23.525 25.685000000000002 24.46 26.33 70-74 23.76 25.069999999999997 24.759999999999998 26.41 75-79 23.525 25.415 24.785 26.275 80-84 23.515 24.555 25.295 26.634999999999998 85-89 24.265 24.125 25.3 26.31 90-94 24.69 23.955000000000002 24.695 26.66 95-99 24.725 25.03 24.785 25.46 100-104 24.66 24.895 24.925 25.52 105-109 24.23 24.285 25.259999999999998 26.224999999999998 110-114 24.349999999999998 25.055 24.54 26.055 115-119 24.43 24.54 24.740000000000002 26.290000000000003 120-124 24.745 24.005000000000003 24.72 26.529999999999998 125-129 24.88 24.285 24.675 26.16 130-134 24.73 24.58 24.6 26.090000000000003 135-139 24.445 24.6 24.73 26.224999999999998 140-144 24.855 24.38 24.490000000000002 26.275 145-149 24.34 24.154999999999998 24.490000000000002 27.015 150-151 24.4375 24.025 25.0 26.5375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 0.0 23 0.0 24 0.0 25 2.0 26 3.5 27 2.5 28 4.0 29 7.0 30 9.0 31 11.0 32 20.0 33 28.0 34 31.5 35 38.5 36 46.0 37 59.0 38 87.5 39 102.5 40 106.0 41 146.0 42 176.5 43 170.5 44 184.5 45 203.5 46 189.0 47 179.0 48 177.5 49 170.0 50 164.5 51 143.5 52 123.5 53 113.0 54 98.0 55 100.0 56 98.5 57 89.5 58 82.0 59 63.0 60 65.0 61 65.0 62 56.0 63 61.5 64 63.0 65 61.5 66 54.5 67 47.5 68 47.0 69 44.5 70 39.5 71 39.0 72 32.0 73 19.5 74 17.0 75 14.5 76 11.5 77 10.0 78 7.5 79 4.0 80 1.0 81 0.5 82 1.5 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.7 #Duplication Level Percentage of deduplicated Percentage of total 1 95.82027168234065 91.7 2 3.8923719958202714 7.449999999999999 3 0.2612330198537095 0.75 4 0.026123301985370953 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.2375 0.0 0.0 0.0 0.0 116-117 0.275 0.0 0.0 0.0 0.0 118-119 0.3 0.0 0.0 0.0 0.0 120-121 0.3125 0.0 0.0 0.0 0.0 122-123 0.325 0.0 0.0 0.0 0.0 124-125 0.3875 0.0 0.0 0.0 0.0 126-127 0.44999999999999996 0.0 0.0 0.0 0.0 128-129 0.5 0.0 0.0 0.0 0.0 130-131 0.55 0.0 0.0 0.0 0.0 132-133 0.6875 0.0 0.0 0.0 0.0 134-135 0.775 0.0 0.0 0.0 0.0 136-137 0.8374999999999999 0.0 0.0 0.0 0.0 138-139 0.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804165 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804165_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4965 37.0 37.0 37.0 37.0 37.0 2 36.11 37.0 37.0 37.0 37.0 37.0 3 36.263 37.0 37.0 37.0 37.0 37.0 4 36.411 37.0 37.0 37.0 37.0 37.0 5 36.337 37.0 37.0 37.0 37.0 37.0 6 36.337 37.0 37.0 37.0 37.0 37.0 7 36.2975 37.0 37.0 37.0 37.0 37.0 8 36.467 37.0 37.0 37.0 37.0 37.0 9 36.384 37.0 37.0 37.0 37.0 37.0 10-14 36.326499999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.2273 37.0 37.0 37.0 37.0 37.0 20-24 36.2454 37.0 37.0 37.0 37.0 37.0 25-29 36.212900000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.1413 37.0 37.0 37.0 37.0 37.0 35-39 36.0949 37.0 37.0 37.0 37.0 37.0 40-44 36.083099999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.983700000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.053700000000006 37.0 37.0 37.0 37.0 37.0 55-59 35.9872 37.0 37.0 37.0 37.0 37.0 60-64 35.9001 37.0 37.0 37.0 37.0 37.0 65-69 35.857899999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.86409999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.8236 37.0 37.0 37.0 37.0 37.0 80-84 35.755100000000006 37.0 37.0 37.0 37.0 37.0 85-89 35.67230000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.6398 37.0 37.0 37.0 37.0 37.0 95-99 35.50749999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.446299999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.3918 37.0 37.0 37.0 34.6 37.0 110-114 35.288 37.0 37.0 37.0 34.6 37.0 115-119 35.206300000000006 37.0 37.0 37.0 29.8 37.0 120-124 35.2025 37.0 37.0 37.0 29.8 37.0 125-129 35.177499999999995 37.0 37.0 37.0 27.4 37.0 130-134 35.088 37.0 37.0 37.0 25.0 37.0 135-139 34.9045 37.0 37.0 37.0 25.0 37.0 140-144 34.7002 37.0 37.0 37.0 25.0 37.0 145-149 34.721500000000006 37.0 37.0 37.0 25.0 37.0 150-151 34.01975 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 6.0 16 4.0 17 1.0 18 0.0 19 2.0 20 1.0 21 5.0 22 5.0 23 7.0 24 4.0 25 7.0 26 7.0 27 9.0 28 15.0 29 27.0 30 35.0 31 59.0 32 56.0 33 144.0 34 265.0 35 728.0 36 2510.0 37 102.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.775 14.6 12.525 32.1 2 29.175 21.4 27.975 21.45 3 24.075 23.974999999999998 27.35 24.6 4 27.0 30.325000000000003 18.575 24.099999999999998 5 27.1 32.324999999999996 19.400000000000002 21.175 6 21.5 34.275 20.375 23.849999999999998 7 21.625 14.05 37.15 27.175 8 22.7 20.599999999999998 22.3 34.4 9 25.775 20.7 24.85 28.675 10-14 26.384999999999998 24.215 22.5 26.900000000000002 15-19 25.97 24.135 23.445 26.450000000000003 20-24 25.435000000000002 25.240000000000002 23.169999999999998 26.155 25-29 26.31 24.03 23.669999999999998 25.990000000000002 30-34 26.11 24.005000000000003 23.71 26.174999999999997 35-39 26.055 24.03 23.105 26.810000000000002 40-44 26.85 24.36 22.900000000000002 25.89 45-49 26.064999999999998 23.925 24.07 25.94 50-54 26.58 24.13 23.169999999999998 26.119999999999997 55-59 26.729999999999997 24.43 22.759999999999998 26.08 60-64 26.415 24.11 23.49 25.985000000000003 65-69 26.655 24.07 23.32 25.955000000000002 70-74 26.705000000000002 23.605 23.549999999999997 26.14 75-79 26.955000000000002 23.95 23.315 25.779999999999998 80-84 26.55 24.605 23.189999999999998 25.655 85-89 27.089999999999996 24.035 23.255 25.619999999999997 90-94 26.435 24.855 23.044999999999998 25.665 95-99 26.529999999999998 24.565 23.34 25.564999999999998 100-104 27.125 24.145 23.225 25.505 105-109 26.66 24.05 23.52 25.77 110-114 26.77 24.605 23.445 25.180000000000003 115-119 27.065 24.63 22.79 25.515 120-124 26.83 24.39 23.11 25.669999999999998 125-129 26.77 24.349999999999998 23.645 25.235000000000003 130-134 27.1 24.68 22.89 25.330000000000002 135-139 27.075 24.709999999999997 23.25 24.965 140-144 27.084999999999997 24.595 23.36 24.959999999999997 145-149 27.38 24.89 22.689999999999998 25.040000000000003 150-151 27.075 25.575 22.125 25.224999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.5 23 2.0 24 1.5 25 0.5 26 1.0 27 2.0 28 2.0 29 3.0 30 8.0 31 11.5 32 14.5 33 15.5 34 17.0 35 28.0 36 40.5 37 48.0 38 63.0 39 81.0 40 100.0 41 119.5 42 120.0 43 140.0 44 151.5 45 151.0 46 171.5 47 168.5 48 156.0 49 160.5 50 151.0 51 130.0 52 116.0 53 95.5 54 101.0 55 93.0 56 79.5 57 90.0 58 95.0 59 96.5 60 85.0 61 79.0 62 77.5 63 80.5 64 84.5 65 81.0 66 73.5 67 75.5 68 80.0 69 76.5 70 77.0 71 75.5 72 52.0 73 38.0 74 35.5 75 23.0 76 23.0 77 18.5 78 12.0 79 8.0 80 2.5 81 1.0 82 0.5 83 1.0 84 1.0 85 1.0 86 1.0 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 1.0 99 1.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.525 #Duplication Level Percentage of deduplicated Percentage of total 1 95.8126144988223 91.525 2 3.8209892698246533 7.3 3 0.31405391258832765 0.8999999999999999 4 0.026171159382360636 0.1 5 0.0 0.0 6 0.0 0.0 7 0.026171159382360636 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.2375 0.0 0.0 0.0 0.0 116-117 0.275 0.0 0.0 0.0 0.0 118-119 0.3 0.0 0.0 0.0 0.0 120-121 0.3125 0.0 0.0 0.0 0.0 122-123 0.35 0.0 0.0 0.0 0.0 124-125 0.4125 0.0 0.0 0.0 0.0 126-127 0.475 0.0 0.0 0.0 0.0 128-129 0.525 0.0 0.0 0.0 0.0 130-131 0.575 0.0 0.0 0.0 0.0 132-133 0.7125 0.0 0.0 0.0 0.0 134-135 0.7875000000000001 0.0 0.0 0.0 0.0 136-137 0.85 0.0 0.0 0.0 0.0 138-139 0.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCCGCC 10 0.006830828 145.0 5 CGGTGGA 10 0.006830828 145.0 4 >>END_MODULE Read 1846581 spots for SRR7804165.sra Written 1846581 spots for SRR7804165.sra Read 1846581 spots for SRR7804165.sra Written 1846581 spots for SRR7804165.sra Read 1846581 spots for SRR7804165.sra Written 1846581 spots for SRR7804165.sra Read 1846581 spots for SRR7804165.sra Written 1846581 spots for SRR7804165.sra Read 1846581 spots for SRR7804165.sra Written 1846581 spots for SRR7804165.sra Read 1846581 spots for SRR7804165.sra Written 1846581 spots for SRR7804165.sra Read 1846581 spots for SRR7804165.sra Written 1846581 spots for SRR7804165.sra Read 1846581 spots for SRR7804165.sra Written 1846581 spots for SRR7804165.sra Read 1846581 spots for SRR7804165.sra Written 1846581 spots for SRR7804165.sra Read 1846581 spots for SRR7804165.sra Written 1846581 spots for SRR7804165.sra Read 1846581 spots for SRR7804165.sra Written 1846581 spots for SRR7804165.sra Read 1846588 spots for SRR7804165.sra Written 1846588 spots for SRR7804165.sra Read 1846581 spots for SRR7804165.sra Written 1846581 spots for SRR7804165.sra Read 1846581 spots for SRR7804165.sra Written 1846581 spots for SRR7804165.sra Read 1846581 spots for SRR7804165.sra Written 1846581 spots for SRR7804165.sra Read 1846581 spots for SRR7804165.sra Written 1846581 spots for SRR7804165.sra Read 1846581 spots for SRR7804165.sra Written 1846581 spots for SRR7804165.sra Read 1846581 spots for SRR7804165.sra Written 1846581 spots for SRR7804165.sra Read 1846581 spots for SRR7804165.sra Written 1846581 spots for SRR7804165.sra Read 1846581 spots for SRR7804165.sra Written 1846581 spots for SRR7804165.sra SRR ids: ['SRR7804165.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_40cuwimx SRR7804165.sra spots: 36931627 blocks: [[1, 1846581], [1846582, 3693162], [3693163, 5539743], [5539744, 7386324], [7386325, 9232905], [9232906, 11079486], [11079487, 12926067], [12926068, 14772648], [14772649, 16619229], [16619230, 18465810], [18465811, 20312391], [20312392, 22158972], [22158973, 24005553], [24005554, 25852134], [25852135, 27698715], [27698716, 29545296], [29545297, 31391877], [31391878, 33238458], [33238459, 35085039], [35085040, 36931627]] SRR7804165 file size 12493216 SRR7804165 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804165 SRR7804165_1.fastq SRR7804165_2.fastq Input file: SRR7804165_1.fastq Paired file: SRR7804165_2.fastq trimmed: SRR7804165-trimmed-pair1.fastq, SRR7804165-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:09:27 2024 >> started Tue Dec 10 03:10:08 2024 >> done (40.214s) 36931627 read pairs processed; of these: 112 ( 0.00%) short read pairs filtered out after trimming by size control 942 ( 0.00%) empty read pairs filtered out after trimming by size control 36930573 (100.00%) read pairs available; of these: 618543 ( 1.67%) trimmed read pairs available after processing 36312030 (98.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 14 0.00% 20 16 0.00% 21 24 0.00% 22 17 0.00% 23 35 0.00% 24 22 0.00% 25 35 0.00% 26 38 0.00% 27 35 0.00% 28 34 0.00% 29 38 0.00% 30 44 0.00% 31 56 0.00% 32 52 0.00% 33 60 0.00% 34 43 0.00% 35 65 0.00% 36 64 0.00% 37 66 0.00% 38 59 0.00% 39 73 0.00% 40 65 0.00% 41 47 0.00% 42 73 0.00% 43 72 0.00% 44 65 0.00% 45 67 0.00% 46 77 0.00% 47 78 0.00% 48 89 0.00% 49 86 0.00% 50 85 0.00% 51 76 0.00% 52 103 0.00% 53 94 0.00% 54 104 0.00% 55 106 0.00% 56 107 0.00% 57 87 0.00% 58 111 0.00% 59 94 0.00% 60 131 0.00% 61 143 0.00% 62 124 0.00% 63 112 0.00% 64 143 0.00% 65 121 0.00% 66 116 0.00% 67 114 0.00% 68 162 0.00% 69 176 0.00% 70 163 0.00% 71 153 0.00% 72 203 0.00% 73 212 0.00% 74 193 0.00% 75 189 0.00% 76 224 0.00% 77 241 0.00% 78 250 0.00% 79 252 0.00% 80 267 0.00% 81 306 0.00% 82 318 0.00% 83 343 0.00% 84 431 0.00% 85 402 0.00% 86 469 0.00% 87 472 0.00% 88 573 0.00% 89 559 0.00% 90 657 0.00% 91 743 0.00% 92 812 0.00% 93 898 0.00% 94 1014 0.00% 95 1130 0.00% 96 1196 0.00% 97 1331 0.00% 98 1439 0.00% 99 1526 0.00% 100 1628 0.00% 101 1848 0.01% 102 2055 0.01% 103 2339 0.01% 104 2511 0.01% 105 2839 0.01% 106 2972 0.01% 107 3066 0.01% 108 3392 0.01% 109 3567 0.01% 110 3837 0.01% 111 4157 0.01% 112 4455 0.01% 113 4835 0.01% 114 5322 0.01% 115 5735 0.02% 116 6066 0.02% 117 6354 0.02% 118 6584 0.02% 119 7034 0.02% 120 7309 0.02% 121 7893 0.02% 122 8460 0.02% 123 8853 0.02% 124 9687 0.03% 125 9988 0.03% 126 10676 0.03% 127 10780 0.03% 128 11349 0.03% 129 11850 0.03% 130 12437 0.03% 131 12814 0.03% 132 13869 0.04% 133 14308 0.04% 134 15395 0.04% 135 16273 0.04% 136 16832 0.05% 137 17124 0.05% 138 18216 0.05% 139 18834 0.05% 140 19205 0.05% 141 20384 0.06% 142 20834 0.06% 143 21457 0.06% 144 22822 0.06% 145 24458 0.07% 146 25392 0.07% 147 26039 0.07% 148 26734 0.07% 149 27510 0.07% 150 29273 0.08% 151 36312030 98.33% 36930573 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=5.05 fanout-score-rank=19 prefix-density=0.44 prefix-fanout=3.5 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=314.17 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=22.5 sequence=ATCATCATCGTGGTAGTACAAGTGAAACCAGCTACACACACTTGGTCGCGAGCATAGTCGATTTGCATATACACATGTGCCTCTCATTGACACCTTACTTGCCGGGAACGAAGTTGGTGGCAAAGGCCCACGCGTTGTTGTTGACGGGGTCGGCAAGGTGGTCAGCGAGGTTCTCAAGGGGACCCTTGCCGGTGACGATGGCCTGAACGAAGAAGCCGAACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=5.18 fanout-score-rank=20 prefix-density=0.79 prefix-fanout=2.0 sequence=AGATGTCTTGCAGCTGTGGATCAAGCTGCAACTGTGGCTCAAACTGCACTTGCGGGAAGATGTACCCAGACCTGGCAGAGCAGGCCAGCACCACCAGCAGCACCCAGGCCCAGGTGGTGGTTCTCGGCATGGCGCCGGAGAAGAA criterion=fanout-score sequence-density=0.12 sequence-density-rank=18 fanout-score=145.94 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=19.0 sequence=CCGCCGCCGCCG SRR7804165 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:11:01 Started mapping on | Dec 10 03:11:01 Finished on | Dec 10 03:18:43 Mapping speed, Million of reads per hour | 287.77 Number of input reads | 36930573 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 33970531 Uniquely mapped reads % | 91.98% Average mapped length | 300.35 Number of splices: Total | 37262689 Number of splices: Annotated (sjdb) | 34981965 Number of splices: GT/AG | 36704233 Number of splices: GC/AG | 486311 Number of splices: AT/AC | 22196 Number of splices: Non-canonical | 49949 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.64 Insertion rate per base | 0.01% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 332101 % of reads mapped to multiple loci | 0.90% Number of reads mapped to too many loci | 11257 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.87% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2627941 2627941 2627941 N_multimapping 332101 332101 332101 N_noFeature 999485 32912569 1263556 N_ambiguous 959180 6542 167031 UnstrandedReadsAssigned:32011866 PositiveStrandReadsAssigned:1051420 NegativeStrandReadsAssigned:32539944 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804165 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804165-trimmed-pair1.fastq SRR7804165-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,930,573 reads, 32,894,239 reads pseudoaligned [quant] estimated average fragment length: 346.054 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,168 rounds 52973 SRR7804165.ke.tsv 35125 SRR7804165.se.tsv 88098 total ==> SRR7804165.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 592.309 0 0 PNS24247 1044 698.946 121.552 6.63934 PNS24249 1928 1582.95 131.29 3.16645 PNS24246 1044 698.946 121.552 6.63934 PNS24248 1044 698.946 121.552 6.63934 PNS24244 1471 1125.95 169.054 5.7321 PNS24243 293 66.8558 0 0 KQK14069 1603 1257.95 4519.24 137.154 KQK14071 474 180.908 79.3525 16.7459 ==> SRR7804165.se.tsv <== BRADI_1g14170v3 4822 BRADI_1g53295v3 244 BRADI_1g59795v3 1179 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 657 BRADI_1g74790v3 1324 BRADI_1g09890v3 0 BRADI_1g77505v3 511 BRADI_1g48960v3 1 SRR7804165 completed mapping pipeline successfully