Starting /dee2/code/volunteer_pipeline.sh SRR7804166 current disk space = 1525398982656 free memory = 1407519664 SRR7804166 SRAfilesize 52af48b50f96a5e141ed4f6bac5ecc7f SRR7804166.sra SRR7804166.sra file validated SRR7804166 is paired end SRR7804166 is conventional basespace SRR7804166 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804166_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.18775 37.0 37.0 37.0 37.0 37.0 2 36.312 37.0 37.0 37.0 37.0 37.0 3 36.41 37.0 37.0 37.0 37.0 37.0 4 36.47 37.0 37.0 37.0 37.0 37.0 5 36.5205 37.0 37.0 37.0 37.0 37.0 6 36.441 37.0 37.0 37.0 37.0 37.0 7 36.317 37.0 37.0 37.0 37.0 37.0 8 36.49 37.0 37.0 37.0 37.0 37.0 9 36.439 37.0 37.0 37.0 37.0 37.0 10-14 36.4927 37.0 37.0 37.0 37.0 37.0 15-19 36.4549 37.0 37.0 37.0 37.0 37.0 20-24 36.452 37.0 37.0 37.0 37.0 37.0 25-29 36.3802 37.0 37.0 37.0 37.0 37.0 30-34 36.375800000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.3382 37.0 37.0 37.0 37.0 37.0 40-44 36.3272 37.0 37.0 37.0 37.0 37.0 45-49 36.28359999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.2173 37.0 37.0 37.0 37.0 37.0 55-59 36.1872 37.0 37.0 37.0 37.0 37.0 60-64 36.1556 37.0 37.0 37.0 37.0 37.0 65-69 36.1312 37.0 37.0 37.0 37.0 37.0 70-74 36.035000000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.0628 37.0 37.0 37.0 37.0 37.0 80-84 36.053200000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.9774 37.0 37.0 37.0 37.0 37.0 90-94 35.924600000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.8208 37.0 37.0 37.0 37.0 37.0 100-104 35.813 37.0 37.0 37.0 37.0 37.0 105-109 35.7454 37.0 37.0 37.0 37.0 37.0 110-114 35.7542 37.0 37.0 37.0 37.0 37.0 115-119 35.5612 37.0 37.0 37.0 37.0 37.0 120-124 35.5608 37.0 37.0 37.0 37.0 37.0 125-129 35.51899999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.4215 37.0 37.0 37.0 37.0 37.0 135-139 35.2428 37.0 37.0 37.0 29.8 37.0 140-144 35.26090000000001 37.0 37.0 37.0 34.6 37.0 145-149 35.08480000000001 37.0 37.0 37.0 25.0 37.0 150-151 34.5075 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 1.0 22 1.0 23 1.0 24 5.0 25 3.0 26 11.0 27 14.0 28 23.0 29 26.0 30 32.0 31 57.0 32 73.0 33 126.0 34 174.0 35 441.0 36 2766.0 37 245.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.71950914099674 13.398447282744804 10.693713999499122 36.18832957675933 2 23.075000000000003 19.625 34.225 23.075000000000003 3 21.55 26.200000000000003 25.224999999999998 27.025 4 25.900000000000002 31.7 19.475 22.925 5 24.575 32.4 21.475 21.55 6 22.125 32.875 22.225 22.775000000000002 7 17.125 20.549999999999997 40.825 21.5 8 20.175 20.925 25.75 33.15 9 20.95 21.725 28.175 29.15 10-14 23.62 26.169999999999998 24.335 25.874999999999996 15-19 23.855 25.3 23.825 27.02 20-24 23.365 25.83 24.32 26.484999999999996 25-29 23.86 25.39 24.25 26.5 30-34 24.404999999999998 25.345000000000002 24.099999999999998 26.150000000000002 35-39 23.98 25.480000000000004 24.255 26.284999999999997 40-44 23.825 24.93 24.285 26.96 45-49 24.3 24.855 24.615000000000002 26.229999999999997 50-54 24.305 25.795 23.395 26.505000000000003 55-59 24.37 25.130000000000003 23.94 26.56 60-64 24.565 24.325 24.135 26.974999999999998 65-69 24.44 25.074999999999996 23.895 26.590000000000003 70-74 24.195 25.115 23.925 26.765 75-79 24.755 25.235000000000003 23.544999999999998 26.465 80-84 24.59 24.695 23.585 27.13 85-89 24.41 24.75 23.595 27.245 90-94 24.490000000000002 24.695 24.135 26.68 95-99 24.779999999999998 25.430000000000003 22.91 26.88 100-104 24.275 24.474999999999998 23.77 27.48 105-109 24.97 24.89 23.29 26.85 110-114 24.73 24.310000000000002 24.115000000000002 26.845000000000002 115-119 25.355 24.43 24.005000000000003 26.21 120-124 25.169999999999998 23.625 24.22 26.985 125-129 24.755 23.72 24.18 27.345000000000002 130-134 25.040000000000003 24.6 23.75 26.61 135-139 24.565 24.09 23.515 27.83 140-144 25.25 24.455 23.615 26.68 145-149 25.525 23.565 23.74 27.169999999999998 150-151 25.4625 23.1375 23.025000000000002 28.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.5 23 1.0 24 1.0 25 0.5 26 1.0 27 1.0 28 2.0 29 7.5 30 12.5 31 13.5 32 16.0 33 20.5 34 24.0 35 37.0 36 51.0 37 63.5 38 85.0 39 97.0 40 112.5 41 127.5 42 138.5 43 146.0 44 160.0 45 175.5 46 184.5 47 184.0 48 163.0 49 152.0 50 140.5 51 137.5 52 145.5 53 132.0 54 116.0 55 100.5 56 92.5 57 91.0 58 78.0 59 77.0 60 77.0 61 71.5 62 71.5 63 63.5 64 62.5 65 65.5 66 58.0 67 60.5 68 64.5 69 57.0 70 45.0 71 45.0 72 42.5 73 29.0 74 27.0 75 21.0 76 11.5 77 11.0 78 8.0 79 4.5 80 2.0 81 2.0 82 3.0 83 2.0 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.1 #Duplication Level Percentage of deduplicated Percentage of total 1 96.17585848074923 92.425 2 3.5900104058272633 6.9 3 0.23413111342351717 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.4875 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.6 0.0 0.0 0.0 0.0 122-123 0.65 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.925 0.0 0.0 0.0 0.0 128-129 1.0125 0.0 0.0 0.0 0.0 130-131 1.1124999999999998 0.0 0.0 0.0 0.0 132-133 1.2375 0.0 0.0 0.0 0.0 134-135 1.35 0.0 0.0 0.0 0.0 136-137 1.4625 0.0 0.0 0.0 0.0 138-139 1.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCACG 10 0.006830828 145.0 4 >>END_MODULE SRR7804166 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804166_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.449 37.0 37.0 37.0 37.0 37.0 2 36.196 37.0 37.0 37.0 37.0 37.0 3 36.228 37.0 37.0 37.0 37.0 37.0 4 36.3155 37.0 37.0 37.0 37.0 37.0 5 36.3555 37.0 37.0 37.0 37.0 37.0 6 36.1915 37.0 37.0 37.0 37.0 37.0 7 36.0955 37.0 37.0 37.0 37.0 37.0 8 36.1885 37.0 37.0 37.0 37.0 37.0 9 36.234 37.0 37.0 37.0 37.0 37.0 10-14 36.2464 37.0 37.0 37.0 37.0 37.0 15-19 36.1481 37.0 37.0 37.0 37.0 37.0 20-24 36.1645 37.0 37.0 37.0 37.0 37.0 25-29 36.079100000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.064299999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.9738 37.0 37.0 37.0 37.0 37.0 40-44 35.9433 37.0 37.0 37.0 37.0 37.0 45-49 35.946600000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.9385 37.0 37.0 37.0 37.0 37.0 55-59 35.898799999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.773700000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.6397 37.0 37.0 37.0 37.0 37.0 70-74 35.7216 37.0 37.0 37.0 37.0 37.0 75-79 35.6188 37.0 37.0 37.0 37.0 37.0 80-84 35.609700000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.5202 37.0 37.0 37.0 37.0 37.0 90-94 35.4302 37.0 37.0 37.0 37.0 37.0 95-99 35.466899999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.3521 37.0 37.0 37.0 34.6 37.0 105-109 35.2819 37.0 37.0 37.0 34.6 37.0 110-114 35.149699999999996 37.0 37.0 37.0 27.4 37.0 115-119 35.1031 37.0 37.0 37.0 27.4 37.0 120-124 35.0894 37.0 37.0 37.0 25.0 37.0 125-129 34.9729 37.0 37.0 37.0 25.0 37.0 130-134 34.8839 37.0 37.0 37.0 25.0 37.0 135-139 34.71 37.0 37.0 37.0 25.0 37.0 140-144 34.592499999999994 37.0 37.0 37.0 25.0 37.0 145-149 34.455 37.0 37.0 37.0 25.0 37.0 150-151 33.758 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 4.0 15 5.0 16 1.0 17 0.0 18 0.0 19 2.0 20 4.0 21 5.0 22 7.0 23 16.0 24 14.0 25 12.0 26 11.0 27 23.0 28 23.0 29 21.0 30 31.0 31 43.0 32 61.0 33 127.0 34 248.0 35 753.0 36 2478.0 37 107.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.475 13.775 12.875 32.875 2 29.599999999999998 17.925 28.725 23.75 3 24.95 23.225 26.424999999999997 25.4 4 29.075 29.549999999999997 17.675 23.7 5 28.95 30.625000000000004 18.675 21.75 6 22.375 33.125 18.475 26.025 7 21.7 14.799999999999999 36.85 26.650000000000002 8 24.25 19.650000000000002 21.925 34.175 9 24.75 21.525 23.5 30.225 10-14 26.405 24.37 21.535 27.689999999999998 15-19 26.534999999999997 24.185000000000002 23.06 26.22 20-24 26.5 24.26 22.23 27.01 25-29 26.590000000000003 24.13 22.595000000000002 26.685 30-34 27.18 23.794999999999998 23.0 26.025 35-39 26.985 23.705000000000002 22.655 26.655 40-44 26.935 23.87 22.32 26.875 45-49 27.355 23.965 22.655 26.025 50-54 27.800000000000004 23.845 22.325 26.029999999999998 55-59 27.389999999999997 23.865 22.375 26.369999999999997 60-64 26.474999999999998 24.305 22.81 26.41 65-69 27.655 24.060000000000002 22.515 25.77 70-74 27.415 23.87 22.785 25.929999999999996 75-79 27.589999999999996 24.404999999999998 22.63 25.374999999999996 80-84 27.560000000000002 23.855 23.135 25.45 85-89 28.15 24.41 22.205 25.235000000000003 90-94 27.295 24.195 23.005 25.505 95-99 27.775 23.974999999999998 22.509999999999998 25.740000000000002 100-104 26.93 23.74 23.035 26.295 105-109 27.395000000000003 23.665 23.325000000000003 25.615 110-114 27.1 24.26 23.09 25.55 115-119 27.55 23.78 22.89 25.779999999999998 120-124 27.325 24.09 23.25 25.335 125-129 27.855 23.71 22.96 25.474999999999998 130-134 27.55 24.279999999999998 22.86 25.31 135-139 27.63 24.665 23.075000000000003 24.63 140-144 27.72 24.345 22.564999999999998 25.369999999999997 145-149 27.24 24.745 22.85 25.165 150-151 28.0625 23.325000000000003 23.25 25.362499999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 1.0 21 0.5 22 0.0 23 1.5 24 2.0 25 2.0 26 2.0 27 0.5 28 0.5 29 2.0 30 3.5 31 4.5 32 4.0 33 7.5 34 13.0 35 20.5 36 28.5 37 39.5 38 59.0 39 69.5 40 84.0 41 102.0 42 119.5 43 129.5 44 138.0 45 145.5 46 150.5 47 161.0 48 160.5 49 143.0 50 121.5 51 123.0 52 125.5 53 128.0 54 123.5 55 117.0 56 107.5 57 99.0 58 95.0 59 88.5 60 96.5 61 89.5 62 86.5 63 101.0 64 94.0 65 92.5 66 86.5 67 80.5 68 83.0 69 76.0 70 74.5 71 58.5 72 50.5 73 51.0 74 40.5 75 32.5 76 23.0 77 14.0 78 10.5 79 6.5 80 5.5 81 3.5 82 1.5 83 1.5 84 1.0 85 0.5 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 2.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.95 #Duplication Level Percentage of deduplicated Percentage of total 1 96.22199062011464 92.325 2 3.3871808233454925 6.5 3 0.33871808233454925 0.975 4 0.05211047420531526 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.42500000000000004 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.5625 0.0 0.0 0.0 0.0 118-119 0.6375 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.725 0.0 0.0 0.0 0.0 124-125 0.825 0.0 0.0 0.0 0.0 126-127 1.0 0.0 0.0 0.0 0.0 128-129 1.0875 0.0 0.0 0.0 0.0 130-131 1.1749999999999998 0.0 0.0 0.0 0.0 132-133 1.2875 0.0 0.0 0.0 0.0 134-135 1.4249999999999998 0.0 0.0 0.0 0.025 136-137 1.55 0.0 0.0 0.0 0.025 138-139 1.6625 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCACAG 10 0.006830828 145.0 7 >>END_MODULE Read 1407669 spots for SRR7804166.sra Written 1407669 spots for SRR7804166.sra Read 1407669 spots for SRR7804166.sra Written 1407669 spots for SRR7804166.sra Read 1407669 spots for SRR7804166.sra Written 1407669 spots for SRR7804166.sra Read 1407669 spots for SRR7804166.sra Written 1407669 spots for SRR7804166.sra Read 1407669 spots for SRR7804166.sra Written 1407669 spots for SRR7804166.sra Read 1407669 spots for SRR7804166.sra Written 1407669 spots for SRR7804166.sra Read 1407669 spots for SRR7804166.sra Written 1407669 spots for SRR7804166.sra Read 1407669 spots for SRR7804166.sra Written 1407669 spots for SRR7804166.sra Read 1407669 spots for SRR7804166.sra Written 1407669 spots for SRR7804166.sra Read 1407669 spots for SRR7804166.sra Written 1407669 spots for SRR7804166.sra Read 1407669 spots for SRR7804166.sra Written 1407669 spots for SRR7804166.sra Read 1407669 spots for SRR7804166.sra Written 1407669 spots for SRR7804166.sra Read 1407669 spots for SRR7804166.sra Written 1407669 spots for SRR7804166.sra Read 1407669 spots for SRR7804166.sra Written 1407669 spots for SRR7804166.sra Read 1407669 spots for SRR7804166.sra Written 1407669 spots for SRR7804166.sra Read 1407669 spots for SRR7804166.sra Written 1407669 spots for SRR7804166.sra Read 1407669 spots for SRR7804166.sra Written 1407669 spots for SRR7804166.sra Read 1407669 spots for SRR7804166.sra Written 1407669 spots for SRR7804166.sra Read 1407669 spots for SRR7804166.sra Written 1407669 spots for SRR7804166.sra Read 1407674 spots for SRR7804166.sra Written 1407674 spots for SRR7804166.sra SRR ids: ['SRR7804166.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l5q91q93 SRR7804166.sra spots: 28153385 blocks: [[1, 1407669], [1407670, 2815338], [2815339, 4223007], [4223008, 5630676], [5630677, 7038345], [7038346, 8446014], [8446015, 9853683], [9853684, 11261352], [11261353, 12669021], [12669022, 14076690], [14076691, 15484359], [15484360, 16892028], [16892029, 18299697], [18299698, 19707366], [19707367, 21115035], [21115036, 22522704], [22522705, 23930373], [23930374, 25338042], [25338043, 26745711], [26745712, 28153385]] SRR7804166 file size 9518558 SRR7804166 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804166 SRR7804166_1.fastq SRR7804166_2.fastq Input file: SRR7804166_1.fastq Paired file: SRR7804166_2.fastq trimmed: SRR7804166-trimmed-pair1.fastq, SRR7804166-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:05:57 2024 >> started Tue Dec 10 03:06:41 2024 >> done (44.122s) 28153385 read pairs processed; of these: 101 ( 0.00%) short read pairs filtered out after trimming by size control 554 ( 0.00%) empty read pairs filtered out after trimming by size control 28152730 (100.00%) read pairs available; of these: 839502 ( 2.98%) trimmed read pairs available after processing 27313228 (97.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 15 0.00% 20 11 0.00% 21 31 0.00% 22 25 0.00% 23 32 0.00% 24 22 0.00% 25 23 0.00% 26 41 0.00% 27 34 0.00% 28 43 0.00% 29 40 0.00% 30 54 0.00% 31 50 0.00% 32 53 0.00% 33 52 0.00% 34 54 0.00% 35 71 0.00% 36 47 0.00% 37 68 0.00% 38 75 0.00% 39 66 0.00% 40 50 0.00% 41 66 0.00% 42 73 0.00% 43 78 0.00% 44 75 0.00% 45 91 0.00% 46 77 0.00% 47 67 0.00% 48 84 0.00% 49 97 0.00% 50 81 0.00% 51 96 0.00% 52 74 0.00% 53 86 0.00% 54 115 0.00% 55 115 0.00% 56 114 0.00% 57 99 0.00% 58 116 0.00% 59 119 0.00% 60 108 0.00% 61 143 0.00% 62 135 0.00% 63 138 0.00% 64 147 0.00% 65 163 0.00% 66 125 0.00% 67 179 0.00% 68 165 0.00% 69 192 0.00% 70 191 0.00% 71 212 0.00% 72 201 0.00% 73 215 0.00% 74 218 0.00% 75 268 0.00% 76 260 0.00% 77 271 0.00% 78 320 0.00% 79 387 0.00% 80 379 0.00% 81 443 0.00% 82 497 0.00% 83 558 0.00% 84 653 0.00% 85 628 0.00% 86 712 0.00% 87 805 0.00% 88 915 0.00% 89 937 0.00% 90 1051 0.00% 91 1202 0.00% 92 1335 0.00% 93 1507 0.01% 94 1709 0.01% 95 1881 0.01% 96 2073 0.01% 97 2174 0.01% 98 2310 0.01% 99 2523 0.01% 100 2773 0.01% 101 3091 0.01% 102 3317 0.01% 103 3821 0.01% 104 3961 0.01% 105 4404 0.02% 106 4773 0.02% 107 4958 0.02% 108 5315 0.02% 109 5579 0.02% 110 5680 0.02% 111 6179 0.02% 112 6903 0.02% 113 7366 0.03% 114 7959 0.03% 115 8421 0.03% 116 8863 0.03% 117 9373 0.03% 118 9511 0.03% 119 9822 0.03% 120 10335 0.04% 121 11141 0.04% 122 12006 0.04% 123 12653 0.04% 124 13611 0.05% 125 14210 0.05% 126 15094 0.05% 127 15286 0.05% 128 15717 0.06% 129 16487 0.06% 130 16994 0.06% 131 17347 0.06% 132 18562 0.07% 133 19456 0.07% 134 20576 0.07% 135 22044 0.08% 136 22950 0.08% 137 23525 0.08% 138 24161 0.09% 139 24771 0.09% 140 25341 0.09% 141 25925 0.09% 142 27254 0.10% 143 28092 0.10% 144 29765 0.11% 145 31388 0.11% 146 32523 0.12% 147 33447 0.12% 148 34388 0.12% 149 35170 0.12% 150 36192 0.13% 151 27313228 97.02% 28152730 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=4.70 fanout-score-rank=26 prefix-density=0.27 prefix-fanout=4.1 sequence=TGCCGCACTTGCAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=218.50 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=15.3 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAG criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=25 prefix-density=0.81 prefix-fanout=2.7 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.14 sequence-density-rank=18 fanout-score=147.37 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=21.3 sequence=CGCCGCCGCCGC SRR7804166 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:07:50 Started mapping on | Dec 10 03:07:51 Finished on | Dec 10 03:13:39 Mapping speed, Million of reads per hour | 291.24 Number of input reads | 28152730 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 25875964 Uniquely mapped reads % | 91.91% Average mapped length | 299.83 Number of splices: Total | 23752458 Number of splices: Annotated (sjdb) | 22367298 Number of splices: GT/AG | 23440415 Number of splices: GC/AG | 262782 Number of splices: AT/AC | 14493 Number of splices: Non-canonical | 34768 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.85 Insertion rate per base | 0.01% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 281380 % of reads mapped to multiple loci | 1.00% Number of reads mapped to too many loci | 9346 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.77% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1995386 1995386 1995386 N_multimapping 281380 281380 281380 N_noFeature 517520 25127614 742816 N_ambiguous 603328 3916 80766 UnstrandedReadsAssigned:24755116 PositiveStrandReadsAssigned:744434 NegativeStrandReadsAssigned:25052382 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804166 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804166-trimmed-pair1.fastq SRR7804166-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,152,730 reads, 25,463,083 reads pseudoaligned [quant] estimated average fragment length: 316.215 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52973 SRR7804166.ke.tsv 35125 SRR7804166.se.tsv 88098 total ==> SRR7804166.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 621.441 12.8865 0.978444 PNS24247 1044 728.785 56.5865 3.66364 PNS24249 1928 1612.79 161.878 4.73601 PNS24246 1044 728.785 56.5865 3.66364 PNS24248 1044 728.785 56.5865 3.66364 PNS24244 1471 1155.79 152.476 6.22477 PNS24243 293 73.1708 0 0 KQK14069 1603 1287.79 4355.32 159.579 KQK14071 474 195.901 12.7944 3.08164 ==> SRR7804166.se.tsv <== BRADI_1g14170v3 4352 BRADI_1g53295v3 136 BRADI_1g59795v3 421 BRADI_1g07683v3 0 BRADI_1g00485v3 109 BRADI_1g20270v3 1555 BRADI_1g74790v3 619 BRADI_1g09890v3 42 BRADI_1g77505v3 540 BRADI_1g48960v3 3 SRR7804166 completed mapping pipeline successfully