Starting /dee2/code/volunteer_pipeline.sh SRR7804167 current disk space = 1541156765696 free memory = 1463388248 SRR7804167 SRAfilesize c667422368f5c767c902605c9e1135ba SRR7804167.sra SRR7804167.sra file validated SRR7804167 is paired end SRR7804167 is conventional basespace SRR7804167 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804167_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3055 37.0 37.0 37.0 37.0 37.0 2 36.219 37.0 37.0 37.0 37.0 37.0 3 36.404 37.0 37.0 37.0 37.0 37.0 4 36.4495 37.0 37.0 37.0 37.0 37.0 5 36.5025 37.0 37.0 37.0 37.0 37.0 6 36.5255 37.0 37.0 37.0 37.0 37.0 7 36.394 37.0 37.0 37.0 37.0 37.0 8 36.3835 37.0 37.0 37.0 37.0 37.0 9 36.4555 37.0 37.0 37.0 37.0 37.0 10-14 36.54970000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.4753 37.0 37.0 37.0 37.0 37.0 20-24 36.4816 37.0 37.0 37.0 37.0 37.0 25-29 36.371500000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.4102 37.0 37.0 37.0 37.0 37.0 35-39 36.3366 37.0 37.0 37.0 37.0 37.0 40-44 36.3705 37.0 37.0 37.0 37.0 37.0 45-49 36.2945 37.0 37.0 37.0 37.0 37.0 50-54 36.2377 37.0 37.0 37.0 37.0 37.0 55-59 36.206 37.0 37.0 37.0 37.0 37.0 60-64 36.1588 37.0 37.0 37.0 37.0 37.0 65-69 36.1567 37.0 37.0 37.0 37.0 37.0 70-74 36.077099999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.0375 37.0 37.0 37.0 37.0 37.0 80-84 36.059 37.0 37.0 37.0 37.0 37.0 85-89 35.9559 37.0 37.0 37.0 37.0 37.0 90-94 35.9284 37.0 37.0 37.0 37.0 37.0 95-99 35.804700000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.79430000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.742999999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.76219999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.6518 37.0 37.0 37.0 37.0 37.0 120-124 35.6012 37.0 37.0 37.0 37.0 37.0 125-129 35.4897 37.0 37.0 37.0 37.0 37.0 130-134 35.4359 37.0 37.0 37.0 37.0 37.0 135-139 35.242000000000004 37.0 37.0 37.0 29.8 37.0 140-144 35.2148 37.0 37.0 37.0 29.8 37.0 145-149 35.1182 37.0 37.0 37.0 25.0 37.0 150-151 34.34375 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 0.0 22 1.0 23 0.0 24 3.0 25 2.0 26 5.0 27 9.0 28 24.0 29 29.0 30 36.0 31 51.0 32 81.0 33 107.0 34 198.0 35 497.0 36 2709.0 37 246.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.24987481221833 11.392088132198296 12.769153730595894 42.58888332498748 2 25.174999999999997 16.025 35.5 23.3 3 24.775 23.0 22.85 29.375 4 27.775 30.0 17.474999999999998 24.75 5 27.224999999999998 31.55 20.45 20.775 6 20.125 34.075 23.325000000000003 22.475 7 17.4 20.025000000000002 41.425 21.15 8 22.0 19.45 26.650000000000002 31.900000000000002 9 20.724999999999998 20.1 29.65 29.525000000000002 10-14 23.799999999999997 25.629999999999995 24.015 26.555 15-19 23.830000000000002 24.44 25.2 26.529999999999998 20-24 23.419999999999998 24.975 24.855 26.75 25-29 24.39 24.75 24.27 26.590000000000003 30-34 23.794999999999998 25.319999999999997 24.995 25.89 35-39 24.075 24.945 24.58 26.400000000000002 40-44 23.87 24.665 24.86 26.605 45-49 24.23 24.4 24.84 26.529999999999998 50-54 24.455 24.385 24.075 27.084999999999997 55-59 24.385 24.94 23.7 26.974999999999998 60-64 24.45 24.529999999999998 23.974999999999998 27.045 65-69 24.465 24.154999999999998 24.165 27.215 70-74 24.795 24.035 24.705 26.465 75-79 24.64 25.005 23.805 26.55 80-84 24.474999999999998 24.62 24.46 26.445 85-89 25.0 23.974999999999998 24.0 27.025 90-94 24.805 23.855 24.7 26.640000000000004 95-99 25.055 23.585 23.669999999999998 27.689999999999998 100-104 24.93 24.12 24.095 26.855 105-109 24.48 24.07 24.26 27.189999999999998 110-114 25.074999999999996 23.82 23.77 27.334999999999997 115-119 24.72 23.41 24.825 27.045 120-124 24.95 23.27 23.974999999999998 27.805000000000003 125-129 25.555 24.08 23.880000000000003 26.484999999999996 130-134 25.06 23.585 24.115000000000002 27.24 135-139 25.15 24.035 23.465 27.35 140-144 25.56 23.3 24.224999999999998 26.915 145-149 26.27 23.22 23.98 26.529999999999998 150-151 26.05 24.0 22.95 27.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 0.0 25 1.0 26 2.5 27 3.5 28 4.5 29 3.5 30 4.5 31 13.5 32 16.5 33 16.5 34 23.5 35 32.5 36 43.5 37 54.0 38 75.5 39 93.5 40 101.5 41 121.5 42 130.5 43 140.0 44 162.0 45 174.0 46 170.5 47 160.5 48 168.5 49 173.0 50 166.5 51 155.5 52 142.5 53 135.5 54 131.0 55 117.0 56 107.0 57 104.0 58 96.5 59 90.0 60 79.5 61 69.0 62 60.0 63 58.5 64 62.5 65 71.5 66 66.0 67 53.5 68 48.5 69 44.0 70 36.0 71 31.0 72 37.0 73 34.5 74 29.0 75 22.0 76 15.5 77 15.5 78 10.5 79 6.0 80 5.0 81 2.5 82 1.0 83 1.0 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.75 #Duplication Level Percentage of deduplicated Percentage of total 1 95.74412532637075 91.675 2 4.073107049608355 7.8 3 0.18276762402088773 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0125 0.0 0.0 0.0 0.025 86-87 0.037500000000000006 0.0 0.0 0.0 0.025 88-89 0.075 0.0 0.0 0.0 0.025 90-91 0.075 0.0 0.0 0.0 0.025 92-93 0.075 0.0 0.0 0.0 0.025 94-95 0.075 0.0 0.0 0.0 0.025 96-97 0.075 0.0 0.0 0.0 0.025 98-99 0.1 0.0 0.0 0.0 0.025 100-101 0.125 0.0 0.0 0.0 0.025 102-103 0.175 0.0 0.0 0.0 0.025 104-105 0.175 0.0 0.0 0.0 0.025 106-107 0.1875 0.0 0.0 0.0 0.025 108-109 0.2625 0.0 0.0 0.0 0.025 110-111 0.3125 0.0 0.0 0.0 0.025 112-113 0.3375 0.0 0.0 0.0 0.025 114-115 0.35 0.0 0.0 0.0 0.025 116-117 0.4 0.0 0.0 0.0 0.025 118-119 0.4 0.0 0.0 0.0 0.025 120-121 0.525 0.0 0.0 0.0 0.025 122-123 0.675 0.0 0.0 0.0 0.025 124-125 0.75 0.0 0.0 0.0 0.025 126-127 0.7625 0.0 0.0 0.0 0.025 128-129 0.8374999999999999 0.0 0.0 0.0 0.025 130-131 0.925 0.0 0.0 0.0 0.025 132-133 1.0 0.0 0.0 0.0 0.025 134-135 1.1375000000000002 0.0 0.0 0.0 0.025 136-137 1.3624999999999998 0.0 0.0 0.0 0.025 138-139 1.5375 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAGTCA 10 0.006830828 145.0 8 ATGCAAC 10 0.006830828 145.0 6 >>END_MODULE SRR7804167 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804167_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3145 37.0 37.0 37.0 37.0 37.0 2 36.112 37.0 37.0 37.0 37.0 37.0 3 36.3625 37.0 37.0 37.0 37.0 37.0 4 36.3435 37.0 37.0 37.0 37.0 37.0 5 36.4515 37.0 37.0 37.0 37.0 37.0 6 36.116 37.0 37.0 37.0 37.0 37.0 7 36.1725 37.0 37.0 37.0 37.0 37.0 8 36.328 37.0 37.0 37.0 37.0 37.0 9 36.319 37.0 37.0 37.0 37.0 37.0 10-14 36.2668 37.0 37.0 37.0 37.0 37.0 15-19 36.226299999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.1715 37.0 37.0 37.0 37.0 37.0 25-29 36.13870000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.148900000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.091499999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.05 37.0 37.0 37.0 37.0 37.0 45-49 35.90689999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.934 37.0 37.0 37.0 37.0 37.0 55-59 35.915600000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.802899999999994 37.0 37.0 37.0 37.0 37.0 65-69 35.7231 37.0 37.0 37.0 37.0 37.0 70-74 35.67960000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.6812 37.0 37.0 37.0 37.0 37.0 80-84 35.6164 37.0 37.0 37.0 37.0 37.0 85-89 35.5576 37.0 37.0 37.0 37.0 37.0 90-94 35.547399999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.4336 37.0 37.0 37.0 37.0 37.0 100-104 35.414300000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.345299999999995 37.0 37.0 37.0 34.6 37.0 110-114 35.18560000000001 37.0 37.0 37.0 25.0 37.0 115-119 35.1708 37.0 37.0 37.0 27.4 37.0 120-124 35.0507 37.0 37.0 37.0 25.0 37.0 125-129 34.9895 37.0 37.0 37.0 25.0 37.0 130-134 34.85719999999999 37.0 37.0 37.0 25.0 37.0 135-139 34.6813 37.0 37.0 37.0 25.0 37.0 140-144 34.5622 37.0 37.0 37.0 25.0 37.0 145-149 34.484700000000004 37.0 37.0 37.0 25.0 37.0 150-151 33.72325 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 1.0 16 2.0 17 0.0 18 0.0 19 0.0 20 0.0 21 5.0 22 6.0 23 5.0 24 10.0 25 3.0 26 8.0 27 22.0 28 17.0 29 23.0 30 29.0 31 52.0 32 98.0 33 131.0 34 333.0 35 890.0 36 2260.0 37 102.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.900000000000002 10.525 15.775 41.8 2 27.875 17.625 30.349999999999998 24.15 3 25.374999999999996 22.025 26.150000000000002 26.450000000000003 4 27.375 29.125 16.675 26.825 5 30.525000000000002 30.625000000000004 17.7 21.15 6 22.525000000000002 33.975 18.05 25.45 7 21.2 15.174999999999999 37.0 26.625 8 23.125 20.4 21.075 35.4 9 24.9 19.725 24.75 30.625000000000004 10-14 25.97 25.019999999999996 21.560000000000002 27.450000000000003 15-19 26.375 24.675 22.21 26.740000000000002 20-24 26.179999999999996 23.974999999999998 22.845 27.0 25-29 26.174999999999997 24.39 22.17 27.265 30-34 26.369999999999997 24.11 22.509999999999998 27.01 35-39 26.745 23.965 22.855 26.435 40-44 26.76 23.635 23.05 26.555 45-49 27.55 23.36 22.939999999999998 26.150000000000002 50-54 27.105 23.575 23.395 25.924999999999997 55-59 27.465 23.669999999999998 22.925 25.94 60-64 27.625 23.880000000000003 22.415 26.08 65-69 27.389999999999997 24.4 22.900000000000002 25.31 70-74 27.74 23.26 23.09 25.91 75-79 27.534999999999997 23.369999999999997 22.74 26.355 80-84 27.755000000000003 23.845 22.919999999999998 25.480000000000004 85-89 27.445000000000004 23.89 22.64 26.025 90-94 27.015 24.09 22.965 25.929999999999996 95-99 27.785 24.165 22.31 25.740000000000002 100-104 27.189999999999998 23.71 22.95 26.150000000000002 105-109 27.189999999999998 23.525 23.415 25.869999999999997 110-114 27.625 24.26 22.55 25.564999999999998 115-119 28.02 24.085 22.384999999999998 25.509999999999998 120-124 27.235 24.16 22.705000000000002 25.900000000000002 125-129 28.015 23.669999999999998 23.06 25.255 130-134 27.779999999999998 24.205 22.365 25.650000000000002 135-139 27.450000000000003 24.27 23.115 25.165 140-144 27.74 24.275 23.405 24.58 145-149 27.834999999999997 24.85 22.335 24.98 150-151 28.787499999999998 24.725 22.037499999999998 24.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.0 27 1.0 28 2.0 29 3.5 30 3.5 31 4.5 32 7.5 33 10.0 34 15.0 35 21.0 36 30.0 37 39.0 38 48.5 39 55.0 40 71.5 41 96.0 42 109.5 43 122.0 44 139.0 45 159.0 46 149.5 47 144.0 48 153.0 49 152.0 50 159.0 51 161.0 52 146.5 53 129.5 54 129.0 55 120.5 56 101.0 57 94.5 58 98.0 59 99.5 60 103.0 61 100.5 62 81.0 63 79.5 64 80.0 65 75.5 66 77.0 67 78.0 68 87.5 69 82.0 70 69.5 71 63.5 72 51.0 73 41.0 74 36.0 75 24.0 76 22.0 77 20.5 78 13.0 79 9.5 80 9.0 81 8.5 82 4.0 83 1.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.125 #Duplication Level Percentage of deduplicated Percentage of total 1 95.45335085413929 90.8 2 4.099868593955322 7.8 3 0.39421813403416556 1.125 4 0.026281208935611037 0.1 5 0.0 0.0 6 0.0 0.0 7 0.026281208935611037 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.425 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.7250000000000001 0.0 0.0 0.0 0.0 124-125 0.8 0.0 0.0 0.0 0.0 126-127 0.8125 0.0 0.0 0.0 0.0 128-129 0.8875 0.0 0.0 0.0 0.0 130-131 0.975 0.0 0.0 0.0 0.0 132-133 1.0499999999999998 0.0 0.0 0.0 0.0 134-135 1.1875 0.0 0.0 0.0 0.0 136-137 1.4 0.0 0.0 0.0 0.0 138-139 1.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGCTT 10 0.006830828 145.0 1 ATACAAC 10 0.006830828 145.0 6 >>END_MODULE Read 1414796 spots for SRR7804167.sra Written 1414796 spots for SRR7804167.sra Read 1414796 spots for SRR7804167.sra Written 1414796 spots for SRR7804167.sra Read 1414796 spots for SRR7804167.sra Written 1414796 spots for SRR7804167.sra Read 1414796 spots for SRR7804167.sra Written 1414796 spots for SRR7804167.sra Read 1414796 spots for SRR7804167.sra Written 1414796 spots for SRR7804167.sra Read 1414796 spots for SRR7804167.sra Written 1414796 spots for SRR7804167.sra Read 1414796 spots for SRR7804167.sra Written 1414796 spots for SRR7804167.sra Read 1414796 spots for SRR7804167.sra Written 1414796 spots for SRR7804167.sra Read 1414796 spots for SRR7804167.sra Written 1414796 spots for SRR7804167.sra Read 1414796 spots for SRR7804167.sra Written 1414796 spots for SRR7804167.sra Read 1414796 spots for SRR7804167.sra Written 1414796 spots for SRR7804167.sra Read 1414796 spots for SRR7804167.sra Written 1414796 spots for SRR7804167.sra Read 1414796 spots for SRR7804167.sra Written 1414796 spots for SRR7804167.sra Read 1414796 spots for SRR7804167.sra Written 1414796 spots for SRR7804167.sra Read 1414796 spots for SRR7804167.sra Written 1414796 spots for SRR7804167.sra Read 1414796 spots for SRR7804167.sra Written 1414796 spots for SRR7804167.sra Read 1414796 spots for SRR7804167.sra Written 1414796 spots for SRR7804167.sra Read 1414796 spots for SRR7804167.sra Written 1414796 spots for SRR7804167.sra Read 1414813 spots for SRR7804167.sra Written 1414813 spots for SRR7804167.sra Read 1414796 spots for SRR7804167.sra Written 1414796 spots for SRR7804167.sra SRR ids: ['SRR7804167.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_re8_o7y9 SRR7804167.sra spots: 28295937 blocks: [[1, 1414796], [1414797, 2829592], [2829593, 4244388], [4244389, 5659184], [5659185, 7073980], [7073981, 8488776], [8488777, 9903572], [9903573, 11318368], [11318369, 12733164], [12733165, 14147960], [14147961, 15562756], [15562757, 16977552], [16977553, 18392348], [18392349, 19807144], [19807145, 21221940], [21221941, 22636736], [22636737, 24051532], [24051533, 25466328], [25466329, 26881124], [26881125, 28295937]] SRR7804167 file size 9566864 SRR7804167 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804167 SRR7804167_1.fastq SRR7804167_2.fastq Input file: SRR7804167_1.fastq Paired file: SRR7804167_2.fastq trimmed: SRR7804167-trimmed-pair1.fastq, SRR7804167-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:42:31 2024 >> started Sat Dec 7 17:43:05 2024 >> done (34.219s) 28295937 read pairs processed; of these: 75 ( 0.00%) short read pairs filtered out after trimming by size control 683 ( 0.00%) empty read pairs filtered out after trimming by size control 28295179 (100.00%) read pairs available; of these: 893329 ( 3.16%) trimmed read pairs available after processing 27401850 (96.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 22 0.00% 20 12 0.00% 21 24 0.00% 22 35 0.00% 23 35 0.00% 24 33 0.00% 25 28 0.00% 26 40 0.00% 27 38 0.00% 28 46 0.00% 29 58 0.00% 30 44 0.00% 31 67 0.00% 32 54 0.00% 33 69 0.00% 34 58 0.00% 35 66 0.00% 36 63 0.00% 37 76 0.00% 38 71 0.00% 39 81 0.00% 40 77 0.00% 41 85 0.00% 42 79 0.00% 43 100 0.00% 44 90 0.00% 45 94 0.00% 46 90 0.00% 47 97 0.00% 48 116 0.00% 49 90 0.00% 50 119 0.00% 51 72 0.00% 52 127 0.00% 53 118 0.00% 54 132 0.00% 55 142 0.00% 56 117 0.00% 57 112 0.00% 58 130 0.00% 59 132 0.00% 60 129 0.00% 61 177 0.00% 62 166 0.00% 63 150 0.00% 64 168 0.00% 65 178 0.00% 66 191 0.00% 67 172 0.00% 68 205 0.00% 69 181 0.00% 70 226 0.00% 71 241 0.00% 72 274 0.00% 73 276 0.00% 74 244 0.00% 75 345 0.00% 76 305 0.00% 77 380 0.00% 78 398 0.00% 79 466 0.00% 80 489 0.00% 81 493 0.00% 82 569 0.00% 83 610 0.00% 84 701 0.00% 85 731 0.00% 86 817 0.00% 87 978 0.00% 88 1071 0.00% 89 1131 0.00% 90 1304 0.00% 91 1367 0.00% 92 1504 0.01% 93 1716 0.01% 94 1888 0.01% 95 2135 0.01% 96 2379 0.01% 97 2536 0.01% 98 2631 0.01% 99 2875 0.01% 100 3156 0.01% 101 3429 0.01% 102 3776 0.01% 103 4128 0.01% 104 4366 0.02% 105 4832 0.02% 106 4888 0.02% 107 5247 0.02% 108 5732 0.02% 109 6210 0.02% 110 6755 0.02% 111 7025 0.02% 112 7430 0.03% 113 7960 0.03% 114 8560 0.03% 115 8994 0.03% 116 9578 0.03% 117 9783 0.03% 118 10343 0.04% 119 11123 0.04% 120 11439 0.04% 121 12174 0.04% 122 12791 0.05% 123 13438 0.05% 124 14539 0.05% 125 14746 0.05% 126 15691 0.06% 127 16307 0.06% 128 16842 0.06% 129 17834 0.06% 130 18459 0.07% 131 19229 0.07% 132 19971 0.07% 133 20839 0.07% 134 21670 0.08% 135 22631 0.08% 136 24091 0.09% 137 24172 0.09% 138 25845 0.09% 139 26055 0.09% 140 26903 0.10% 141 28056 0.10% 142 29268 0.10% 143 29672 0.10% 144 31460 0.11% 145 32089 0.11% 146 33555 0.12% 147 34245 0.12% 148 35901 0.13% 149 36369 0.13% 150 37779 0.13% 151 27401850 96.84% 28295179 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.22 fanout-score-rank=27 prefix-density=0.56 prefix-fanout=3.1 sequence=TGCCGCACTTGCAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=26 fanout-score=272.30 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=19.6 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=1.73 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=22 prefix-density=1.86 prefix-fanout=2.8 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.20 sequence-density-rank=13 fanout-score=66.67 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=13.1 sequence=CCGCCGCCGCCGGAGCCGAGAACGGAGGCTGCAAGTG SRR7804167 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:44:09 Started mapping on | Dec 07 17:44:09 Finished on | Dec 07 17:52:16 Mapping speed, Million of reads per hour | 209.16 Number of input reads | 28295179 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 25782357 Uniquely mapped reads % | 91.12% Average mapped length | 299.79 Number of splices: Total | 23221668 Number of splices: Annotated (sjdb) | 21694449 Number of splices: GT/AG | 22914587 Number of splices: GC/AG | 257059 Number of splices: AT/AC | 13767 Number of splices: Non-canonical | 36255 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 318082 % of reads mapped to multiple loci | 1.12% Number of reads mapped to too many loci | 17124 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.15% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2194740 2194740 2194740 N_multimapping 318082 318082 318082 N_noFeature 629338 24896394 1016645 N_ambiguous 586294 4670 88056 UnstrandedReadsAssigned:24566725 PositiveStrandReadsAssigned:881293 NegativeStrandReadsAssigned:24677656 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804167 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804167-trimmed-pair1.fastq SRR7804167-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,295,179 reads, 24,929,836 reads pseudoaligned [quant] estimated average fragment length: 314.247 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52973 SRR7804167.ke.tsv 35125 SRR7804167.se.tsv 88098 total ==> SRR7804167.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 623.493 14.6147 1.05616 PNS24247 1044 730.753 60.7056 3.74307 PNS24249 1928 1614.75 218.68 6.10201 PNS24246 1044 730.753 60.7056 3.74307 PNS24248 1044 730.753 60.7056 3.74307 PNS24244 1471 1157.75 188.589 7.33955 PNS24243 293 74.0464 0 0 KQK14069 1603 1289.75 12810.7 447.545 KQK14071 474 196.471 3.59859 0.825286 ==> SRR7804167.se.tsv <== BRADI_1g14170v3 12840 BRADI_1g53295v3 301 BRADI_1g59795v3 420 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 995 BRADI_1g74790v3 391 BRADI_1g09890v3 0 BRADI_1g77505v3 373 BRADI_1g48960v3 0 SRR7804167 completed mapping pipeline successfully