Starting /dee2/code/volunteer_pipeline.sh SRR7804168 current disk space = 1525459447808 free memory = 1562726764 SRR7804168 SRAfilesize a40441c16255a599265cde2314c04997 SRR7804168.sra SRR7804168.sra file validated SRR7804168 is paired end SRR7804168 is conventional basespace SRR7804168 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804168_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1235 37.0 37.0 37.0 37.0 37.0 2 36.139 37.0 37.0 37.0 37.0 37.0 3 36.39 37.0 37.0 37.0 37.0 37.0 4 36.456 37.0 37.0 37.0 37.0 37.0 5 36.501 37.0 37.0 37.0 37.0 37.0 6 36.527 37.0 37.0 37.0 37.0 37.0 7 36.263 37.0 37.0 37.0 37.0 37.0 8 36.414 37.0 37.0 37.0 37.0 37.0 9 36.319 37.0 37.0 37.0 37.0 37.0 10-14 36.5048 37.0 37.0 37.0 37.0 37.0 15-19 36.4771 37.0 37.0 37.0 37.0 37.0 20-24 36.4938 37.0 37.0 37.0 37.0 37.0 25-29 36.4322 37.0 37.0 37.0 37.0 37.0 30-34 36.416700000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.375099999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.359 37.0 37.0 37.0 37.0 37.0 45-49 36.3076 37.0 37.0 37.0 37.0 37.0 50-54 36.274300000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.1905 37.0 37.0 37.0 37.0 37.0 60-64 36.2223 37.0 37.0 37.0 37.0 37.0 65-69 36.1568 37.0 37.0 37.0 37.0 37.0 70-74 36.114999999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.0799 37.0 37.0 37.0 37.0 37.0 80-84 36.0955 37.0 37.0 37.0 37.0 37.0 85-89 36.089800000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.9787 37.0 37.0 37.0 37.0 37.0 95-99 35.85119999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.8276 37.0 37.0 37.0 37.0 37.0 105-109 35.7716 37.0 37.0 37.0 37.0 37.0 110-114 35.7333 37.0 37.0 37.0 37.0 37.0 115-119 35.7273 37.0 37.0 37.0 37.0 37.0 120-124 35.6059 37.0 37.0 37.0 37.0 37.0 125-129 35.6083 37.0 37.0 37.0 37.0 37.0 130-134 35.4807 37.0 37.0 37.0 37.0 37.0 135-139 35.3294 37.0 37.0 37.0 32.2 37.0 140-144 35.370599999999996 37.0 37.0 37.0 34.6 37.0 145-149 35.12820000000001 37.0 37.0 37.0 27.4 37.0 150-151 34.6845 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 1.0 25 5.0 26 2.0 27 16.0 28 18.0 29 27.0 30 37.0 31 51.0 32 78.0 33 121.0 34 174.0 35 420.0 36 2813.0 37 235.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.3609022556391 10.200501253132831 12.130325814536342 43.30827067669173 2 24.6 16.8 35.575 23.025000000000002 3 23.175 22.225 22.675 31.924999999999997 4 25.4 30.8 18.125 25.674999999999997 5 26.55 31.674999999999997 21.275 20.5 6 19.75 35.175 22.875 22.2 7 16.925 20.724999999999998 40.725 21.625 8 21.65 20.349999999999998 27.950000000000003 30.049999999999997 9 21.9 20.05 30.725 27.325 10-14 23.305 26.889999999999997 24.095 25.71 15-19 22.825 25.955000000000002 25.095 26.125 20-24 23.39 25.285000000000004 25.374999999999996 25.95 25-29 23.185 25.05 25.135 26.63 30-34 23.59 25.27 24.985 26.155 35-39 23.865 25.355 24.82 25.96 40-44 23.555 25.740000000000002 24.4 26.305 45-49 24.15 25.46 23.925 26.465 50-54 23.580000000000002 25.45 24.625 26.345000000000002 55-59 24.01 24.759999999999998 25.06 26.169999999999998 60-64 24.015 25.119999999999997 24.685000000000002 26.179999999999996 65-69 24.25 25.295 24.47 25.985000000000003 70-74 23.990000000000002 24.81 24.5 26.700000000000003 75-79 24.44 24.959999999999997 24.245 26.355 80-84 24.935 24.43 24.759999999999998 25.874999999999996 85-89 24.27 24.985 24.455 26.290000000000003 90-94 24.5 24.55 24.490000000000002 26.46 95-99 24.26 24.104999999999997 24.95 26.685 100-104 24.495 24.795 24.240000000000002 26.47 105-109 24.2 24.2 24.995 26.605 110-114 24.22 24.875 23.945 26.96 115-119 24.565 24.12 24.975 26.340000000000003 120-124 24.490000000000002 24.62 23.945 26.945000000000004 125-129 24.32 24.87 24.235 26.575 130-134 24.610000000000003 24.404999999999998 24.245 26.740000000000002 135-139 24.615000000000002 24.154999999999998 24.57 26.66 140-144 24.88 23.925 24.85 26.345000000000002 145-149 24.67 24.555 24.14 26.634999999999998 150-151 25.4 24.125 23.525 26.950000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.5 27 2.0 28 3.0 29 4.0 30 6.5 31 12.0 32 16.0 33 18.5 34 23.0 35 39.5 36 54.0 37 65.5 38 87.5 39 98.0 40 106.0 41 123.5 42 150.0 43 167.0 44 174.0 45 183.5 46 197.0 47 192.0 48 174.5 49 168.5 50 161.0 51 152.0 52 146.5 53 137.5 54 109.5 55 90.5 56 95.0 57 85.0 58 68.5 59 76.5 60 82.0 61 69.0 62 63.5 63 69.0 64 60.0 65 56.0 66 60.5 67 55.0 68 47.5 69 43.0 70 40.5 71 34.0 72 32.5 73 27.5 74 21.0 75 16.0 76 9.0 77 8.0 78 5.0 79 2.0 80 1.5 81 1.0 82 2.5 83 2.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.075 #Duplication Level Percentage of deduplicated Percentage of total 1 96.07077803799116 92.30000000000001 2 3.7730939370283636 7.249999999999999 3 0.156128024980484 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.07500000000000001 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.4875 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.525 0.0 0.0 0.0 0.0 124-125 0.65 0.0 0.0 0.0 0.0 126-127 0.75 0.0 0.0 0.0 0.0 128-129 0.825 0.0 0.0 0.0 0.0 130-131 0.8374999999999999 0.0 0.0 0.0 0.0 132-133 0.925 0.0 0.0 0.0 0.0 134-135 0.95 0.0 0.0 0.0 0.0 136-137 1.1625 0.0 0.0 0.0 0.0 138-139 1.2000000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCGAGG 10 0.006830828 145.0 6 TCTGCTG 35 0.0033124194 62.14286 7 >>END_MODULE SRR7804168 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804168_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3415 37.0 37.0 37.0 37.0 37.0 2 36.048 37.0 37.0 37.0 37.0 37.0 3 36.2145 37.0 37.0 37.0 37.0 37.0 4 36.2975 37.0 37.0 37.0 37.0 37.0 5 36.3725 37.0 37.0 37.0 37.0 37.0 6 36.2245 37.0 37.0 37.0 37.0 37.0 7 36.2045 37.0 37.0 37.0 37.0 37.0 8 36.345 37.0 37.0 37.0 37.0 37.0 9 36.266 37.0 37.0 37.0 37.0 37.0 10-14 36.268899999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.1931 37.0 37.0 37.0 37.0 37.0 20-24 36.1482 37.0 37.0 37.0 37.0 37.0 25-29 36.1346 37.0 37.0 37.0 37.0 37.0 30-34 36.0814 37.0 37.0 37.0 37.0 37.0 35-39 36.0268 37.0 37.0 37.0 37.0 37.0 40-44 35.9627 37.0 37.0 37.0 37.0 37.0 45-49 35.8721 37.0 37.0 37.0 37.0 37.0 50-54 35.9383 37.0 37.0 37.0 37.0 37.0 55-59 35.8444 37.0 37.0 37.0 37.0 37.0 60-64 35.7278 37.0 37.0 37.0 37.0 37.0 65-69 35.72130000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.693 37.0 37.0 37.0 37.0 37.0 75-79 35.6875 37.0 37.0 37.0 37.0 37.0 80-84 35.5466 37.0 37.0 37.0 37.0 37.0 85-89 35.51970000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.4094 37.0 37.0 37.0 37.0 37.0 95-99 35.3252 37.0 37.0 37.0 37.0 37.0 100-104 35.250099999999996 37.0 37.0 37.0 32.2 37.0 105-109 35.1772 37.0 37.0 37.0 29.8 37.0 110-114 35.0333 37.0 37.0 37.0 25.0 37.0 115-119 34.97840000000001 37.0 37.0 37.0 25.0 37.0 120-124 34.9335 37.0 37.0 37.0 25.0 37.0 125-129 34.8948 37.0 37.0 37.0 25.0 37.0 130-134 34.81 37.0 37.0 37.0 25.0 37.0 135-139 34.583600000000004 37.0 37.0 37.0 25.0 37.0 140-144 34.4764 37.0 37.0 37.0 25.0 37.0 145-149 34.428599999999996 37.0 37.0 37.0 25.0 37.0 150-151 33.713750000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 3.0 15 1.0 16 1.0 17 1.0 18 1.0 19 3.0 20 3.0 21 1.0 22 6.0 23 4.0 24 10.0 25 6.0 26 15.0 27 25.0 28 17.0 29 22.0 30 46.0 31 66.0 32 97.0 33 154.0 34 305.0 35 820.0 36 2311.0 37 81.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.324999999999996 12.375 14.524999999999999 39.775 2 29.275000000000002 18.9 31.424999999999997 20.4 3 24.7 23.525 25.6 26.174999999999997 4 27.474999999999998 29.65 17.625 25.25 5 29.375 30.975 19.225 20.424999999999997 6 22.25 34.050000000000004 19.7 24.0 7 21.125 15.325 37.05 26.5 8 23.225 19.725 22.675 34.375 9 24.375 21.099999999999998 25.474999999999998 29.049999999999997 10-14 25.8 24.735 22.575 26.889999999999997 15-19 25.8 24.52 23.48 26.200000000000003 20-24 25.445 24.66 23.425 26.47 25-29 25.535000000000004 24.41 24.01 26.045 30-34 26.495 23.84 23.44 26.224999999999998 35-39 26.345000000000002 24.12 23.34 26.195 40-44 26.3 23.25 23.76 26.69 45-49 25.965 23.73 24.055 26.25 50-54 26.555 24.03 23.78 25.635 55-59 26.75 23.919999999999998 23.369999999999997 25.96 60-64 25.71 24.34 23.715 26.235000000000003 65-69 26.515 24.26 23.41 25.814999999999998 70-74 27.05 24.245 23.085 25.619999999999997 75-79 26.82 24.565 22.915 25.7 80-84 26.71 24.635 23.25 25.405 85-89 27.155 24.335 23.595 24.915000000000003 90-94 27.12 23.655 23.119999999999997 26.105 95-99 27.339999999999996 24.33 22.785 25.545 100-104 27.13 24.36 23.35 25.16 105-109 26.63 24.955 23.225 25.19 110-114 27.250000000000004 24.235 23.395 25.119999999999997 115-119 27.505000000000003 24.08 23.205000000000002 25.21 120-124 26.97 24.565 23.494999999999997 24.97 125-129 27.425 24.635 23.119999999999997 24.82 130-134 27.750000000000004 24.695 23.225 24.33 135-139 26.93 24.395 23.84 24.834999999999997 140-144 27.21 24.67 23.09 25.03 145-149 27.655 24.355 23.39 24.6 150-151 27.6625 24.4 23.65 24.2875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 0.0 27 1.5 28 3.0 29 2.5 30 6.0 31 9.5 32 12.0 33 14.5 34 21.0 35 29.0 36 33.0 37 47.5 38 67.0 39 76.0 40 94.5 41 114.5 42 122.0 43 123.5 44 139.0 45 161.0 46 160.0 47 165.5 48 171.5 49 148.0 50 152.5 51 152.0 52 122.5 53 118.5 54 121.0 55 117.0 56 102.0 57 95.0 58 97.0 59 86.0 60 77.0 61 89.0 62 99.0 63 89.0 64 84.0 65 79.5 66 64.5 67 61.5 68 67.5 69 70.0 70 61.5 71 50.0 72 45.5 73 38.0 74 34.5 75 29.0 76 21.0 77 16.0 78 10.5 79 7.0 80 3.0 81 2.5 82 2.0 83 4.0 84 3.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.65 #Duplication Level Percentage of deduplicated Percentage of total 1 95.71353894406691 91.55 2 4.025091479351803 7.7 3 0.26136957658128596 0.75 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.525 0.0 0.0 0.0 0.0 124-125 0.6625 0.0 0.0 0.0 0.0 126-127 0.8 0.0 0.0 0.0 0.0 128-129 0.875 0.0 0.0 0.0 0.0 130-131 0.8875 0.0 0.0 0.0 0.0 132-133 0.975 0.0 0.0 0.0 0.0 134-135 1.0 0.0 0.0 0.0 0.0 136-137 1.2125 0.0 0.0 0.0 0.0 138-139 1.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCACGC 10 0.006830828 145.0 1 >>END_MODULE Read 1743174 spots for SRR7804168.sra Written 1743174 spots for SRR7804168.sra Read 1743174 spots for SRR7804168.sra Written 1743174 spots for SRR7804168.sra Read 1743174 spots for SRR7804168.sra Written 1743174 spots for SRR7804168.sra Read 1743174 spots for SRR7804168.sra Written 1743174 spots for SRR7804168.sra Read 1743174 spots for SRR7804168.sra Written 1743174 spots for SRR7804168.sra Read 1743174 spots for SRR7804168.sra Written 1743174 spots for SRR7804168.sra Read 1743174 spots for SRR7804168.sra Written 1743174 spots for SRR7804168.sra Read 1743174 spots for SRR7804168.sra Written 1743174 spots for SRR7804168.sra Read 1743174 spots for SRR7804168.sra Written 1743174 spots for SRR7804168.sra Read 1743191 spots for SRR7804168.sra Written 1743191 spots for SRR7804168.sra Read 1743174 spots for SRR7804168.sra Written 1743174 spots for SRR7804168.sra Read 1743174 spots for SRR7804168.sra Written 1743174 spots for SRR7804168.sra Read 1743174 spots for SRR7804168.sra Written 1743174 spots for SRR7804168.sra Read 1743174 spots for SRR7804168.sra Written 1743174 spots for SRR7804168.sra Read 1743174 spots for SRR7804168.sra Written 1743174 spots for SRR7804168.sra Read 1743174 spots for SRR7804168.sra Written 1743174 spots for SRR7804168.sra Read 1743174 spots for SRR7804168.sra Written 1743174 spots for SRR7804168.sra Read 1743174 spots for SRR7804168.sra Written 1743174 spots for SRR7804168.sra Read 1743174 spots for SRR7804168.sra Written 1743174 spots for SRR7804168.sra Read 1743174 spots for SRR7804168.sra Written 1743174 spots for SRR7804168.sra SRR ids: ['SRR7804168.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2o7_60gm SRR7804168.sra spots: 34863497 blocks: [[1, 1743174], [1743175, 3486348], [3486349, 5229522], [5229523, 6972696], [6972697, 8715870], [8715871, 10459044], [10459045, 12202218], [12202219, 13945392], [13945393, 15688566], [15688567, 17431740], [17431741, 19174914], [19174915, 20918088], [20918089, 22661262], [22661263, 24404436], [24404437, 26147610], [26147611, 27890784], [27890785, 29633958], [29633959, 31377132], [31377133, 33120306], [33120307, 34863497]] SRR7804168 file size 11792394 SRR7804168 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804168 SRR7804168_1.fastq SRR7804168_2.fastq Input file: SRR7804168_1.fastq Paired file: SRR7804168_2.fastq trimmed: SRR7804168-trimmed-pair1.fastq, SRR7804168-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:11:24 2024 >> started Tue Dec 10 03:12:06 2024 >> done (42.633s) 34863497 read pairs processed; of these: 76 ( 0.00%) short read pairs filtered out after trimming by size control 493 ( 0.00%) empty read pairs filtered out after trimming by size control 34862928 (100.00%) read pairs available; of these: 839879 ( 2.41%) trimmed read pairs available after processing 34023049 (97.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 17 0.00% 20 19 0.00% 21 18 0.00% 22 32 0.00% 23 35 0.00% 24 29 0.00% 25 36 0.00% 26 33 0.00% 27 42 0.00% 28 41 0.00% 29 51 0.00% 30 45 0.00% 31 68 0.00% 32 60 0.00% 33 59 0.00% 34 59 0.00% 35 78 0.00% 36 54 0.00% 37 79 0.00% 38 73 0.00% 39 66 0.00% 40 71 0.00% 41 77 0.00% 42 79 0.00% 43 73 0.00% 44 87 0.00% 45 97 0.00% 46 96 0.00% 47 108 0.00% 48 85 0.00% 49 85 0.00% 50 101 0.00% 51 98 0.00% 52 112 0.00% 53 101 0.00% 54 143 0.00% 55 119 0.00% 56 118 0.00% 57 131 0.00% 58 115 0.00% 59 116 0.00% 60 134 0.00% 61 147 0.00% 62 136 0.00% 63 169 0.00% 64 161 0.00% 65 177 0.00% 66 174 0.00% 67 150 0.00% 68 196 0.00% 69 206 0.00% 70 213 0.00% 71 237 0.00% 72 229 0.00% 73 319 0.00% 74 287 0.00% 75 335 0.00% 76 319 0.00% 77 390 0.00% 78 417 0.00% 79 505 0.00% 80 521 0.00% 81 563 0.00% 82 554 0.00% 83 656 0.00% 84 766 0.00% 85 831 0.00% 86 1005 0.00% 87 1016 0.00% 88 1194 0.00% 89 1229 0.00% 90 1354 0.00% 91 1407 0.00% 92 1633 0.00% 93 1810 0.01% 94 2017 0.01% 95 2153 0.01% 96 2408 0.01% 97 2561 0.01% 98 2731 0.01% 99 2947 0.01% 100 3192 0.01% 101 3503 0.01% 102 3789 0.01% 103 3988 0.01% 104 4402 0.01% 105 4782 0.01% 106 4969 0.01% 107 5198 0.01% 108 5486 0.02% 109 5883 0.02% 110 6243 0.02% 111 6613 0.02% 112 7132 0.02% 113 7552 0.02% 114 7865 0.02% 115 8501 0.02% 116 8909 0.03% 117 9357 0.03% 118 9740 0.03% 119 10214 0.03% 120 10527 0.03% 121 11269 0.03% 122 11875 0.03% 123 12511 0.04% 124 13235 0.04% 125 13875 0.04% 126 14408 0.04% 127 14850 0.04% 128 15633 0.04% 129 16177 0.05% 130 16827 0.05% 131 17659 0.05% 132 18300 0.05% 133 19311 0.06% 134 20060 0.06% 135 21018 0.06% 136 22141 0.06% 137 22759 0.07% 138 23681 0.07% 139 24399 0.07% 140 25004 0.07% 141 26093 0.07% 142 27029 0.08% 143 27906 0.08% 144 29517 0.08% 145 30426 0.09% 146 31195 0.09% 147 32802 0.09% 148 33746 0.10% 149 34609 0.10% 150 36443 0.10% 151 34023049 97.59% 34862928 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=34 prefix-density=0.41 prefix-fanout=2.0 sequence=TAAGGGTTTGCGACCCCGCGCGATC criterion=fanout-score sequence-density=0.06 sequence-density-rank=22 fanout-score=146.15 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=20.8 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=28 prefix-density=0.70 prefix-fanout=2.3 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=826.03 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=23.1 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR7804168 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:13:06 Started mapping on | Dec 10 03:13:06 Finished on | Dec 10 03:20:31 Mapping speed, Million of reads per hour | 282.04 Number of input reads | 34862928 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 32594166 Uniquely mapped reads % | 93.49% Average mapped length | 300.00 Number of splices: Total | 31977071 Number of splices: Annotated (sjdb) | 29788283 Number of splices: GT/AG | 31547090 Number of splices: GC/AG | 358468 Number of splices: AT/AC | 22570 Number of splices: Non-canonical | 48943 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.83 Insertion rate per base | 0.01% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 404043 % of reads mapped to multiple loci | 1.16% Number of reads mapped to too many loci | 13735 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.99% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1864719 1864719 1864719 N_multimapping 404043 404043 404043 N_noFeature 926838 31334212 1544738 N_ambiguous 765958 6600 122893 UnstrandedReadsAssigned:30901370 PositiveStrandReadsAssigned:1253354 NegativeStrandReadsAssigned:30926535 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804168 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804168-trimmed-pair1.fastq SRR7804168-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,862,928 reads, 31,228,825 reads pseudoaligned [quant] estimated average fragment length: 332.964 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,290 rounds 52973 SRR7804168.ke.tsv 35125 SRR7804168.se.tsv 88098 total ==> SRR7804168.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 605.249 0 0 PNS24247 1044 712.036 96.9278 5.60502 PNS24249 1928 1596.04 344.877 8.89719 PNS24246 1044 712.036 96.9278 5.60502 PNS24248 1044 712.036 96.9278 5.60502 PNS24244 1471 1139.04 156.339 5.65146 PNS24243 293 71.0897 5 2.89597 KQK14069 1603 1271.04 15927.6 515.968 KQK14071 474 189.472 90.7355 19.718 ==> SRR7804168.se.tsv <== BRADI_1g14170v3 16474 BRADI_1g53295v3 359 BRADI_1g59795v3 772 BRADI_1g07683v3 0 BRADI_1g00485v3 70 BRADI_1g20270v3 901 BRADI_1g74790v3 347 BRADI_1g09890v3 0 BRADI_1g77505v3 412 BRADI_1g48960v3 0 SRR7804168 completed mapping pipeline successfully