Starting /dee2/code/volunteer_pipeline.sh SRR7804169 current disk space = 1525449666560 free memory = 1494252948 SRR7804169 SRAfilesize 95a952bafb68b366f1c8f6654ae275de SRR7804169.sra SRR7804169.sra file validated SRR7804169 is paired end SRR7804169 is conventional basespace SRR7804169 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804169_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.347 37.0 37.0 37.0 37.0 37.0 2 36.2435 37.0 37.0 37.0 37.0 37.0 3 36.3775 37.0 37.0 37.0 37.0 37.0 4 36.4305 37.0 37.0 37.0 37.0 37.0 5 36.53 37.0 37.0 37.0 37.0 37.0 6 36.419 37.0 37.0 37.0 37.0 37.0 7 36.2725 37.0 37.0 37.0 37.0 37.0 8 36.5205 37.0 37.0 37.0 37.0 37.0 9 36.372 37.0 37.0 37.0 37.0 37.0 10-14 36.519099999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.4928 37.0 37.0 37.0 37.0 37.0 20-24 36.4856 37.0 37.0 37.0 37.0 37.0 25-29 36.4274 37.0 37.0 37.0 37.0 37.0 30-34 36.428 37.0 37.0 37.0 37.0 37.0 35-39 36.366200000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.30310000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.2816 37.0 37.0 37.0 37.0 37.0 50-54 36.231700000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.202999999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.1995 37.0 37.0 37.0 37.0 37.0 65-69 36.160000000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.0833 37.0 37.0 37.0 37.0 37.0 75-79 36.0796 37.0 37.0 37.0 37.0 37.0 80-84 36.041700000000006 37.0 37.0 37.0 37.0 37.0 85-89 35.97619999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.9222 37.0 37.0 37.0 37.0 37.0 95-99 35.846500000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.791199999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.7675 37.0 37.0 37.0 37.0 37.0 110-114 35.778000000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.6652 37.0 37.0 37.0 37.0 37.0 120-124 35.5489 37.0 37.0 37.0 37.0 37.0 125-129 35.5795 37.0 37.0 37.0 37.0 37.0 130-134 35.4065 37.0 37.0 37.0 37.0 37.0 135-139 35.3251 37.0 37.0 37.0 37.0 37.0 140-144 35.270500000000006 37.0 37.0 37.0 32.2 37.0 145-149 35.1315 37.0 37.0 37.0 27.4 37.0 150-151 34.485749999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 3.0 25 2.0 26 10.0 27 17.0 28 13.0 29 26.0 30 39.0 31 61.0 32 67.0 33 105.0 34 195.0 35 441.0 36 2782.0 37 236.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.46069103655483 12.093139709564346 9.564346519779669 37.88182273410115 2 25.650000000000002 17.875 35.199999999999996 21.275 3 23.075000000000003 23.925 22.525000000000002 30.475 4 28.425 29.725 18.3 23.549999999999997 5 25.8 31.6 22.475 20.125 6 22.45 31.874999999999996 22.625 23.05 7 18.575 18.8 40.400000000000006 22.225 8 21.6 20.075000000000003 25.424999999999997 32.9 9 21.2 18.925 30.225 29.65 10-14 24.305 25.650000000000002 23.565 26.479999999999997 15-19 25.06 24.115000000000002 24.385 26.44 20-24 25.055 24.5 24.044999999999998 26.400000000000002 25-29 24.595 24.395 24.2 26.810000000000002 30-34 24.38 24.11 24.66 26.85 35-39 24.115000000000002 24.349999999999998 24.14 27.395000000000003 40-44 24.779999999999998 23.95 24.51 26.76 45-49 24.560000000000002 23.86 24.015 27.565 50-54 24.615000000000002 24.18 24.425 26.779999999999998 55-59 24.709999999999997 24.3 23.9 27.089999999999996 60-64 25.105 24.46 23.91 26.525 65-69 25.395 23.275000000000002 24.099999999999998 27.229999999999997 70-74 25.490000000000002 24.169999999999998 23.535 26.805 75-79 25.405 23.755000000000003 23.169999999999998 27.67 80-84 25.115 23.51 23.985 27.389999999999997 85-89 25.05 24.085 23.52 27.345000000000002 90-94 25.16 23.7 23.995 27.145000000000003 95-99 26.115 23.43 23.305 27.150000000000002 100-104 26.035000000000004 23.810000000000002 23.46 26.695 105-109 25.319999999999997 23.335 24.310000000000002 27.034999999999997 110-114 26.195 23.325000000000003 23.635 26.845000000000002 115-119 26.05 23.185 23.455000000000002 27.310000000000002 120-124 25.900000000000002 23.36 23.375 27.365000000000002 125-129 26.105 23.705000000000002 23.225 26.965 130-134 26.155 22.86 23.93 27.055 135-139 25.905 22.89 23.65 27.555000000000003 140-144 26.595000000000002 22.685 23.39 27.33 145-149 26.165 22.665 23.43 27.74 150-151 27.037499999999998 22.6 22.95 27.4125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 0.5 26 0.5 27 1.0 28 1.5 29 4.5 30 6.5 31 9.0 32 10.0 33 15.0 34 25.0 35 31.5 36 35.5 37 56.0 38 83.0 39 88.0 40 91.0 41 112.5 42 126.0 43 135.5 44 145.0 45 157.5 46 165.5 47 160.0 48 166.5 49 150.5 50 131.5 51 134.5 52 141.5 53 135.5 54 117.5 55 104.5 56 94.0 57 93.5 58 93.5 59 94.0 60 90.5 61 93.5 62 96.0 63 89.0 64 98.5 65 96.5 66 75.5 67 66.5 68 64.0 69 63.0 70 54.0 71 41.0 72 36.0 73 30.5 74 24.0 75 17.0 76 12.5 77 10.5 78 8.5 79 5.0 80 3.5 81 2.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.35 #Duplication Level Percentage of deduplicated Percentage of total 1 94.48860625331214 89.14999999999999 2 5.113937466878643 9.65 3 0.3179650238473768 0.8999999999999999 4 0.0794912559618442 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.7250000000000001 0.0 0.0 0.0 0.0 126-127 0.825 0.0 0.0 0.0 0.0 128-129 1.0125 0.0 0.0 0.0 0.0 130-131 1.1124999999999998 0.0 0.0 0.0 0.0 132-133 1.1875 0.0 0.0 0.0 0.0 134-135 1.3375 0.0 0.0 0.0 0.0 136-137 1.4874999999999998 0.0 0.0 0.0 0.0 138-139 1.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGTAGC 10 0.006830828 145.0 1 >>END_MODULE SRR7804169 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804169_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.408 37.0 37.0 37.0 37.0 37.0 2 36.136 37.0 37.0 37.0 37.0 37.0 3 36.2165 37.0 37.0 37.0 37.0 37.0 4 36.2945 37.0 37.0 37.0 37.0 37.0 5 36.2465 37.0 37.0 37.0 37.0 37.0 6 36.0565 37.0 37.0 37.0 37.0 37.0 7 36.171 37.0 37.0 37.0 37.0 37.0 8 36.3185 37.0 37.0 37.0 37.0 37.0 9 36.2635 37.0 37.0 37.0 37.0 37.0 10-14 36.1864 37.0 37.0 37.0 37.0 37.0 15-19 36.2153 37.0 37.0 37.0 37.0 37.0 20-24 36.135099999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.1183 37.0 37.0 37.0 37.0 37.0 30-34 36.040400000000005 37.0 37.0 37.0 37.0 37.0 35-39 35.9688 37.0 37.0 37.0 37.0 37.0 40-44 35.9791 37.0 37.0 37.0 37.0 37.0 45-49 35.8644 37.0 37.0 37.0 37.0 37.0 50-54 35.9048 37.0 37.0 37.0 37.0 37.0 55-59 35.80970000000001 37.0 37.0 37.0 37.0 37.0 60-64 35.78189999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.739 37.0 37.0 37.0 37.0 37.0 70-74 35.6264 37.0 37.0 37.0 37.0 37.0 75-79 35.665 37.0 37.0 37.0 37.0 37.0 80-84 35.578500000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.4979 37.0 37.0 37.0 37.0 37.0 90-94 35.4271 37.0 37.0 37.0 37.0 37.0 95-99 35.3283 37.0 37.0 37.0 34.6 37.0 100-104 35.2814 37.0 37.0 37.0 34.6 37.0 105-109 35.259100000000004 37.0 37.0 37.0 29.8 37.0 110-114 35.0244 37.0 37.0 37.0 25.0 37.0 115-119 34.9952 37.0 37.0 37.0 25.0 37.0 120-124 34.952200000000005 37.0 37.0 37.0 25.0 37.0 125-129 34.941599999999994 37.0 37.0 37.0 25.0 37.0 130-134 34.7825 37.0 37.0 37.0 25.0 37.0 135-139 34.6124 37.0 37.0 37.0 25.0 37.0 140-144 34.423899999999996 37.0 37.0 37.0 25.0 37.0 145-149 34.3755 37.0 37.0 37.0 25.0 37.0 150-151 33.6335 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 0.0 15 2.0 16 3.0 17 0.0 18 0.0 19 5.0 20 3.0 21 5.0 22 5.0 23 6.0 24 10.0 25 10.0 26 9.0 27 19.0 28 21.0 29 24.0 30 42.0 31 65.0 32 77.0 33 170.0 34 289.0 35 825.0 36 2334.0 37 73.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.75 13.025 11.3 37.925 2 29.375 19.625 28.299999999999997 22.7 3 25.575 22.125 24.975 27.325 4 28.4 30.099999999999998 15.9 25.6 5 27.675 31.75 18.075 22.5 6 23.75 32.425 17.775 26.05 7 22.725 14.899999999999999 35.475 26.900000000000002 8 24.224999999999998 19.45 21.25 35.075 9 24.275 19.950000000000003 24.2 31.574999999999996 10-14 26.39 24.41 21.335 27.865000000000002 15-19 26.735 23.605 22.015 27.644999999999996 20-24 27.305 23.555 21.825 27.315 25-29 27.255000000000003 23.46 21.9 27.384999999999998 30-34 27.115000000000002 23.28 22.2 27.405 35-39 27.24 23.715 21.745 27.3 40-44 26.86 23.54 22.2 27.400000000000002 45-49 27.365000000000002 23.115 22.235 27.284999999999997 50-54 26.77 22.905 22.23 28.095 55-59 27.01 23.415 21.85 27.725 60-64 27.08 22.43 22.455 28.035 65-69 27.034999999999997 23.165 21.65 28.15 70-74 27.224999999999998 23.18 21.86 27.735 75-79 27.62 22.71 22.38 27.29 80-84 27.47 22.975 22.45 27.105 85-89 27.79 22.865 21.965 27.38 90-94 27.694999999999997 22.405 22.435 27.465 95-99 27.79 23.035 22.134999999999998 27.04 100-104 27.435 22.725 22.64 27.200000000000003 105-109 27.950000000000003 23.25 21.805 26.995 110-114 27.450000000000003 23.005 22.225 27.32 115-119 28.27 23.435 21.3 26.995 120-124 27.615000000000002 23.445 21.515 27.425 125-129 27.965 23.830000000000002 22.235 25.97 130-134 27.88 23.75 21.66 26.71 135-139 28.470000000000002 23.65 21.735 26.145000000000003 140-144 28.194999999999997 23.919999999999998 21.759999999999998 26.125 145-149 28.04 23.815 21.63 26.515 150-151 28.7 23.575 21.85 25.874999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 1.5 21 0.5 22 0.0 23 0.5 24 0.5 25 1.0 26 1.5 27 3.5 28 4.5 29 1.5 30 1.5 31 4.5 32 6.5 33 7.0 34 8.5 35 13.5 36 24.5 37 32.0 38 39.0 39 52.5 40 73.5 41 87.0 42 100.5 43 117.5 44 131.5 45 148.0 46 141.0 47 132.0 48 133.0 49 113.0 50 111.0 51 133.5 52 134.5 53 116.5 54 105.5 55 99.5 56 97.0 57 108.5 58 108.0 59 106.0 60 110.5 61 110.5 62 121.5 63 116.5 64 110.0 65 111.0 66 95.0 67 95.5 68 99.0 69 90.0 70 79.0 71 69.5 72 62.0 73 54.0 74 48.5 75 37.0 76 26.0 77 18.5 78 13.0 79 8.5 80 5.0 81 4.0 82 1.5 83 0.5 84 1.5 85 2.0 86 1.5 87 1.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.075 #Duplication Level Percentage of deduplicated Percentage of total 1 94.31304809992027 88.725 2 5.208610151474887 9.8 3 0.3720435822482062 1.05 4 0.07972362476747276 0.3 5 0.026574541589157584 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGGGACTACCCGCTGAGTTTAAGCATATAAATAAGCGGAGGAGAAGAAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.30000000000000004 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.6375 0.0 0.0 0.0 0.0 124-125 0.7250000000000001 0.0 0.0 0.0 0.0 126-127 0.825 0.0 0.0 0.0 0.0 128-129 1.0125 0.0 0.0 0.0 0.0 130-131 1.1124999999999998 0.0 0.0 0.0 0.0 132-133 1.1875 0.0 0.0 0.0 0.0 134-135 1.3375 0.0 0.0 0.0 0.0 136-137 1.4874999999999998 0.0 0.0 0.0 0.0 138-139 1.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAACAC 10 0.006830828 145.0 3 TGTATGA 10 0.006830828 145.0 5 >>END_MODULE Read 1606798 spots for SRR7804169.sra Written 1606798 spots for SRR7804169.sra Read 1606798 spots for SRR7804169.sra Written 1606798 spots for SRR7804169.sra Read 1606798 spots for SRR7804169.sra Written 1606798 spots for SRR7804169.sra Read 1606798 spots for SRR7804169.sra Written 1606798 spots for SRR7804169.sra Read 1606798 spots for SRR7804169.sra Written 1606798 spots for SRR7804169.sra Read 1606798 spots for SRR7804169.sra Written 1606798 spots for SRR7804169.sra Read 1606798 spots for SRR7804169.sra Written 1606798 spots for SRR7804169.sra Read 1606808 spots for SRR7804169.sra Written 1606808 spots for SRR7804169.sra Read 1606798 spots for SRR7804169.sra Written 1606798 spots for SRR7804169.sra Read 1606798 spots for SRR7804169.sra Written 1606798 spots for SRR7804169.sra Read 1606798 spots for SRR7804169.sra Written 1606798 spots for SRR7804169.sra Read 1606798 spots for SRR7804169.sra Written 1606798 spots for SRR7804169.sra Read 1606798 spots for SRR7804169.sra Written 1606798 spots for SRR7804169.sra Read 1606798 spots for SRR7804169.sra Written 1606798 spots for SRR7804169.sra Read 1606798 spots for SRR7804169.sra Written 1606798 spots for SRR7804169.sra Read 1606798 spots for SRR7804169.sra Written 1606798 spots for SRR7804169.sra Read 1606798 spots for SRR7804169.sra Written 1606798 spots for SRR7804169.sra Read 1606798 spots for SRR7804169.sra Written 1606798 spots for SRR7804169.sra Read 1606798 spots for SRR7804169.sra Written 1606798 spots for SRR7804169.sra Read 1606798 spots for SRR7804169.sra Written 1606798 spots for SRR7804169.sra SRR ids: ['SRR7804169.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ydvrzw0x SRR7804169.sra spots: 32135970 blocks: [[1, 1606798], [1606799, 3213596], [3213597, 4820394], [4820395, 6427192], [6427193, 8033990], [8033991, 9640788], [9640789, 11247586], [11247587, 12854384], [12854385, 14461182], [14461183, 16067980], [16067981, 17674778], [17674779, 19281576], [19281577, 20888374], [20888375, 22495172], [22495173, 24101970], [24101971, 25708768], [25708769, 27315566], [27315567, 28922364], [28922365, 30529162], [30529163, 32135970]] SRR7804169 file size 10868125 SRR7804169 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804169 SRR7804169_1.fastq SRR7804169_2.fastq Input file: SRR7804169_1.fastq Paired file: SRR7804169_2.fastq trimmed: SRR7804169-trimmed-pair1.fastq, SRR7804169-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:12:01 2024 >> started Tue Dec 10 03:12:52 2024 >> done (51.273s) 32135970 read pairs processed; of these: 96 ( 0.00%) short read pairs filtered out after trimming by size control 576 ( 0.00%) empty read pairs filtered out after trimming by size control 32135298 (100.00%) read pairs available; of these: 823167 ( 2.56%) trimmed read pairs available after processing 31312131 (97.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 10 0.00% 20 19 0.00% 21 20 0.00% 22 25 0.00% 23 23 0.00% 24 20 0.00% 25 29 0.00% 26 30 0.00% 27 29 0.00% 28 39 0.00% 29 35 0.00% 30 24 0.00% 31 33 0.00% 32 37 0.00% 33 43 0.00% 34 31 0.00% 35 60 0.00% 36 41 0.00% 37 56 0.00% 38 51 0.00% 39 59 0.00% 40 38 0.00% 41 36 0.00% 42 53 0.00% 43 54 0.00% 44 46 0.00% 45 54 0.00% 46 56 0.00% 47 65 0.00% 48 55 0.00% 49 64 0.00% 50 55 0.00% 51 78 0.00% 52 70 0.00% 53 79 0.00% 54 97 0.00% 55 81 0.00% 56 58 0.00% 57 78 0.00% 58 85 0.00% 59 88 0.00% 60 105 0.00% 61 93 0.00% 62 108 0.00% 63 116 0.00% 64 98 0.00% 65 112 0.00% 66 103 0.00% 67 137 0.00% 68 147 0.00% 69 144 0.00% 70 138 0.00% 71 167 0.00% 72 170 0.00% 73 207 0.00% 74 198 0.00% 75 205 0.00% 76 199 0.00% 77 251 0.00% 78 272 0.00% 79 279 0.00% 80 347 0.00% 81 353 0.00% 82 415 0.00% 83 524 0.00% 84 472 0.00% 85 584 0.00% 86 631 0.00% 87 665 0.00% 88 762 0.00% 89 857 0.00% 90 901 0.00% 91 1087 0.00% 92 1221 0.00% 93 1311 0.00% 94 1538 0.00% 95 1617 0.01% 96 1784 0.01% 97 1911 0.01% 98 2116 0.01% 99 2229 0.01% 100 2444 0.01% 101 2803 0.01% 102 3091 0.01% 103 3418 0.01% 104 3710 0.01% 105 4116 0.01% 106 4417 0.01% 107 4486 0.01% 108 4888 0.02% 109 5063 0.02% 110 5415 0.02% 111 5856 0.02% 112 6534 0.02% 113 6903 0.02% 114 7706 0.02% 115 8214 0.03% 116 8431 0.03% 117 8897 0.03% 118 9150 0.03% 119 9437 0.03% 120 9916 0.03% 121 10468 0.03% 122 11348 0.04% 123 12041 0.04% 124 13341 0.04% 125 14008 0.04% 126 14877 0.05% 127 15096 0.05% 128 15413 0.05% 129 15968 0.05% 130 16457 0.05% 131 17294 0.05% 132 18108 0.06% 133 19589 0.06% 134 20638 0.06% 135 21985 0.07% 136 22556 0.07% 137 23325 0.07% 138 24072 0.07% 139 24599 0.08% 140 25250 0.08% 141 25878 0.08% 142 27171 0.08% 143 27853 0.09% 144 29788 0.09% 145 31841 0.10% 146 32850 0.10% 147 33889 0.11% 148 35073 0.11% 149 34897 0.11% 150 36010 0.11% 151 31312131 97.44% 32135298 reads passed initial QC criterion=sequence-density sequence-density=1.05 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=24 prefix-density=1.09 prefix-fanout=2.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.13 sequence-density-rank=29 fanout-score=18.89 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=4.3 sequence=TTCTTGGCGAACGTCTCTGGGTCAGCTGACAACCCCGCGGTGTCCCAGCCGTAGTCACCGGGGAACTCGCCGGTCAGGTA criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=15 prefix-density=0.97 prefix-fanout=2.9 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCAGGCAGCCCGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=132.40 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=6.9 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR7804169 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:14:02 Started mapping on | Dec 10 03:14:02 Finished on | Dec 10 03:19:24 Mapping speed, Million of reads per hour | 359.28 Number of input reads | 32135298 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 30134545 Uniquely mapped reads % | 93.77% Average mapped length | 300.11 Number of splices: Total | 30945855 Number of splices: Annotated (sjdb) | 29334769 Number of splices: GT/AG | 30533493 Number of splices: GC/AG | 363687 Number of splices: AT/AC | 12596 Number of splices: Non-canonical | 36079 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.53 Insertion rate per base | 0.01% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 331741 % of reads mapped to multiple loci | 1.03% Number of reads mapped to too many loci | 29638 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.39% % of reads unmapped: other | 0.71% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1669012 1669012 1669012 N_multimapping 331741 331741 331741 N_noFeature 681678 29253843 874890 N_ambiguous 837023 4256 150812 UnstrandedReadsAssigned:28615844 PositiveStrandReadsAssigned:876446 NegativeStrandReadsAssigned:29108843 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804169 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804169-trimmed-pair1.fastq SRR7804169-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,135,298 reads, 29,345,570 reads pseudoaligned [quant] estimated average fragment length: 325.484 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,139 rounds 52973 SRR7804169.ke.tsv 35125 SRR7804169.se.tsv 88098 total ==> SRR7804169.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 612.447 0 0 PNS24247 1044 719.516 58.1916 3.29253 PNS24249 1928 1603.52 197.299 5.00912 PNS24246 1044 719.516 58.1916 3.29253 PNS24248 1044 719.516 58.1916 3.29253 PNS24244 1471 1146.52 99.1262 3.5198 PNS24243 293 71.8649 0 0 KQK14069 1603 1278.52 398.691 12.6952 KQK14071 474 192.26 9.74715 2.06395 ==> SRR7804169.se.tsv <== BRADI_1g14170v3 430 BRADI_1g53295v3 314 BRADI_1g59795v3 732 BRADI_1g07683v3 0 BRADI_1g00485v3 44 BRADI_1g20270v3 3907 BRADI_1g74790v3 251 BRADI_1g09890v3 15 BRADI_1g77505v3 385 BRADI_1g48960v3 1 SRR7804169 completed mapping pipeline successfully