Starting /dee2/code/volunteer_pipeline.sh SRR7804170 current disk space = 1525981495296 free memory = 1558801572 SRR7804170 SRAfilesize f2e9b6fedc396a5703bab7194183c90b SRR7804170.sra SRR7804170.sra file validated SRR7804170 is paired end SRR7804170 is conventional basespace SRR7804170 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804170_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1605 37.0 37.0 37.0 37.0 37.0 2 36.1985 37.0 37.0 37.0 37.0 37.0 3 36.431 37.0 37.0 37.0 37.0 37.0 4 36.498 37.0 37.0 37.0 37.0 37.0 5 36.4455 37.0 37.0 37.0 37.0 37.0 6 36.5195 37.0 37.0 37.0 37.0 37.0 7 36.2475 37.0 37.0 37.0 37.0 37.0 8 36.5035 37.0 37.0 37.0 37.0 37.0 9 36.442 37.0 37.0 37.0 37.0 37.0 10-14 36.4981 37.0 37.0 37.0 37.0 37.0 15-19 36.452999999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.4861 37.0 37.0 37.0 37.0 37.0 25-29 36.440999999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.4092 37.0 37.0 37.0 37.0 37.0 35-39 36.37 37.0 37.0 37.0 37.0 37.0 40-44 36.3184 37.0 37.0 37.0 37.0 37.0 45-49 36.270799999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.230399999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.226800000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.1721 37.0 37.0 37.0 37.0 37.0 65-69 36.1644 37.0 37.0 37.0 37.0 37.0 70-74 36.0802 37.0 37.0 37.0 37.0 37.0 75-79 36.0563 37.0 37.0 37.0 37.0 37.0 80-84 36.075100000000006 37.0 37.0 37.0 37.0 37.0 85-89 35.9936 37.0 37.0 37.0 37.0 37.0 90-94 35.9146 37.0 37.0 37.0 37.0 37.0 95-99 35.8243 37.0 37.0 37.0 37.0 37.0 100-104 35.8337 37.0 37.0 37.0 37.0 37.0 105-109 35.7558 37.0 37.0 37.0 37.0 37.0 110-114 35.7325 37.0 37.0 37.0 37.0 37.0 115-119 35.6926 37.0 37.0 37.0 37.0 37.0 120-124 35.615399999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.5587 37.0 37.0 37.0 37.0 37.0 130-134 35.450900000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.3663 37.0 37.0 37.0 34.6 37.0 140-144 35.2391 37.0 37.0 37.0 29.8 37.0 145-149 35.150400000000005 37.0 37.0 37.0 27.4 37.0 150-151 34.51625 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 0.0 21 1.0 22 3.0 23 4.0 24 0.0 25 6.0 26 10.0 27 12.0 28 15.0 29 29.0 30 31.0 31 40.0 32 68.0 33 106.0 34 185.0 35 457.0 36 2796.0 37 235.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.28686058174524 12.988966900702106 11.283851554663991 38.44032096288866 2 24.675 19.925 33.975 21.425 3 20.925 26.0 24.05 29.025000000000002 4 24.9 31.974999999999998 20.825 22.3 5 25.275 32.275 21.825 20.625 6 20.825 34.25 21.9 23.025000000000002 7 16.1 19.6 41.825 22.475 8 21.6 19.625 26.6 32.175 9 20.95 18.475 31.574999999999996 28.999999999999996 10-14 22.98 26.700000000000003 24.740000000000002 25.580000000000002 15-19 23.18 24.845 26.06 25.915 20-24 23.36 25.97 25.0 25.669999999999998 25-29 23.46 25.490000000000002 25.2 25.85 30-34 22.99 26.015 25.740000000000002 25.255 35-39 23.400000000000002 25.745 25.014999999999997 25.840000000000003 40-44 23.62 25.6 24.86 25.919999999999998 45-49 24.46 25.055 24.88 25.605 50-54 23.71 25.735000000000003 24.725 25.83 55-59 23.9 25.095 25.25 25.755 60-64 23.93 25.06 24.895 26.115 65-69 23.965 25.1 24.990000000000002 25.945 70-74 24.675 25.21 24.48 25.635 75-79 24.26 24.92 24.779999999999998 26.040000000000003 80-84 23.885 25.169999999999998 24.875 26.07 85-89 23.72 24.48 25.44 26.36 90-94 24.34 24.38 24.709999999999997 26.57 95-99 24.46 24.779999999999998 24.88 25.88 100-104 24.035 24.38 24.81 26.775 105-109 24.349999999999998 24.6 24.825 26.224999999999998 110-114 24.595 24.735 24.825 25.845000000000002 115-119 25.014999999999997 24.4 24.605 25.979999999999997 120-124 24.41 24.67 24.52 26.400000000000002 125-129 24.985 24.07 24.9 26.045 130-134 24.725 24.805 24.505 25.965 135-139 25.130000000000003 24.42 24.385 26.064999999999998 140-144 24.845 24.425 24.495 26.235000000000003 145-149 24.82 24.085 24.635 26.46 150-151 24.9125 24.349999999999998 24.325 26.4125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 2.0 28 3.0 29 4.0 30 9.0 31 14.0 32 20.0 33 25.0 34 27.5 35 38.0 36 50.5 37 81.0 38 96.0 39 98.0 40 120.0 41 128.0 42 142.5 43 174.5 44 189.0 45 198.0 46 200.5 47 194.5 48 186.0 49 171.0 50 158.0 51 143.0 52 138.0 53 129.0 54 102.0 55 93.0 56 98.0 57 87.5 58 74.0 59 66.0 60 61.5 61 60.5 62 57.5 63 51.0 64 47.0 65 57.0 66 60.0 67 56.0 68 49.0 69 32.5 70 33.5 71 39.5 72 32.0 73 22.0 74 18.5 75 16.0 76 12.0 77 8.5 78 7.5 79 6.0 80 2.5 81 1.0 82 0.5 83 0.5 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.075 #Duplication Level Percentage of deduplicated Percentage of total 1 95.03023928477518 90.35 2 4.759400473310544 9.049999999999999 3 0.2103602419142782 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.1 0.0 0.0 0.0 0.0 114-115 0.1 0.0 0.0 0.0 0.0 116-117 0.1 0.0 0.0 0.0 0.0 118-119 0.16249999999999998 0.0 0.0 0.0 0.0 120-121 0.175 0.0 0.0 0.0 0.0 122-123 0.2 0.0 0.0 0.0 0.0 124-125 0.2375 0.0 0.0 0.0 0.0 126-127 0.325 0.0 0.0 0.0 0.0 128-129 0.4625 0.0 0.0 0.0 0.0 130-131 0.525 0.0 0.0 0.0 0.0 132-133 0.5375000000000001 0.0 0.0 0.0 0.0 134-135 0.6 0.0 0.0 0.0 0.0 136-137 0.7 0.0 0.0 0.0 0.0 138-139 0.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCTTCC 25 8.7132835E-4 87.0 4 >>END_MODULE SRR7804170 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804170_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.144 37.0 37.0 37.0 37.0 37.0 2 35.87 37.0 37.0 37.0 37.0 37.0 3 36.114 37.0 37.0 37.0 37.0 37.0 4 36.035 37.0 37.0 37.0 37.0 37.0 5 36.2145 37.0 37.0 37.0 37.0 37.0 6 35.9745 37.0 37.0 37.0 37.0 37.0 7 35.8745 37.0 37.0 37.0 37.0 37.0 8 36.128 37.0 37.0 37.0 37.0 37.0 9 36.0875 37.0 37.0 37.0 37.0 37.0 10-14 36.0358 37.0 37.0 37.0 37.0 37.0 15-19 35.9771 37.0 37.0 37.0 37.0 37.0 20-24 35.8856 37.0 37.0 37.0 37.0 37.0 25-29 35.8845 37.0 37.0 37.0 37.0 37.0 30-34 35.8726 37.0 37.0 37.0 37.0 37.0 35-39 35.734500000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.71509999999999 37.0 37.0 37.0 37.0 37.0 45-49 35.6988 37.0 37.0 37.0 37.0 37.0 50-54 35.64490000000001 37.0 37.0 37.0 37.0 37.0 55-59 35.6108 37.0 37.0 37.0 37.0 37.0 60-64 35.480000000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.475 37.0 37.0 37.0 37.0 37.0 70-74 35.43 37.0 37.0 37.0 37.0 37.0 75-79 35.334 37.0 37.0 37.0 34.6 37.0 80-84 35.3711 37.0 37.0 37.0 37.0 37.0 85-89 35.219699999999996 37.0 37.0 37.0 27.4 37.0 90-94 35.142799999999994 37.0 37.0 37.0 25.0 37.0 95-99 35.042100000000005 37.0 37.0 37.0 25.0 37.0 100-104 34.9303 37.0 37.0 37.0 25.0 37.0 105-109 34.9876 37.0 37.0 37.0 25.0 37.0 110-114 34.8033 37.0 37.0 37.0 25.0 37.0 115-119 34.660000000000004 37.0 37.0 37.0 25.0 37.0 120-124 34.625800000000005 37.0 37.0 37.0 25.0 37.0 125-129 34.5526 37.0 37.0 37.0 25.0 37.0 130-134 34.4831 37.0 37.0 37.0 25.0 37.0 135-139 34.3221 37.0 37.0 37.0 25.0 37.0 140-144 34.099199999999996 37.0 37.0 37.0 25.0 37.0 145-149 34.047200000000004 37.0 37.0 37.0 25.0 37.0 150-151 33.3945 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 4.0 15 1.0 16 3.0 17 4.0 18 2.0 19 2.0 20 2.0 21 3.0 22 8.0 23 4.0 24 6.0 25 14.0 26 10.0 27 21.0 28 22.0 29 41.0 30 45.0 31 83.0 32 128.0 33 210.0 34 369.0 35 916.0 36 2052.0 37 47.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.65 13.075000000000001 13.700000000000001 38.574999999999996 2 29.975 18.45 30.825000000000003 20.75 3 23.5 22.575 27.125 26.8 4 27.500000000000004 30.375000000000004 17.775 24.349999999999998 5 28.175 31.924999999999997 18.725 21.175 6 20.875 34.849999999999994 18.525 25.75 7 20.575 15.25 38.525 25.650000000000002 8 21.925 18.725 23.724999999999998 35.625 9 23.125 21.325 25.124999999999996 30.425 10-14 25.575 25.135 22.465 26.825 15-19 25.485000000000003 23.855 23.630000000000003 27.029999999999998 20-24 26.02 24.69 23.21 26.08 25-29 25.8 24.855 23.200000000000003 26.145000000000003 30-34 25.635 24.215 23.794999999999998 26.355 35-39 25.405 24.675 23.625 26.295 40-44 26.290000000000003 24.625 22.925 26.16 45-49 26.995 25.064999999999998 22.375 25.564999999999998 50-54 27.075 23.955000000000002 23.325000000000003 25.645 55-59 26.590000000000003 24.01 23.64 25.759999999999998 60-64 26.834999999999997 24.01 23.44 25.715 65-69 26.91 24.099999999999998 23.330000000000002 25.66 70-74 26.795 23.655 23.43 26.119999999999997 75-79 26.279999999999998 24.58 23.285 25.855 80-84 27.189999999999998 23.89 23.155 25.765 85-89 26.985 24.685000000000002 22.91 25.419999999999998 90-94 26.340000000000003 24.72 23.565 25.374999999999996 95-99 27.485 24.385 23.315 24.815 100-104 27.224999999999998 24.255 23.01 25.509999999999998 105-109 26.840000000000003 24.195 23.415 25.55 110-114 27.12 24.005000000000003 23.21 25.665 115-119 26.375 24.975 23.11 25.540000000000003 120-124 27.29 24.445 23.189999999999998 25.074999999999996 125-129 26.735 24.725 23.62 24.92 130-134 26.245 24.37 23.665 25.72 135-139 27.315 24.44 23.035 25.21 140-144 26.755000000000003 24.505 23.89 24.85 145-149 27.33 24.3 23.485 24.884999999999998 150-151 27.037499999999998 25.074999999999996 22.35 25.5375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 0.5 18 0.5 19 1.0 20 0.5 21 1.0 22 1.5 23 0.5 24 1.0 25 1.5 26 0.5 27 1.5 28 5.0 29 8.0 30 7.5 31 8.0 32 10.5 33 16.5 34 24.0 35 30.0 36 41.0 37 50.0 38 58.0 39 83.5 40 95.5 41 103.5 42 128.5 43 149.0 44 156.5 45 142.0 46 152.5 47 165.5 48 159.5 49 143.0 50 128.0 51 137.5 52 139.5 53 127.0 54 110.5 55 98.0 56 92.0 57 89.5 58 83.0 59 91.5 60 84.5 61 75.5 62 85.0 63 80.5 64 80.5 65 90.0 66 89.0 67 72.5 68 77.0 69 81.5 70 67.5 71 56.5 72 45.5 73 35.0 74 27.0 75 25.5 76 21.5 77 14.0 78 10.5 79 8.5 80 5.5 81 2.5 82 2.5 83 2.5 84 1.5 85 0.5 86 1.0 87 1.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.5 98 1.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.1 #Duplication Level Percentage of deduplicated Percentage of total 1 95.21556256572029 90.55 2 4.468980021030494 8.5 3 0.2891692954784437 0.8250000000000001 4 0.0 0.0 5 0.026288117770767613 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.1 0.0 0.0 0.0 0.0 114-115 0.1 0.0 0.0 0.0 0.0 116-117 0.1 0.0 0.0 0.0 0.0 118-119 0.16249999999999998 0.0 0.0 0.0 0.0 120-121 0.175 0.0 0.0 0.0 0.0 122-123 0.2 0.0 0.0 0.0 0.0 124-125 0.2375 0.0 0.0 0.0 0.0 126-127 0.325 0.0 0.0 0.0 0.0 128-129 0.4375 0.0 0.0 0.0 0.0 130-131 0.5 0.0 0.0 0.0 0.0 132-133 0.5125 0.0 0.0 0.0 0.0 134-135 0.575 0.0 0.0 0.0 0.0 136-137 0.675 0.0 0.0 0.0 0.0 138-139 0.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 35 0.0035366106 20.714287 130-134 >>END_MODULE Read 1942897 spots for SRR7804170.sra Written 1942897 spots for SRR7804170.sra Read 1942897 spots for SRR7804170.sra Written 1942897 spots for SRR7804170.sra Read 1942897 spots for SRR7804170.sra Written 1942897 spots for SRR7804170.sra Read 1942897 spots for SRR7804170.sra Written 1942897 spots for SRR7804170.sra Read 1942897 spots for SRR7804170.sra Written 1942897 spots for SRR7804170.sra Read 1942897 spots for SRR7804170.sra Written 1942897 spots for SRR7804170.sra Read 1942897 spots for SRR7804170.sra Written 1942897 spots for SRR7804170.sra Read 1942897 spots for SRR7804170.sra Written 1942897 spots for SRR7804170.sra Read 1942897 spots for SRR7804170.sra Written 1942897 spots for SRR7804170.sra Read 1942897 spots for SRR7804170.sra Written 1942897 spots for SRR7804170.sra Read 1942897 spots for SRR7804170.sra Written 1942897 spots for SRR7804170.sra Read 1942897 spots for SRR7804170.sra Written 1942897 spots for SRR7804170.sra Read 1942897 spots for SRR7804170.sra Written 1942897 spots for SRR7804170.sra Read 1942897 spots for SRR7804170.sra Written 1942897 spots for SRR7804170.sra Read 1942897 spots for SRR7804170.sra Written 1942897 spots for SRR7804170.sra Read 1942897 spots for SRR7804170.sra Written 1942897 spots for SRR7804170.sra Read 1942897 spots for SRR7804170.sra Written 1942897 spots for SRR7804170.sra Read 1942903 spots for SRR7804170.sra Written 1942903 spots for SRR7804170.sra Read 1942897 spots for SRR7804170.sra Written 1942897 spots for SRR7804170.sra Read 1942897 spots for SRR7804170.sra Written 1942897 spots for SRR7804170.sra SRR ids: ['SRR7804170.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n_42ove6 SRR7804170.sra spots: 38857946 blocks: [[1, 1942897], [1942898, 3885794], [3885795, 5828691], [5828692, 7771588], [7771589, 9714485], [9714486, 11657382], [11657383, 13600279], [13600280, 15543176], [15543177, 17486073], [17486074, 19428970], [19428971, 21371867], [21371868, 23314764], [23314765, 25257661], [25257662, 27200558], [27200559, 29143455], [29143456, 31086352], [31086353, 33029249], [33029250, 34972146], [34972147, 36915043], [36915044, 38857946]] SRR7804170 file size 13145982 SRR7804170 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804170 SRR7804170_1.fastq SRR7804170_2.fastq Input file: SRR7804170_1.fastq Paired file: SRR7804170_2.fastq trimmed: SRR7804170-trimmed-pair1.fastq, SRR7804170-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:17:57 2024 >> started Tue Dec 10 03:18:39 2024 >> done (41.904s) 38857946 read pairs processed; of these: 134 ( 0.00%) short read pairs filtered out after trimming by size control 1096 ( 0.00%) empty read pairs filtered out after trimming by size control 38856716 (100.00%) read pairs available; of these: 662187 ( 1.70%) trimmed read pairs available after processing 38194529 (98.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 29 0.00% 20 18 0.00% 21 31 0.00% 22 41 0.00% 23 31 0.00% 24 40 0.00% 25 43 0.00% 26 52 0.00% 27 66 0.00% 28 55 0.00% 29 70 0.00% 30 68 0.00% 31 75 0.00% 32 65 0.00% 33 71 0.00% 34 59 0.00% 35 105 0.00% 36 81 0.00% 37 93 0.00% 38 110 0.00% 39 83 0.00% 40 96 0.00% 41 85 0.00% 42 119 0.00% 43 122 0.00% 44 103 0.00% 45 104 0.00% 46 134 0.00% 47 112 0.00% 48 125 0.00% 49 135 0.00% 50 154 0.00% 51 128 0.00% 52 135 0.00% 53 143 0.00% 54 142 0.00% 55 143 0.00% 56 139 0.00% 57 152 0.00% 58 145 0.00% 59 138 0.00% 60 180 0.00% 61 179 0.00% 62 175 0.00% 63 176 0.00% 64 169 0.00% 65 201 0.00% 66 189 0.00% 67 187 0.00% 68 199 0.00% 69 196 0.00% 70 248 0.00% 71 247 0.00% 72 251 0.00% 73 282 0.00% 74 257 0.00% 75 285 0.00% 76 295 0.00% 77 324 0.00% 78 320 0.00% 79 413 0.00% 80 449 0.00% 81 419 0.00% 82 503 0.00% 83 535 0.00% 84 602 0.00% 85 584 0.00% 86 714 0.00% 87 673 0.00% 88 763 0.00% 89 896 0.00% 90 956 0.00% 91 1088 0.00% 92 1155 0.00% 93 1193 0.00% 94 1357 0.00% 95 1554 0.00% 96 1633 0.00% 97 1770 0.00% 98 1936 0.00% 99 2243 0.01% 100 2254 0.01% 101 2417 0.01% 102 2717 0.01% 103 2834 0.01% 104 3076 0.01% 105 3346 0.01% 106 3418 0.01% 107 3844 0.01% 108 4086 0.01% 109 4352 0.01% 110 4685 0.01% 111 4851 0.01% 112 5303 0.01% 113 5631 0.01% 114 6042 0.02% 115 6416 0.02% 116 6708 0.02% 117 7067 0.02% 118 7475 0.02% 119 7979 0.02% 120 8284 0.02% 121 8678 0.02% 122 9293 0.02% 123 9713 0.02% 124 10249 0.03% 125 10875 0.03% 126 11259 0.03% 127 11771 0.03% 128 12120 0.03% 129 12754 0.03% 130 13381 0.03% 131 13719 0.04% 132 14807 0.04% 133 15160 0.04% 134 15981 0.04% 135 16592 0.04% 136 17418 0.04% 137 18090 0.05% 138 18894 0.05% 139 18939 0.05% 140 19945 0.05% 141 20975 0.05% 142 21910 0.06% 143 22548 0.06% 144 23596 0.06% 145 24733 0.06% 146 25238 0.06% 147 26437 0.07% 148 27130 0.07% 149 27669 0.07% 150 29872 0.08% 151 38194529 98.30% 38856716 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=30 prefix-density=0.24 prefix-fanout=2.3 sequence=TGGGCACACTCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=114.25 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=16.9 sequence=GGCGGCGGCGGCCTCGAAGCCTGACTTGGTCGCCGGCGGCGCAACGCCCATGACGAGTGTCTGGGAAGAAGTCGCCTCCTCGGCCATCATCTCTGGGTACAT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=6.17 fanout-score-rank=19 prefix-density=0.30 prefix-fanout=4.7 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=1414.53 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=21.9 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR7804170 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:19:28 Started mapping on | Dec 10 03:19:28 Finished on | Dec 10 03:27:02 Mapping speed, Million of reads per hour | 308.11 Number of input reads | 38856716 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 36172818 Uniquely mapped reads % | 93.09% Average mapped length | 300.10 Number of splices: Total | 37526676 Number of splices: Annotated (sjdb) | 35120682 Number of splices: GT/AG | 37031018 Number of splices: GC/AG | 415755 Number of splices: AT/AC | 26552 Number of splices: Non-canonical | 53351 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.01% Deletion average length | 2.72 Insertion rate per base | 0.01% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 410061 % of reads mapped to multiple loci | 1.06% Number of reads mapped to too many loci | 13285 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.56% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2273837 2273837 2273837 N_multimapping 410061 410061 410061 N_noFeature 1150653 35096397 1552287 N_ambiguous 821321 7388 145940 UnstrandedReadsAssigned:34200844 PositiveStrandReadsAssigned:1069033 NegativeStrandReadsAssigned:34474591 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804170 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804170-trimmed-pair1.fastq SRR7804170-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,856,716 reads, 34,936,317 reads pseudoaligned [quant] estimated average fragment length: 349.718 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,246 rounds 52973 SRR7804170.ke.tsv 35125 SRR7804170.se.tsv 88098 total ==> SRR7804170.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 588.722 0 0 PNS24247 1044 695.282 116.608 6.18724 PNS24249 1928 1579.28 382.805 8.94223 PNS24246 1044 695.282 116.608 6.18724 PNS24248 1044 695.282 116.608 6.18724 PNS24244 1471 1122.28 195.371 6.42222 PNS24243 293 66.881 1 0.551602 KQK14069 1603 1254.28 12267.5 360.82 KQK14071 474 179.685 82.8547 17.0111 ==> SRR7804170.se.tsv <== BRADI_1g14170v3 12934 BRADI_1g53295v3 1646 BRADI_1g59795v3 997 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 787 BRADI_1g74790v3 686 BRADI_1g09890v3 0 BRADI_1g77505v3 396 BRADI_1g48960v3 0 SRR7804170 completed mapping pipeline successfully