Starting /dee2/code/volunteer_pipeline.sh SRR7804171 current disk space = 1525946331136 free memory = 1598936156 SRR7804171 SRAfilesize b5d14ade300be86e75b38dff2692a70b SRR7804171.sra SRR7804171.sra file validated SRR7804171 is paired end SRR7804171 is conventional basespace SRR7804171 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804171_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.162 37.0 37.0 37.0 37.0 37.0 2 36.296 37.0 37.0 37.0 37.0 37.0 3 36.421 37.0 37.0 37.0 37.0 37.0 4 36.5035 37.0 37.0 37.0 37.0 37.0 5 36.528 37.0 37.0 37.0 37.0 37.0 6 36.505 37.0 37.0 37.0 37.0 37.0 7 36.293 37.0 37.0 37.0 37.0 37.0 8 36.4765 37.0 37.0 37.0 37.0 37.0 9 36.357 37.0 37.0 37.0 37.0 37.0 10-14 36.5242 37.0 37.0 37.0 37.0 37.0 15-19 36.46909999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.479800000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.35340000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.373400000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.359300000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.31099999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.287400000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.266000000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.229800000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.1745 37.0 37.0 37.0 37.0 37.0 65-69 36.169500000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.1086 37.0 37.0 37.0 37.0 37.0 75-79 36.11999999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.092699999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.960699999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.944 37.0 37.0 37.0 37.0 37.0 95-99 35.87320000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.8191 37.0 37.0 37.0 37.0 37.0 105-109 35.7887 37.0 37.0 37.0 37.0 37.0 110-114 35.8307 37.0 37.0 37.0 37.0 37.0 115-119 35.695699999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.591100000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.50750000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.491 37.0 37.0 37.0 37.0 37.0 135-139 35.407399999999996 37.0 37.0 37.0 34.6 37.0 140-144 35.351099999999995 37.0 37.0 37.0 34.6 37.0 145-149 35.2022 37.0 37.0 37.0 29.8 37.0 150-151 34.57575 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 0.0 24 5.0 25 2.0 26 7.0 27 12.0 28 19.0 29 31.0 30 38.0 31 48.0 32 72.0 33 95.0 34 187.0 35 482.0 36 2730.0 37 270.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.16850551654965 11.985957873620864 11.208625877632898 45.63691073219659 2 24.25 17.775 36.725 21.25 3 22.275 23.575 24.075 30.075000000000003 4 26.424999999999997 30.0 19.375 24.2 5 27.35 31.45 20.200000000000003 21.0 6 20.8 33.35 23.65 22.2 7 16.0 21.099999999999998 41.925000000000004 20.974999999999998 8 20.875 19.875 28.499999999999996 30.75 9 20.8 19.575 31.624999999999996 28.000000000000004 10-14 23.064999999999998 26.224999999999998 24.69 26.02 15-19 23.325000000000003 25.415 24.759999999999998 26.5 20-24 23.53 25.245 25.275 25.95 25-29 23.87 25.495 24.67 25.965 30-34 23.48 24.75 25.230000000000004 26.540000000000003 35-39 23.810000000000002 25.224999999999998 24.555 26.41 40-44 23.745 25.585 24.665 26.005 45-49 23.3 25.069999999999997 25.005 26.625 50-54 24.05 25.355 23.955000000000002 26.640000000000004 55-59 23.945 24.805 24.675 26.575 60-64 24.25 24.565 24.44 26.745 65-69 24.415 24.765 24.125 26.695 70-74 24.34 24.62 24.115000000000002 26.924999999999997 75-79 23.815 24.83 24.785 26.57 80-84 25.03 23.905 24.610000000000003 26.455000000000002 85-89 25.124999999999996 24.349999999999998 24.065 26.46 90-94 24.67 24.305 24.41 26.615 95-99 25.080000000000002 24.7 23.73 26.490000000000002 100-104 24.825 24.060000000000002 24.27 26.845000000000002 105-109 24.959999999999997 24.33 24.165 26.545 110-114 24.86 23.665 24.740000000000002 26.735 115-119 24.865000000000002 24.195 24.43 26.51 120-124 25.240000000000002 23.799999999999997 23.98 26.979999999999997 125-129 25.365 24.474999999999998 24.46 25.7 130-134 24.815 24.48 24.2 26.505000000000003 135-139 25.455 24.03 24.03 26.484999999999996 140-144 25.19 23.990000000000002 23.65 27.169999999999998 145-149 24.6 24.125 23.97 27.305 150-151 25.6125 23.1125 23.95 27.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 1.5 26 2.0 27 2.5 28 1.5 29 4.0 30 7.5 31 8.0 32 12.5 33 22.5 34 29.0 35 38.0 36 51.0 37 57.0 38 74.5 39 89.0 40 112.5 41 145.0 42 173.0 43 181.0 44 167.0 45 182.5 46 183.0 47 161.5 48 152.0 49 159.0 50 165.0 51 135.0 52 120.0 53 129.0 54 118.5 55 99.0 56 89.5 57 83.0 58 84.0 59 90.5 60 86.5 61 76.0 62 74.5 63 66.5 64 62.5 65 66.5 66 65.5 67 62.5 68 53.5 69 48.0 70 45.5 71 41.0 72 28.0 73 23.5 74 27.5 75 16.5 76 4.0 77 6.0 78 6.0 79 2.5 80 0.5 81 0.5 82 1.0 83 1.5 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.45 #Duplication Level Percentage of deduplicated Percentage of total 1 95.54740701938188 91.2 2 4.138292299633315 7.9 3 0.3143006809848088 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0125 0.0 0.0 0.0 0.0 102-103 0.037500000000000006 0.0 0.0 0.0 0.0 104-105 0.07500000000000001 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.025 108-109 0.15 0.0 0.0 0.0 0.025 110-111 0.225 0.0 0.0 0.0 0.025 112-113 0.275 0.0 0.0 0.0 0.025 114-115 0.38749999999999996 0.0 0.0 0.0 0.025 116-117 0.4625 0.0 0.0 0.0 0.025 118-119 0.55 0.0 0.0 0.0 0.025 120-121 0.65 0.0 0.0 0.0 0.025 122-123 0.7124999999999999 0.0 0.0 0.0 0.025 124-125 0.7875000000000001 0.0 0.0 0.0 0.025 126-127 0.825 0.0 0.0 0.0 0.025 128-129 0.875 0.0 0.0 0.0 0.025 130-131 0.9874999999999999 0.0 0.0 0.0 0.025 132-133 1.15 0.0 0.0 0.0 0.025 134-135 1.225 0.0 0.0 0.0 0.025 136-137 1.2999999999999998 0.0 0.0 0.0 0.025 138-139 1.5125 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAGAAG 10 0.006830828 145.0 145 AAGTTAT 10 0.006830828 145.0 9 >>END_MODULE SRR7804171 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804171_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2195 37.0 37.0 37.0 37.0 37.0 2 36.106 37.0 37.0 37.0 37.0 37.0 3 36.127 37.0 37.0 37.0 37.0 37.0 4 36.132 37.0 37.0 37.0 37.0 37.0 5 36.215 37.0 37.0 37.0 37.0 37.0 6 36.129 37.0 37.0 37.0 37.0 37.0 7 36.1355 37.0 37.0 37.0 37.0 37.0 8 36.2185 37.0 37.0 37.0 37.0 37.0 9 36.2575 37.0 37.0 37.0 37.0 37.0 10-14 36.1007 37.0 37.0 37.0 37.0 37.0 15-19 36.080400000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.056799999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.0555 37.0 37.0 37.0 37.0 37.0 30-34 35.970800000000004 37.0 37.0 37.0 37.0 37.0 35-39 35.88699999999999 37.0 37.0 37.0 37.0 37.0 40-44 35.9891 37.0 37.0 37.0 37.0 37.0 45-49 35.8454 37.0 37.0 37.0 37.0 37.0 50-54 35.8525 37.0 37.0 37.0 37.0 37.0 55-59 35.805899999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.6717 37.0 37.0 37.0 37.0 37.0 65-69 35.617399999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.62330000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.6443 37.0 37.0 37.0 37.0 37.0 80-84 35.4935 37.0 37.0 37.0 37.0 37.0 85-89 35.423300000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.331399999999995 37.0 37.0 37.0 34.6 37.0 95-99 35.2366 37.0 37.0 37.0 29.8 37.0 100-104 35.217800000000004 37.0 37.0 37.0 27.4 37.0 105-109 35.1297 37.0 37.0 37.0 27.4 37.0 110-114 35.078 37.0 37.0 37.0 25.0 37.0 115-119 35.0477 37.0 37.0 37.0 25.0 37.0 120-124 34.8865 37.0 37.0 37.0 25.0 37.0 125-129 34.817299999999996 37.0 37.0 37.0 25.0 37.0 130-134 34.7494 37.0 37.0 37.0 25.0 37.0 135-139 34.5428 37.0 37.0 37.0 25.0 37.0 140-144 34.255700000000004 37.0 37.0 37.0 25.0 37.0 145-149 34.26089999999999 37.0 37.0 37.0 25.0 37.0 150-151 33.51025 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 3.0 20 3.0 21 2.0 22 5.0 23 6.0 24 5.0 25 15.0 26 11.0 27 17.0 28 22.0 29 31.0 30 53.0 31 64.0 32 100.0 33 186.0 34 330.0 35 892.0 36 2171.0 37 80.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.15 11.725 14.499999999999998 43.625 2 29.599999999999998 16.3 33.375 20.724999999999998 3 23.400000000000002 21.275 27.625 27.700000000000003 4 25.650000000000002 30.175 17.424999999999997 26.75 5 29.2 31.275 19.125 20.4 6 20.150000000000002 34.449999999999996 19.175 26.224999999999998 7 20.9 13.700000000000001 37.35 28.050000000000004 8 23.1 18.575 23.175 35.15 9 24.925 20.05 24.65 30.375000000000004 10-14 25.790000000000003 24.59 22.345000000000002 27.275 15-19 26.229999999999997 23.785 23.615 26.369999999999997 20-24 26.025 24.015 23.369999999999997 26.590000000000003 25-29 26.47 23.53 23.080000000000002 26.919999999999998 30-34 25.874999999999996 23.369999999999997 23.945 26.810000000000002 35-39 25.525 24.515 23.345 26.615 40-44 26.919999999999998 23.68 22.525000000000002 26.875 45-49 26.515 24.175 22.564999999999998 26.745 50-54 26.025 23.275000000000002 24.04 26.66 55-59 26.884999999999998 23.799999999999997 22.945 26.369999999999997 60-64 26.445 23.89 22.99 26.674999999999997 65-69 26.740000000000002 23.544999999999998 23.165 26.55 70-74 26.855 23.45 23.064999999999998 26.63 75-79 26.375 23.29 23.61 26.724999999999998 80-84 27.065 23.895 22.74 26.3 85-89 27.284999999999997 23.595 23.06 26.06 90-94 27.71 23.52 22.759999999999998 26.009999999999998 95-99 27.339999999999996 23.87 22.695 26.095000000000002 100-104 27.345000000000002 23.97 22.994999999999997 25.69 105-109 27.279999999999998 23.990000000000002 23.189999999999998 25.540000000000003 110-114 27.529999999999998 23.494999999999997 22.85 26.125 115-119 27.175 24.310000000000002 22.264999999999997 26.25 120-124 26.82 24.115000000000002 23.57 25.495 125-129 27.229999999999997 24.26 22.97 25.540000000000003 130-134 27.575 23.73 23.305 25.39 135-139 27.57 24.545 23.13 24.755 140-144 27.365000000000002 24.14 23.415 25.080000000000002 145-149 26.985 24.315 23.305 25.395 150-151 26.937499999999996 25.1 23.3375 24.625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 0.5 25 1.0 26 2.0 27 2.0 28 3.5 29 5.0 30 7.0 31 9.5 32 11.0 33 11.0 34 12.5 35 19.5 36 29.0 37 39.0 38 48.5 39 65.0 40 87.5 41 106.0 42 110.0 43 124.5 44 154.5 45 161.0 46 149.5 47 141.0 48 145.5 49 154.5 50 145.0 51 146.5 52 132.0 53 105.5 54 113.0 55 98.0 56 84.0 57 100.0 58 105.5 59 107.5 60 106.5 61 90.5 62 99.0 63 107.5 64 93.5 65 86.0 66 89.0 67 89.5 68 83.5 69 75.5 70 71.0 71 70.0 72 60.0 73 42.5 74 28.0 75 20.0 76 13.0 77 10.0 78 6.5 79 4.5 80 4.5 81 4.0 82 2.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.675 #Duplication Level Percentage of deduplicated Percentage of total 1 95.27330340639028 90.2 2 4.092949564298917 7.75 3 0.47531027198310005 1.35 4 0.1320306311064167 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.026406126221283337 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.037500000000000006 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.30000000000000004 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.48750000000000004 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.7375 0.0 0.0 0.0 0.0 124-125 0.7875000000000001 0.0 0.0 0.0 0.0 126-127 0.825 0.0 0.0 0.0 0.0 128-129 0.875 0.0 0.0 0.0 0.0 130-131 0.9874999999999999 0.0 0.0 0.0 0.0 132-133 1.125 0.0 0.0 0.0 0.0 134-135 1.1875 0.0 0.0 0.0 0.0 136-137 1.2375 0.0 0.0 0.0 0.0 138-139 1.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTTTCC 10 0.006830828 145.0 5 >>END_MODULE Read 1504514 spots for SRR7804171.sra Written 1504514 spots for SRR7804171.sra Read 1504514 spots for SRR7804171.sra Written 1504514 spots for SRR7804171.sra Read 1504514 spots for SRR7804171.sra Written 1504514 spots for SRR7804171.sra Read 1504514 spots for SRR7804171.sra Written 1504514 spots for SRR7804171.sra Read 1504514 spots for SRR7804171.sra Written 1504514 spots for SRR7804171.sra Read 1504514 spots for SRR7804171.sra Written 1504514 spots for SRR7804171.sra Read 1504514 spots for SRR7804171.sra Written 1504514 spots for SRR7804171.sra Read 1504514 spots for SRR7804171.sra Written 1504514 spots for SRR7804171.sra Read 1504514 spots for SRR7804171.sra Written 1504514 spots for SRR7804171.sra Read 1504514 spots for SRR7804171.sra Written 1504514 spots for SRR7804171.sra Read 1504514 spots for SRR7804171.sra Written 1504514 spots for SRR7804171.sra Read 1504514 spots for SRR7804171.sra Written 1504514 spots for SRR7804171.sra Read 1504514 spots for SRR7804171.sra Written 1504514 spots for SRR7804171.sra Read 1504514 spots for SRR7804171.sra Written 1504514 spots for SRR7804171.sra Read 1504514 spots for SRR7804171.sra Written 1504514 spots for SRR7804171.sra Read 1504514 spots for SRR7804171.sra Written 1504514 spots for SRR7804171.sra Read 1504514 spots for SRR7804171.sra Written 1504514 spots for SRR7804171.sra Read 1504514 spots for SRR7804171.sra Written 1504514 spots for SRR7804171.sra Read 1504514 spots for SRR7804171.sra Written 1504514 spots for SRR7804171.sra Read 1504518 spots for SRR7804171.sra Written 1504518 spots for SRR7804171.sra SRR ids: ['SRR7804171.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_itc93nci SRR7804171.sra spots: 30090284 blocks: [[1, 1504514], [1504515, 3009028], [3009029, 4513542], [4513543, 6018056], [6018057, 7522570], [7522571, 9027084], [9027085, 10531598], [10531599, 12036112], [12036113, 13540626], [13540627, 15045140], [15045141, 16549654], [16549655, 18054168], [18054169, 19558682], [19558683, 21063196], [21063197, 22567710], [22567711, 24072224], [24072225, 25576738], [25576739, 27081252], [27081253, 28585766], [28585767, 30090284]] SRR7804171 file size 10174909 SRR7804171 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804171 SRR7804171_1.fastq SRR7804171_2.fastq Input file: SRR7804171_1.fastq Paired file: SRR7804171_2.fastq trimmed: SRR7804171-trimmed-pair1.fastq, SRR7804171-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:18:19 2024 >> started Tue Dec 10 03:18:54 2024 >> done (35.305s) 30090284 read pairs processed; of these: 80 ( 0.00%) short read pairs filtered out after trimming by size control 1050 ( 0.00%) empty read pairs filtered out after trimming by size control 30089154 (100.00%) read pairs available; of these: 747656 ( 2.48%) trimmed read pairs available after processing 29341498 (97.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 22 0.00% 20 15 0.00% 21 11 0.00% 22 16 0.00% 23 19 0.00% 24 22 0.00% 25 23 0.00% 26 30 0.00% 27 28 0.00% 28 33 0.00% 29 28 0.00% 30 30 0.00% 31 51 0.00% 32 40 0.00% 33 52 0.00% 34 42 0.00% 35 48 0.00% 36 55 0.00% 37 47 0.00% 38 68 0.00% 39 46 0.00% 40 48 0.00% 41 57 0.00% 42 51 0.00% 43 60 0.00% 44 54 0.00% 45 64 0.00% 46 68 0.00% 47 59 0.00% 48 77 0.00% 49 66 0.00% 50 89 0.00% 51 89 0.00% 52 91 0.00% 53 68 0.00% 54 104 0.00% 55 92 0.00% 56 99 0.00% 57 95 0.00% 58 108 0.00% 59 106 0.00% 60 123 0.00% 61 113 0.00% 62 128 0.00% 63 127 0.00% 64 121 0.00% 65 132 0.00% 66 150 0.00% 67 141 0.00% 68 194 0.00% 69 162 0.00% 70 204 0.00% 71 216 0.00% 72 215 0.00% 73 266 0.00% 74 243 0.00% 75 270 0.00% 76 294 0.00% 77 371 0.00% 78 363 0.00% 79 388 0.00% 80 438 0.00% 81 452 0.00% 82 548 0.00% 83 588 0.00% 84 661 0.00% 85 738 0.00% 86 784 0.00% 87 859 0.00% 88 976 0.00% 89 1077 0.00% 90 1174 0.00% 91 1310 0.00% 92 1444 0.00% 93 1580 0.01% 94 1748 0.01% 95 1953 0.01% 96 2073 0.01% 97 2342 0.01% 98 2460 0.01% 99 2579 0.01% 100 2904 0.01% 101 2968 0.01% 102 3391 0.01% 103 3504 0.01% 104 3929 0.01% 105 4200 0.01% 106 4465 0.01% 107 4600 0.02% 108 5045 0.02% 109 5491 0.02% 110 5602 0.02% 111 5898 0.02% 112 6610 0.02% 113 6828 0.02% 114 7175 0.02% 115 7823 0.03% 116 8099 0.03% 117 8565 0.03% 118 9068 0.03% 119 9466 0.03% 120 9884 0.03% 121 10168 0.03% 122 10763 0.04% 123 11449 0.04% 124 11997 0.04% 125 12646 0.04% 126 13223 0.04% 127 13518 0.04% 128 13923 0.05% 129 14672 0.05% 130 15217 0.05% 131 15668 0.05% 132 16692 0.06% 133 17113 0.06% 134 18106 0.06% 135 18605 0.06% 136 20054 0.07% 137 20206 0.07% 138 21311 0.07% 139 21605 0.07% 140 22363 0.07% 141 23153 0.08% 142 24131 0.08% 143 24491 0.08% 144 25580 0.09% 145 26512 0.09% 146 27577 0.09% 147 28437 0.09% 148 29632 0.10% 149 30093 0.10% 150 30952 0.10% 151 29341498 97.52% 30089154 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=3.28 fanout-score-rank=15 prefix-density=0.76 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.18 sequence-density-rank=27 fanout-score=29.33 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=7.9 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=30 prefix-density=0.56 prefix-fanout=2.4 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=145.06 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=4.9 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804171 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:19:50 Started mapping on | Dec 10 03:19:50 Finished on | Dec 10 03:23:46 Mapping speed, Million of reads per hour | 458.99 Number of input reads | 30089154 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 28981831 Uniquely mapped reads % | 96.32% Average mapped length | 300.06 Number of splices: Total | 31292248 Number of splices: Annotated (sjdb) | 29455690 Number of splices: GT/AG | 30860641 Number of splices: GC/AG | 382275 Number of splices: AT/AC | 10992 Number of splices: Non-canonical | 38340 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.65 Insertion rate per base | 0.01% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 327067 % of reads mapped to multiple loci | 1.09% Number of reads mapped to too many loci | 17176 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.12% % of reads unmapped: other | 0.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 780256 780256 780256 N_multimapping 327067 327067 327067 N_noFeature 847338 28048234 1095994 N_ambiguous 819966 4905 136169 UnstrandedReadsAssigned:27314527 PositiveStrandReadsAssigned:928692 NegativeStrandReadsAssigned:27749668 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804171 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804171-trimmed-pair1.fastq SRR7804171-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,089,154 reads, 27,857,977 reads pseudoaligned [quant] estimated average fragment length: 334.462 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,126 rounds 52973 SRR7804171.ke.tsv 35125 SRR7804171.se.tsv 88098 total ==> SRR7804171.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 603.782 0 0 PNS24247 1044 710.538 107.307 6.87789 PNS24249 1928 1594.54 85.3607 2.43802 PNS24246 1044 710.538 107.307 6.87789 PNS24248 1044 710.538 107.307 6.87789 PNS24244 1471 1137.54 192.718 7.71562 PNS24243 293 71.1273 0 0 KQK14069 1603 1269.54 2655.81 95.272 KQK14071 474 188.985 111.421 26.8505 ==> SRR7804171.se.tsv <== BRADI_1g14170v3 3313 BRADI_1g53295v3 170 BRADI_1g59795v3 1360 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 598 BRADI_1g74790v3 303 BRADI_1g09890v3 0 BRADI_1g77505v3 402 BRADI_1g48960v3 0 SRR7804171 completed mapping pipeline successfully