Starting /dee2/code/volunteer_pipeline.sh SRR7804172 current disk space = 1541110353920 free memory = 1453386308 SRR7804172 SRAfilesize d1cdc5e8c8ee83510ccc88713d793fe7 SRR7804172.sra SRR7804172.sra file validated SRR7804172 is paired end SRR7804172 is conventional basespace SRR7804172 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804172_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.09675 37.0 37.0 37.0 37.0 37.0 2 36.3315 37.0 37.0 37.0 37.0 37.0 3 36.442 37.0 37.0 37.0 37.0 37.0 4 36.5485 37.0 37.0 37.0 37.0 37.0 5 36.591 37.0 37.0 37.0 37.0 37.0 6 36.5025 37.0 37.0 37.0 37.0 37.0 7 36.304 37.0 37.0 37.0 37.0 37.0 8 36.57 37.0 37.0 37.0 37.0 37.0 9 36.456 37.0 37.0 37.0 37.0 37.0 10-14 36.5344 37.0 37.0 37.0 37.0 37.0 15-19 36.4902 37.0 37.0 37.0 37.0 37.0 20-24 36.4619 37.0 37.0 37.0 37.0 37.0 25-29 36.447 37.0 37.0 37.0 37.0 37.0 30-34 36.391999999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.405800000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.3312 37.0 37.0 37.0 37.0 37.0 45-49 36.308299999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.252300000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.230000000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.2051 37.0 37.0 37.0 37.0 37.0 65-69 36.1862 37.0 37.0 37.0 37.0 37.0 70-74 36.0832 37.0 37.0 37.0 37.0 37.0 75-79 36.1049 37.0 37.0 37.0 37.0 37.0 80-84 36.077099999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.0621 37.0 37.0 37.0 37.0 37.0 90-94 35.9559 37.0 37.0 37.0 37.0 37.0 95-99 35.865300000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.885000000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.84930000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.831500000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.6939 37.0 37.0 37.0 37.0 37.0 120-124 35.6414 37.0 37.0 37.0 37.0 37.0 125-129 35.671099999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.53 37.0 37.0 37.0 37.0 37.0 135-139 35.38269999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.3871 37.0 37.0 37.0 34.6 37.0 145-149 35.21939999999999 37.0 37.0 37.0 29.8 37.0 150-151 34.54625 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 2.0 25 4.0 26 4.0 27 12.0 28 12.0 29 32.0 30 47.0 31 42.0 32 70.0 33 89.0 34 173.0 35 470.0 36 2780.0 37 261.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.0138017565872 12.070263488080302 11.869510664993726 39.046424090338775 2 24.625 16.775000000000002 34.150000000000006 24.45 3 22.75 24.875 24.45 27.925 4 25.4 30.55 20.5 23.549999999999997 5 26.125 31.25 22.45 20.175 6 20.25 33.125 23.549999999999997 23.075000000000003 7 15.725 20.575 42.225 21.475 8 20.200000000000003 21.224999999999998 26.924999999999997 31.65 9 21.625 19.85 30.349999999999998 28.175 10-14 22.765 26.384999999999998 24.93 25.919999999999998 15-19 23.03 25.074999999999996 25.955000000000002 25.94 20-24 23.405 24.67 25.869999999999997 26.055 25-29 22.78 25.480000000000004 25.575 26.165 30-34 22.165000000000003 25.335 26.584999999999997 25.915 35-39 23.265 25.36 25.590000000000003 25.785000000000004 40-44 23.505000000000003 25.6 25.290000000000003 25.605 45-49 23.455000000000002 25.995 25.040000000000003 25.509999999999998 50-54 23.47 25.385 25.46 25.685000000000002 55-59 23.425 25.8 24.965 25.81 60-64 23.7 24.775 25.424999999999997 26.1 65-69 23.84 25.69 24.925 25.545 70-74 23.715 25.330000000000002 24.715 26.240000000000002 75-79 23.78 24.86 25.759999999999998 25.6 80-84 24.005000000000003 25.009999999999998 25.174999999999997 25.81 85-89 24.47 25.330000000000002 24.8 25.4 90-94 23.830000000000002 25.240000000000002 24.935 25.995 95-99 24.195 24.44 25.47 25.895000000000003 100-104 24.015 24.815 25.080000000000002 26.090000000000003 105-109 23.745 24.88 25.045 26.33 110-114 23.630000000000003 24.805 25.319999999999997 26.245 115-119 24.154999999999998 24.68 25.28 25.885 120-124 24.505 24.275 25.480000000000004 25.740000000000002 125-129 24.285 24.610000000000003 25.085 26.02 130-134 24.27 24.654999999999998 25.569999999999997 25.505 135-139 24.175 24.7 24.945 26.179999999999996 140-144 23.810000000000002 24.855 25.195 26.14 145-149 24.165 24.775 25.16 25.900000000000002 150-151 24.637500000000003 24.175 24.625 26.5625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 0.0 27 0.0 28 3.0 29 6.0 30 6.0 31 11.0 32 16.5 33 21.5 34 30.0 35 38.5 36 46.0 37 63.0 38 90.0 39 111.0 40 123.5 41 139.0 42 170.0 43 190.5 44 188.5 45 199.5 46 198.5 47 191.5 48 193.5 49 173.5 50 162.0 51 161.5 52 139.5 53 111.5 54 98.5 55 95.5 56 94.0 57 86.5 58 77.0 59 69.5 60 69.5 61 66.0 62 59.5 63 58.5 64 53.0 65 55.0 66 51.5 67 49.5 68 44.5 69 33.5 70 32.5 71 26.5 72 21.0 73 16.5 74 12.0 75 12.0 76 13.5 77 9.0 78 3.5 79 1.5 80 1.0 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.49266247379455 91.10000000000001 2 4.1928721174004195 8.0 3 0.3144654088050315 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.0625 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.0875 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.2375 0.0 0.0 0.0 0.0 116-117 0.2625 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.42500000000000004 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.575 0.0 0.0 0.0 0.0 126-127 0.6499999999999999 0.0 0.0 0.0 0.0 128-129 0.7875 0.0 0.0 0.0 0.0 130-131 0.8625 0.0 0.0 0.0 0.0 132-133 0.925 0.0 0.0 0.0 0.0 134-135 1.0375 0.0 0.0 0.0 0.0 136-137 1.1375000000000002 0.0 0.0 0.0 0.0 138-139 1.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCAGAA 10 0.006830828 145.0 1 >>END_MODULE SRR7804172 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804172_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.337 37.0 37.0 37.0 37.0 37.0 2 35.9415 37.0 37.0 37.0 37.0 37.0 3 36.0095 37.0 37.0 37.0 37.0 37.0 4 36.173 37.0 37.0 37.0 37.0 37.0 5 36.202 37.0 37.0 37.0 37.0 37.0 6 36.097 37.0 37.0 37.0 37.0 37.0 7 36.071 37.0 37.0 37.0 37.0 37.0 8 36.2145 37.0 37.0 37.0 37.0 37.0 9 36.187 37.0 37.0 37.0 37.0 37.0 10-14 36.14450000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.08489999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.121 37.0 37.0 37.0 37.0 37.0 25-29 36.08109999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.0071 37.0 37.0 37.0 37.0 37.0 35-39 35.8781 37.0 37.0 37.0 37.0 37.0 40-44 35.8936 37.0 37.0 37.0 37.0 37.0 45-49 35.8503 37.0 37.0 37.0 37.0 37.0 50-54 35.8094 37.0 37.0 37.0 37.0 37.0 55-59 35.8167 37.0 37.0 37.0 37.0 37.0 60-64 35.6773 37.0 37.0 37.0 37.0 37.0 65-69 35.5816 37.0 37.0 37.0 37.0 37.0 70-74 35.6237 37.0 37.0 37.0 37.0 37.0 75-79 35.626799999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.5707 37.0 37.0 37.0 37.0 37.0 85-89 35.4539 37.0 37.0 37.0 37.0 37.0 90-94 35.3537 37.0 37.0 37.0 37.0 37.0 95-99 35.2598 37.0 37.0 37.0 32.2 37.0 100-104 35.2441 37.0 37.0 37.0 32.2 37.0 105-109 35.1366 37.0 37.0 37.0 25.0 37.0 110-114 35.0168 37.0 37.0 37.0 25.0 37.0 115-119 34.9722 37.0 37.0 37.0 25.0 37.0 120-124 34.9091 37.0 37.0 37.0 25.0 37.0 125-129 34.825700000000005 37.0 37.0 37.0 25.0 37.0 130-134 34.8039 37.0 37.0 37.0 25.0 37.0 135-139 34.535799999999995 37.0 37.0 37.0 25.0 37.0 140-144 34.4533 37.0 37.0 37.0 25.0 37.0 145-149 34.328199999999995 37.0 37.0 37.0 25.0 37.0 150-151 33.6215 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 0.0 16 1.0 17 2.0 18 1.0 19 1.0 20 2.0 21 0.0 22 4.0 23 7.0 24 13.0 25 7.0 26 16.0 27 8.0 28 33.0 29 21.0 30 49.0 31 64.0 32 98.0 33 191.0 34 338.0 35 870.0 36 2191.0 37 80.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.65 14.299999999999999 13.750000000000002 35.3 2 29.125 18.65 30.625000000000004 21.6 3 23.05 23.3 27.950000000000003 25.7 4 27.750000000000004 30.125 19.15 22.975 5 28.325 32.225 18.0 21.45 6 22.75 34.275 19.475 23.5 7 21.075 16.575 36.95 25.4 8 22.45 20.200000000000003 22.75 34.599999999999994 9 23.25 21.625 25.85 29.275000000000002 10-14 25.355 25.505 22.715 26.424999999999997 15-19 25.335 24.709999999999997 24.07 25.885 20-24 25.035 24.884999999999998 24.165 25.915 25-29 25.75 24.755 23.93 25.564999999999998 30-34 25.224999999999998 24.495 24.15 26.13 35-39 26.02 24.93 23.474999999999998 25.575 40-44 25.945 24.175 24.055 25.825 45-49 26.150000000000002 24.59 24.05 25.21 50-54 25.55 24.45 24.474999999999998 25.525 55-59 25.83 24.610000000000003 23.674999999999997 25.885 60-64 26.38 25.055 23.815 24.75 65-69 25.935000000000002 24.995 23.835 25.235000000000003 70-74 26.32 25.369999999999997 23.16 25.15 75-79 26.14 24.545 24.16 25.155 80-84 26.484999999999996 25.235000000000003 23.835 24.445 85-89 27.08 24.42 23.990000000000002 24.51 90-94 26.584999999999997 24.6 23.51 25.305 95-99 26.655 24.884999999999998 23.674999999999997 24.785 100-104 26.314999999999998 25.15 23.61 24.925 105-109 26.105 25.105 23.87 24.92 110-114 27.045 25.230000000000004 23.275000000000002 24.45 115-119 26.56 25.09 23.865 24.485 120-124 26.185000000000002 25.15 24.349999999999998 24.315 125-129 26.765 25.435000000000002 23.669999999999998 24.13 130-134 26.540000000000003 25.679999999999996 23.66 24.12 135-139 25.955000000000002 25.235000000000003 24.64 24.169999999999998 140-144 25.94 25.224999999999998 24.265 24.57 145-149 26.419999999999998 25.44 24.099999999999998 24.04 150-151 26.387500000000003 25.8125 23.275000000000002 24.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 2.0 27 1.5 28 1.5 29 3.0 30 5.0 31 6.5 32 11.0 33 14.0 34 16.5 35 29.5 36 42.0 37 55.0 38 72.0 39 88.0 40 111.0 41 119.5 42 135.0 43 164.0 44 170.5 45 168.5 46 167.5 47 170.0 48 161.5 49 152.5 50 158.0 51 153.5 52 132.5 53 125.5 54 128.0 55 105.5 56 83.0 57 89.0 58 88.5 59 85.5 60 88.5 61 78.5 62 73.0 63 73.5 64 75.5 65 72.5 66 67.5 67 67.0 68 64.5 69 59.5 70 49.5 71 41.5 72 36.0 73 31.0 74 31.0 75 25.0 76 16.5 77 11.5 78 7.5 79 4.0 80 1.5 81 0.5 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.975 #Duplication Level Percentage of deduplicated Percentage of total 1 95.15662016320084 90.375 2 4.5538299552513815 8.649999999999999 3 0.23690444853908924 0.675 4 0.0 0.0 5 0.0 0.0 6 0.052645433008686494 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTC 6 0.15 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.0625 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.0875 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.2375 0.0 0.0 0.0 0.0 116-117 0.2625 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.42500000000000004 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.575 0.0 0.0 0.0 0.0 126-127 0.6499999999999999 0.0 0.0 0.0 0.0 128-129 0.7875 0.0 0.0 0.0 0.0 130-131 0.8625 0.0 0.0 0.0 0.0 132-133 0.925 0.0 0.0 0.0 0.0 134-135 1.0375 0.0 0.0 0.0 0.0 136-137 1.1375000000000002 0.0 0.0 0.0 0.0 138-139 1.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATGAT 10 0.006830828 145.0 8 >>END_MODULE Read 1562284 spots for SRR7804172.sra Written 1562284 spots for SRR7804172.sra Read 1562284 spots for SRR7804172.sra Written 1562284 spots for SRR7804172.sra Read 1562284 spots for SRR7804172.sra Written 1562284 spots for SRR7804172.sra Read 1562284 spots for SRR7804172.sra Written 1562284 spots for SRR7804172.sra Read 1562284 spots for SRR7804172.sra Written 1562284 spots for SRR7804172.sra Read 1562284 spots for SRR7804172.sra Written 1562284 spots for SRR7804172.sra Read 1562284 spots for SRR7804172.sra Written 1562284 spots for SRR7804172.sra Read 1562284 spots for SRR7804172.sra Written 1562284 spots for SRR7804172.sra Read 1562284 spots for SRR7804172.sra Written 1562284 spots for SRR7804172.sra Read 1562294 spots for SRR7804172.sra Written 1562294 spots for SRR7804172.sra Read 1562284 spots for SRR7804172.sra Written 1562284 spots for SRR7804172.sra Read 1562284 spots for SRR7804172.sra Written 1562284 spots for SRR7804172.sra Read 1562284 spots for SRR7804172.sra Written 1562284 spots for SRR7804172.sra Read 1562284 spots for SRR7804172.sra Written 1562284 spots for SRR7804172.sra Read 1562284 spots for SRR7804172.sra Written 1562284 spots for SRR7804172.sra Read 1562284 spots for SRR7804172.sra Written 1562284 spots for SRR7804172.sra Read 1562284 spots for SRR7804172.sra Written 1562284 spots for SRR7804172.sra Read 1562284 spots for SRR7804172.sra Written 1562284 spots for SRR7804172.sra Read 1562284 spots for SRR7804172.sra Written 1562284 spots for SRR7804172.sra Read 1562284 spots for SRR7804172.sra Written 1562284 spots for SRR7804172.sra SRR ids: ['SRR7804172.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y41y_533 SRR7804172.sra spots: 31245690 blocks: [[1, 1562284], [1562285, 3124568], [3124569, 4686852], [4686853, 6249136], [6249137, 7811420], [7811421, 9373704], [9373705, 10935988], [10935989, 12498272], [12498273, 14060556], [14060557, 15622840], [15622841, 17185124], [17185125, 18747408], [18747409, 20309692], [20309693, 21871976], [21871977, 23434260], [23434261, 24996544], [24996545, 26558828], [26558829, 28121112], [28121113, 29683396], [29683397, 31245690]] SRR7804172 file size 10566438 SRR7804172 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804172 SRR7804172_1.fastq SRR7804172_2.fastq Input file: SRR7804172_1.fastq Paired file: SRR7804172_2.fastq trimmed: SRR7804172-trimmed-pair1.fastq, SRR7804172-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:45:36 2024 >> started Sat Dec 7 17:46:14 2024 >> done (38.207s) 31245690 read pairs processed; of these: 89 ( 0.00%) short read pairs filtered out after trimming by size control 515 ( 0.00%) empty read pairs filtered out after trimming by size control 31245086 (100.00%) read pairs available; of these: 661969 ( 2.12%) trimmed read pairs available after processing 30583117 (97.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 19 0.00% 20 15 0.00% 21 25 0.00% 22 28 0.00% 23 37 0.00% 24 28 0.00% 25 35 0.00% 26 44 0.00% 27 58 0.00% 28 45 0.00% 29 52 0.00% 30 61 0.00% 31 59 0.00% 32 69 0.00% 33 55 0.00% 34 65 0.00% 35 69 0.00% 36 76 0.00% 37 75 0.00% 38 87 0.00% 39 90 0.00% 40 82 0.00% 41 70 0.00% 42 85 0.00% 43 89 0.00% 44 91 0.00% 45 88 0.00% 46 106 0.00% 47 93 0.00% 48 94 0.00% 49 98 0.00% 50 97 0.00% 51 101 0.00% 52 108 0.00% 53 112 0.00% 54 106 0.00% 55 134 0.00% 56 135 0.00% 57 133 0.00% 58 99 0.00% 59 132 0.00% 60 136 0.00% 61 145 0.00% 62 135 0.00% 63 137 0.00% 64 146 0.00% 65 146 0.00% 66 165 0.00% 67 152 0.00% 68 168 0.00% 69 180 0.00% 70 177 0.00% 71 200 0.00% 72 206 0.00% 73 199 0.00% 74 238 0.00% 75 248 0.00% 76 232 0.00% 77 261 0.00% 78 311 0.00% 79 379 0.00% 80 349 0.00% 81 360 0.00% 82 433 0.00% 83 483 0.00% 84 539 0.00% 85 524 0.00% 86 653 0.00% 87 647 0.00% 88 718 0.00% 89 737 0.00% 90 886 0.00% 91 941 0.00% 92 1115 0.00% 93 1191 0.00% 94 1330 0.00% 95 1443 0.00% 96 1619 0.01% 97 1645 0.01% 98 1756 0.01% 99 1934 0.01% 100 2095 0.01% 101 2262 0.01% 102 2525 0.01% 103 2862 0.01% 104 3001 0.01% 105 3297 0.01% 106 3490 0.01% 107 3736 0.01% 108 3921 0.01% 109 4027 0.01% 110 4297 0.01% 111 4679 0.01% 112 5177 0.02% 113 5592 0.02% 114 5974 0.02% 115 6366 0.02% 116 6769 0.02% 117 6978 0.02% 118 7205 0.02% 119 7500 0.02% 120 7911 0.03% 121 8375 0.03% 122 8912 0.03% 123 9568 0.03% 124 10332 0.03% 125 10762 0.03% 126 11444 0.04% 127 11772 0.04% 128 12028 0.04% 129 12805 0.04% 130 13091 0.04% 131 13574 0.04% 132 14662 0.05% 133 15305 0.05% 134 16221 0.05% 135 17230 0.06% 136 18274 0.06% 137 18535 0.06% 138 19296 0.06% 139 19720 0.06% 140 19806 0.06% 141 20593 0.07% 142 22048 0.07% 143 22517 0.07% 144 23942 0.08% 145 25291 0.08% 146 26415 0.08% 147 27013 0.09% 148 28345 0.09% 149 28592 0.09% 150 29415 0.09% 151 30583117 97.88% 31245086 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=6.45 fanout-score-rank=17 prefix-density=0.31 prefix-fanout=4.7 sequence=GCATTCTTCACAGCCCTGACCGTGGCGGATTCGGGCCTAAGGGTTTGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=23 fanout-score=97.73 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=18.1 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=32 prefix-density=0.67 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=845.00 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=22.3 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATG SRR7804172 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:47:25 Started mapping on | Dec 07 17:47:25 Finished on | Dec 07 17:55:48 Mapping speed, Million of reads per hour | 223.62 Number of input reads | 31245086 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 28534876 Uniquely mapped reads % | 91.33% Average mapped length | 300.10 Number of splices: Total | 28999115 Number of splices: Annotated (sjdb) | 26977254 Number of splices: GT/AG | 28613421 Number of splices: GC/AG | 322364 Number of splices: AT/AC | 21198 Number of splices: Non-canonical | 42132 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.01% Deletion average length | 2.78 Insertion rate per base | 0.01% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 385270 % of reads mapped to multiple loci | 1.23% Number of reads mapped to too many loci | 9251 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.19% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2324940 2324940 2324940 N_multimapping 385270 385270 385270 N_noFeature 896579 27574582 1304037 N_ambiguous 662396 5730 108618 UnstrandedReadsAssigned:26975901 PositiveStrandReadsAssigned:954564 NegativeStrandReadsAssigned:27122221 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804172 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804172-trimmed-pair1.fastq SRR7804172-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,245,086 reads, 27,518,764 reads pseudoaligned [quant] estimated average fragment length: 335.592 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,231 rounds 52973 SRR7804172.ke.tsv 35125 SRR7804172.se.tsv 88098 total ==> SRR7804172.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 602.808 0 0 PNS24247 1044 709.408 101.93 7.01402 PNS24249 1928 1593.41 296.095 9.07123 PNS24246 1044 709.408 101.93 7.01402 PNS24248 1044 709.408 101.93 7.01402 PNS24244 1471 1136.41 162.116 6.96393 PNS24243 293 69.215 3 2.11584 KQK14069 1603 1268.41 7131.64 274.469 KQK14071 474 187.746 47.5947 12.3751 ==> SRR7804172.se.tsv <== BRADI_1g14170v3 7438 BRADI_1g53295v3 442 BRADI_1g59795v3 764 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 382 BRADI_1g74790v3 334 BRADI_1g09890v3 0 BRADI_1g77505v3 377 BRADI_1g48960v3 0 SRR7804172 completed mapping pipeline successfully