Starting /dee2/code/volunteer_pipeline.sh SRR7804173 current disk space = 1541154975744 free memory = 1444048840 SRR7804173 SRAfilesize e3404fc1d469a9de57b4ed4db3e108ee SRR7804173.sra SRR7804173.sra file validated SRR7804173 is paired end SRR7804173 is conventional basespace SRR7804173 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804173_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.16925 37.0 37.0 37.0 37.0 37.0 2 36.2535 37.0 37.0 37.0 37.0 37.0 3 36.3875 37.0 37.0 37.0 37.0 37.0 4 36.5055 37.0 37.0 37.0 37.0 37.0 5 36.573 37.0 37.0 37.0 37.0 37.0 6 36.624 37.0 37.0 37.0 37.0 37.0 7 36.3885 37.0 37.0 37.0 37.0 37.0 8 36.5305 37.0 37.0 37.0 37.0 37.0 9 36.4455 37.0 37.0 37.0 37.0 37.0 10-14 36.5636 37.0 37.0 37.0 37.0 37.0 15-19 36.537099999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.50019999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.4525 37.0 37.0 37.0 37.0 37.0 30-34 36.444399999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.4014 37.0 37.0 37.0 37.0 37.0 40-44 36.34160000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.2633 37.0 37.0 37.0 37.0 37.0 50-54 36.268299999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.2301 37.0 37.0 37.0 37.0 37.0 60-64 36.1735 37.0 37.0 37.0 37.0 37.0 65-69 36.18149999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.0684 37.0 37.0 37.0 37.0 37.0 75-79 36.1054 37.0 37.0 37.0 37.0 37.0 80-84 36.107299999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.0339 37.0 37.0 37.0 37.0 37.0 90-94 35.9892 37.0 37.0 37.0 37.0 37.0 95-99 35.9231 37.0 37.0 37.0 37.0 37.0 100-104 35.8586 37.0 37.0 37.0 37.0 37.0 105-109 35.8228 37.0 37.0 37.0 37.0 37.0 110-114 35.797200000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.695 37.0 37.0 37.0 37.0 37.0 120-124 35.6365 37.0 37.0 37.0 37.0 37.0 125-129 35.6127 37.0 37.0 37.0 37.0 37.0 130-134 35.464 37.0 37.0 37.0 37.0 37.0 135-139 35.4351 37.0 37.0 37.0 37.0 37.0 140-144 35.3586 37.0 37.0 37.0 32.2 37.0 145-149 35.2604 37.0 37.0 37.0 29.8 37.0 150-151 34.61325 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 4.0 25 4.0 26 7.0 27 10.0 28 19.0 29 27.0 30 31.0 31 34.0 32 75.0 33 113.0 34 176.0 35 479.0 36 2793.0 37 227.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.79784298971658 12.515675946827187 10.484073238023576 39.20240782543266 2 25.5 19.025 32.925 22.55 3 21.875 25.3 23.35 29.475 4 26.775 30.025000000000002 19.2 24.0 5 25.924999999999997 32.95 20.599999999999998 20.525 6 22.1 32.6 22.975 22.325 7 16.325 20.1 42.375 21.2 8 20.974999999999998 21.375 26.474999999999998 31.175000000000004 9 20.849999999999998 18.85 31.674999999999997 28.625 10-14 23.98 26.229999999999997 24.165 25.624999999999996 15-19 23.745 24.779999999999998 24.845 26.63 20-24 23.3 25.369999999999997 25.135 26.195 25-29 24.03 24.455 25.485000000000003 26.029999999999998 30-34 23.41 25.180000000000003 25.09 26.32 35-39 23.369999999999997 25.525 24.765 26.340000000000003 40-44 23.27 25.224999999999998 25.205 26.3 45-49 24.044999999999998 24.72 24.93 26.305 50-54 23.695 24.69 25.34 26.275 55-59 24.48 24.635 24.43 26.455000000000002 60-64 23.48 24.83 25.180000000000003 26.51 65-69 24.235 24.33 24.205 27.229999999999997 70-74 24.82 24.115000000000002 24.25 26.815 75-79 24.385 24.335 24.54 26.740000000000002 80-84 25.215 24.68 24.415 25.69 85-89 24.33 24.195 24.305 27.169999999999998 90-94 24.165 24.29 24.805 26.740000000000002 95-99 25.195 23.91 24.45 26.445 100-104 24.79 24.29 24.395 26.525 105-109 24.415 24.610000000000003 24.69 26.284999999999997 110-114 24.415 23.875 24.685000000000002 27.025 115-119 25.095 23.93 24.73 26.245 120-124 25.025 24.205 24.16 26.61 125-129 25.224999999999998 23.669999999999998 24.145 26.96 130-134 25.419999999999998 24.610000000000003 23.595 26.375 135-139 24.97 24.3 23.655 27.075 140-144 25.45 23.91 24.075 26.565 145-149 25.775 23.419999999999998 23.68 27.125 150-151 25.025 24.275 23.9875 26.7125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.5 25 1.0 26 0.0 27 0.5 28 2.5 29 6.0 30 9.0 31 10.0 32 11.5 33 17.0 34 25.0 35 41.5 36 53.5 37 73.5 38 95.5 39 112.0 40 125.5 41 136.0 42 154.5 43 155.5 44 163.0 45 176.0 46 175.5 47 182.0 48 174.0 49 145.5 50 133.0 51 136.5 52 117.0 53 100.5 54 98.0 55 100.0 56 96.0 57 86.5 58 88.0 59 84.5 60 84.5 61 78.0 62 66.0 63 65.5 64 73.5 65 79.5 66 73.5 67 58.0 68 55.0 69 53.0 70 49.5 71 45.0 72 34.5 73 27.0 74 19.0 75 13.5 76 8.5 77 7.0 78 5.0 79 2.0 80 1.5 81 1.0 82 2.0 83 2.0 84 1.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.75 #Duplication Level Percentage of deduplicated Percentage of total 1 94.82849604221636 89.85 2 4.802110817941953 9.1 3 0.36939313984168864 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.037500000000000006 0.0 0.0 0.0 0.0 112-113 0.05 0.0 0.0 0.0 0.0 114-115 0.075 0.0 0.0 0.0 0.0 116-117 0.075 0.0 0.0 0.0 0.0 118-119 0.1375 0.0 0.0 0.0 0.0 120-121 0.15 0.0 0.0 0.0 0.0 122-123 0.2 0.0 0.0 0.0 0.0 124-125 0.2 0.0 0.0 0.0 0.0 126-127 0.21250000000000002 0.0 0.0 0.0 0.0 128-129 0.2375 0.0 0.0 0.0 0.0 130-131 0.2875 0.0 0.0 0.0 0.0 132-133 0.4 0.0 0.0 0.0 0.0 134-135 0.5125 0.0 0.0 0.0 0.0 136-137 0.6125 0.0 0.0 0.0 0.0 138-139 0.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGGCC 10 0.006830828 145.0 6 CAAGTTC 10 0.006830828 145.0 3 AATTGGC 10 0.006830828 145.0 5 >>END_MODULE SRR7804173 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804173_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.523 37.0 37.0 37.0 37.0 37.0 2 36.1645 37.0 37.0 37.0 37.0 37.0 3 36.27 37.0 37.0 37.0 37.0 37.0 4 36.326 37.0 37.0 37.0 37.0 37.0 5 36.4915 37.0 37.0 37.0 37.0 37.0 6 36.3055 37.0 37.0 37.0 37.0 37.0 7 36.2545 37.0 37.0 37.0 37.0 37.0 8 36.423 37.0 37.0 37.0 37.0 37.0 9 36.369 37.0 37.0 37.0 37.0 37.0 10-14 36.3259 37.0 37.0 37.0 37.0 37.0 15-19 36.2894 37.0 37.0 37.0 37.0 37.0 20-24 36.2821 37.0 37.0 37.0 37.0 37.0 25-29 36.2001 37.0 37.0 37.0 37.0 37.0 30-34 36.1669 37.0 37.0 37.0 37.0 37.0 35-39 36.102900000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.07599999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.0024 37.0 37.0 37.0 37.0 37.0 50-54 35.972 37.0 37.0 37.0 37.0 37.0 55-59 35.9559 37.0 37.0 37.0 37.0 37.0 60-64 35.8405 37.0 37.0 37.0 37.0 37.0 65-69 35.8603 37.0 37.0 37.0 37.0 37.0 70-74 35.8039 37.0 37.0 37.0 37.0 37.0 75-79 35.764799999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.650099999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.6043 37.0 37.0 37.0 37.0 37.0 90-94 35.6025 37.0 37.0 37.0 37.0 37.0 95-99 35.517199999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.4281 37.0 37.0 37.0 37.0 37.0 105-109 35.3667 37.0 37.0 37.0 37.0 37.0 110-114 35.2534 37.0 37.0 37.0 32.2 37.0 115-119 35.07 37.0 37.0 37.0 25.0 37.0 120-124 35.0791 37.0 37.0 37.0 25.0 37.0 125-129 35.0068 37.0 37.0 37.0 25.0 37.0 130-134 34.928200000000004 37.0 37.0 37.0 25.0 37.0 135-139 34.692400000000006 37.0 37.0 37.0 25.0 37.0 140-144 34.5802 37.0 37.0 37.0 25.0 37.0 145-149 34.4947 37.0 37.0 37.0 25.0 37.0 150-151 33.7425 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 0.0 16 1.0 17 0.0 18 1.0 19 5.0 20 0.0 21 3.0 22 1.0 23 7.0 24 9.0 25 9.0 26 12.0 27 13.0 28 20.0 29 24.0 30 34.0 31 43.0 32 92.0 33 144.0 34 298.0 35 796.0 36 2405.0 37 80.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.425000000000004 13.875000000000002 12.45 37.25 2 30.375000000000004 19.475 29.175 20.974999999999998 3 24.525 22.400000000000002 26.700000000000003 26.375 4 28.65 29.525000000000002 17.675 24.15 5 28.775000000000002 31.6 17.575 22.05 6 22.275 33.35 20.025000000000002 24.349999999999998 7 22.175 15.25 36.25 26.325 8 22.2 19.950000000000003 22.400000000000002 35.449999999999996 9 22.75 20.674999999999997 25.025 31.55 10-14 25.840000000000003 24.709999999999997 22.13 27.32 15-19 26.255 23.995 23.025000000000002 26.724999999999998 20-24 26.465 24.19 22.465 26.88 25-29 26.26 23.805 22.994999999999997 26.939999999999998 30-34 26.0 23.735 23.11 27.155 35-39 26.615 23.705000000000002 22.650000000000002 27.029999999999998 40-44 26.340000000000003 23.65 23.25 26.76 45-49 26.97 23.48 22.78 26.77 50-54 26.82 23.49 23.244999999999997 26.445 55-59 26.505000000000003 23.485 22.770000000000003 27.24 60-64 27.07 23.94 22.46 26.529999999999998 65-69 26.575 23.565 22.884999999999998 26.974999999999998 70-74 26.595000000000002 23.419999999999998 22.66 27.325 75-79 26.63 23.0 23.294999999999998 27.075 80-84 26.979999999999997 24.05 22.485 26.484999999999996 85-89 26.415 23.65 23.400000000000002 26.534999999999997 90-94 27.384999999999998 23.630000000000003 22.54 26.445 95-99 27.705000000000002 23.605 22.535 26.155 100-104 27.27 23.415 22.675 26.640000000000004 105-109 26.87 23.73 22.945 26.455000000000002 110-114 27.055 23.93 22.475 26.540000000000003 115-119 27.025 24.22 22.17 26.584999999999997 120-124 27.544999999999998 24.05 22.43 25.974999999999998 125-129 26.91 23.79 22.775000000000002 26.525 130-134 27.495000000000005 23.89 22.78 25.835 135-139 27.675 24.2 22.33 25.795 140-144 27.665 24.085 22.825 25.424999999999997 145-149 27.295 23.56 22.994999999999997 26.150000000000002 150-151 27.200000000000003 23.775 23.35 25.674999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.5 27 2.5 28 4.0 29 6.0 30 9.0 31 12.0 32 10.5 33 14.0 34 21.0 35 24.5 36 28.0 37 36.0 38 53.0 39 70.0 40 84.5 41 107.0 42 124.0 43 134.0 44 142.5 45 146.0 46 145.0 47 153.0 48 168.5 49 149.0 50 122.0 51 114.5 52 105.5 53 97.5 54 87.5 55 89.0 56 92.0 57 83.0 58 96.0 59 102.5 60 97.0 61 107.0 62 104.5 63 95.0 64 100.0 65 102.0 66 95.5 67 90.5 68 88.0 69 81.0 70 72.5 71 65.5 72 60.0 73 56.5 74 46.0 75 30.0 76 21.0 77 17.0 78 9.5 79 6.0 80 3.5 81 1.0 82 2.5 83 2.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.1 #Duplication Level Percentage of deduplicated Percentage of total 1 94.44739638682252 88.875 2 4.994686503719448 9.4 3 0.45164718384697133 1.275 4 0.053134962805526036 0.2 5 0.053134962805526036 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.037500000000000006 0.0 0.0 0.0 0.0 110-111 0.0625 0.0 0.0 0.0 0.0 112-113 0.0875 0.0 0.0 0.0 0.0 114-115 0.125 0.0 0.0 0.0 0.0 116-117 0.125 0.0 0.0 0.0 0.0 118-119 0.1875 0.0 0.0 0.0 0.0 120-121 0.2 0.0 0.0 0.0 0.0 122-123 0.25 0.0 0.0 0.0 0.0 124-125 0.25 0.0 0.0 0.0 0.0 126-127 0.2625 0.0 0.0 0.0 0.0 128-129 0.3125 0.0 0.0 0.0 0.0 130-131 0.3625 0.0 0.0 0.0 0.0 132-133 0.475 0.0 0.0 0.0 0.0 134-135 0.5875 0.0 0.0 0.0 0.0 136-137 0.675 0.0 0.0 0.0 0.0 138-139 0.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1781782 spots for SRR7804173.sra Written 1781782 spots for SRR7804173.sra Read 1781799 spots for SRR7804173.sra Written 1781799 spots for SRR7804173.sra Read 1781782 spots for SRR7804173.sra Written 1781782 spots for SRR7804173.sra Read 1781782 spots for SRR7804173.sra Written 1781782 spots for SRR7804173.sra Read 1781782 spots for SRR7804173.sra Written 1781782 spots for SRR7804173.sra Read 1781782 spots for SRR7804173.sra Written 1781782 spots for SRR7804173.sra Read 1781782 spots for SRR7804173.sra Written 1781782 spots for SRR7804173.sra Read 1781782 spots for SRR7804173.sra Written 1781782 spots for SRR7804173.sra Read 1781782 spots for SRR7804173.sra Written 1781782 spots for SRR7804173.sra Read 1781782 spots for SRR7804173.sra Written 1781782 spots for SRR7804173.sra Read 1781782 spots for SRR7804173.sra Written 1781782 spots for SRR7804173.sra Read 1781782 spots for SRR7804173.sra Written 1781782 spots for SRR7804173.sra Read 1781782 spots for SRR7804173.sra Written 1781782 spots for SRR7804173.sra Read 1781782 spots for SRR7804173.sra Written 1781782 spots for SRR7804173.sra Read 1781782 spots for SRR7804173.sra Written 1781782 spots for SRR7804173.sra Read 1781782 spots for SRR7804173.sra Written 1781782 spots for SRR7804173.sra Read 1781782 spots for SRR7804173.sra Written 1781782 spots for SRR7804173.sra Read 1781782 spots for SRR7804173.sra Written 1781782 spots for SRR7804173.sra Read 1781782 spots for SRR7804173.sra Written 1781782 spots for SRR7804173.sra Read 1781782 spots for SRR7804173.sra Written 1781782 spots for SRR7804173.sra SRR ids: ['SRR7804173.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2goc3xmj SRR7804173.sra spots: 35635657 blocks: [[1, 1781782], [1781783, 3563564], [3563565, 5345346], [5345347, 7127128], [7127129, 8908910], [8908911, 10690692], [10690693, 12472474], [12472475, 14254256], [14254257, 16036038], [16036039, 17817820], [17817821, 19599602], [19599603, 21381384], [21381385, 23163166], [23163167, 24944948], [24944949, 26726730], [26726731, 28508512], [28508513, 30290294], [30290295, 32072076], [32072077, 33853858], [33853859, 35635657]] SRR7804173 file size 12054054 SRR7804173 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804173 SRR7804173_1.fastq SRR7804173_2.fastq Input file: SRR7804173_1.fastq Paired file: SRR7804173_2.fastq trimmed: SRR7804173-trimmed-pair1.fastq, SRR7804173-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:46:49 2024 >> started Sat Dec 7 17:47:32 2024 >> done (43.607s) 35635657 read pairs processed; of these: 128 ( 0.00%) short read pairs filtered out after trimming by size control 1022 ( 0.00%) empty read pairs filtered out after trimming by size control 35634507 (100.00%) read pairs available; of these: 644894 ( 1.81%) trimmed read pairs available after processing 34989613 (98.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 18 0.00% 20 22 0.00% 21 25 0.00% 22 20 0.00% 23 21 0.00% 24 39 0.00% 25 42 0.00% 26 28 0.00% 27 41 0.00% 28 55 0.00% 29 36 0.00% 30 47 0.00% 31 59 0.00% 32 50 0.00% 33 63 0.00% 34 41 0.00% 35 50 0.00% 36 67 0.00% 37 69 0.00% 38 54 0.00% 39 55 0.00% 40 78 0.00% 41 47 0.00% 42 84 0.00% 43 65 0.00% 44 59 0.00% 45 67 0.00% 46 72 0.00% 47 76 0.00% 48 93 0.00% 49 77 0.00% 50 75 0.00% 51 95 0.00% 52 81 0.00% 53 91 0.00% 54 106 0.00% 55 109 0.00% 56 99 0.00% 57 114 0.00% 58 86 0.00% 59 116 0.00% 60 99 0.00% 61 118 0.00% 62 133 0.00% 63 102 0.00% 64 140 0.00% 65 159 0.00% 66 113 0.00% 67 153 0.00% 68 158 0.00% 69 157 0.00% 70 154 0.00% 71 208 0.00% 72 193 0.00% 73 244 0.00% 74 206 0.00% 75 245 0.00% 76 267 0.00% 77 276 0.00% 78 310 0.00% 79 390 0.00% 80 373 0.00% 81 425 0.00% 82 464 0.00% 83 505 0.00% 84 558 0.00% 85 594 0.00% 86 628 0.00% 87 714 0.00% 88 776 0.00% 89 883 0.00% 90 959 0.00% 91 1062 0.00% 92 1150 0.00% 93 1276 0.00% 94 1423 0.00% 95 1492 0.00% 96 1680 0.00% 97 1878 0.01% 98 1967 0.01% 99 2095 0.01% 100 2376 0.01% 101 2470 0.01% 102 2749 0.01% 103 2826 0.01% 104 3222 0.01% 105 3440 0.01% 106 3637 0.01% 107 3971 0.01% 108 4087 0.01% 109 4374 0.01% 110 4704 0.01% 111 5023 0.01% 112 5349 0.02% 113 5781 0.02% 114 6158 0.02% 115 6589 0.02% 116 6628 0.02% 117 6791 0.02% 118 7386 0.02% 119 7800 0.02% 120 8026 0.02% 121 8653 0.02% 122 9083 0.03% 123 9586 0.03% 124 10042 0.03% 125 10693 0.03% 126 11070 0.03% 127 11514 0.03% 128 11869 0.03% 129 12413 0.03% 130 12699 0.04% 131 13440 0.04% 132 14336 0.04% 133 14719 0.04% 134 15479 0.04% 135 16304 0.05% 136 17268 0.05% 137 17543 0.05% 138 18118 0.05% 139 18954 0.05% 140 19399 0.05% 141 20165 0.06% 142 20667 0.06% 143 21737 0.06% 144 22890 0.06% 145 23668 0.07% 146 24822 0.07% 147 25711 0.07% 148 26087 0.07% 149 26736 0.08% 150 28504 0.08% 151 34989613 98.19% 35634507 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=3.28 fanout-score-rank=12 prefix-density=0.72 prefix-fanout=3.1 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTATGAGAGGGTCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=47.73 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.3 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=3.49 fanout-score-rank=15 prefix-density=0.71 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=158.18 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.7 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAG SRR7804173 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:48:29 Started mapping on | Dec 07 17:48:30 Finished on | Dec 07 17:53:51 Mapping speed, Million of reads per hour | 399.64 Number of input reads | 35634507 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 33809973 Uniquely mapped reads % | 94.88% Average mapped length | 300.29 Number of splices: Total | 36084578 Number of splices: Annotated (sjdb) | 34002111 Number of splices: GT/AG | 35540760 Number of splices: GC/AG | 480927 Number of splices: AT/AC | 15014 Number of splices: Non-canonical | 47877 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.48 Insertion rate per base | 0.01% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 328407 % of reads mapped to multiple loci | 0.92% Number of reads mapped to too many loci | 25990 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.61% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1496127 1496127 1496127 N_multimapping 328407 328407 328407 N_noFeature 1088859 32732587 1362191 N_ambiguous 977953 6074 174621 UnstrandedReadsAssigned:31743161 PositiveStrandReadsAssigned:1071312 NegativeStrandReadsAssigned:32273161 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804173 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804173-trimmed-pair1.fastq SRR7804173-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,634,507 reads, 32,433,115 reads pseudoaligned [quant] estimated average fragment length: 344.21 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,225 rounds 52973 SRR7804173.ke.tsv 35125 SRR7804173.se.tsv 88098 total ==> SRR7804173.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 594.021 0 0 PNS24247 1044 700.79 87.6742 4.74942 PNS24249 1928 1584.79 162.646 3.89609 PNS24246 1044 700.79 87.6742 4.74942 PNS24248 1044 700.79 87.6742 4.74942 PNS24244 1471 1127.79 119.331 4.01681 PNS24243 293 67.017 0 0 KQK14069 1603 1259.79 4725.21 142.39 KQK14071 474 180.82 58.3724 12.2551 ==> SRR7804173.se.tsv <== BRADI_1g14170v3 5007 BRADI_1g53295v3 228 BRADI_1g59795v3 1203 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 453 BRADI_1g74790v3 784 BRADI_1g09890v3 0 BRADI_1g77505v3 505 BRADI_1g48960v3 0 SRR7804173 completed mapping pipeline successfully