Starting /dee2/code/volunteer_pipeline.sh SRR7804174 current disk space = 1525951045632 free memory = 1452575012 SRR7804174 SRAfilesize 8b227f24174f1edeedf6549820ffda42 SRR7804174.sra SRR7804174.sra file validated SRR7804174 is paired end SRR7804174 is conventional basespace SRR7804174 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804174_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0505 37.0 37.0 37.0 37.0 37.0 2 36.1755 37.0 37.0 37.0 37.0 37.0 3 36.2675 37.0 37.0 37.0 37.0 37.0 4 36.458 37.0 37.0 37.0 37.0 37.0 5 36.483 37.0 37.0 37.0 37.0 37.0 6 36.4815 37.0 37.0 37.0 37.0 37.0 7 36.401 37.0 37.0 37.0 37.0 37.0 8 36.3955 37.0 37.0 37.0 37.0 37.0 9 36.453 37.0 37.0 37.0 37.0 37.0 10-14 36.4724 37.0 37.0 37.0 37.0 37.0 15-19 36.448699999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.4229 37.0 37.0 37.0 37.0 37.0 25-29 36.392399999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.331100000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.3192 37.0 37.0 37.0 37.0 37.0 40-44 36.242200000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.1722 37.0 37.0 37.0 37.0 37.0 50-54 36.1813 37.0 37.0 37.0 37.0 37.0 55-59 36.1447 37.0 37.0 37.0 37.0 37.0 60-64 36.1626 37.0 37.0 37.0 37.0 37.0 65-69 36.0459 37.0 37.0 37.0 37.0 37.0 70-74 36.0041 37.0 37.0 37.0 37.0 37.0 75-79 35.9969 37.0 37.0 37.0 37.0 37.0 80-84 36.034699999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.956300000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.7896 37.0 37.0 37.0 37.0 37.0 95-99 35.7697 37.0 37.0 37.0 37.0 37.0 100-104 35.7383 37.0 37.0 37.0 37.0 37.0 105-109 35.7325 37.0 37.0 37.0 37.0 37.0 110-114 35.7457 37.0 37.0 37.0 37.0 37.0 115-119 35.6179 37.0 37.0 37.0 37.0 37.0 120-124 35.512100000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.493 37.0 37.0 37.0 37.0 37.0 130-134 35.4619 37.0 37.0 37.0 37.0 37.0 135-139 35.228899999999996 37.0 37.0 37.0 27.4 37.0 140-144 35.255599999999994 37.0 37.0 37.0 29.8 37.0 145-149 35.0971 37.0 37.0 37.0 27.4 37.0 150-151 34.4555 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 1.0 22 0.0 23 3.0 24 2.0 25 5.0 26 6.0 27 18.0 28 19.0 29 29.0 30 40.0 31 56.0 32 86.0 33 107.0 34 171.0 35 518.0 36 2716.0 37 222.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.769307923771315 13.0641925777332 9.929789368104313 37.236710130391174 2 25.874999999999996 18.325 33.25 22.55 3 22.475 25.775 23.45 28.299999999999997 4 27.224999999999998 29.875 19.375 23.525 5 25.275 31.075000000000003 22.400000000000002 21.25 6 21.125 32.125 22.425 24.325 7 17.575 19.025 39.35 24.05 8 22.775000000000002 17.8 26.900000000000002 32.525 9 21.45 16.7 30.625000000000004 31.225 10-14 24.035 24.77 23.9 27.295 15-19 24.81 23.419999999999998 25.365 26.405 20-24 25.174999999999997 23.805 24.240000000000002 26.779999999999998 25-29 24.935 23.945 24.165 26.955000000000002 30-34 24.815 24.154999999999998 24.404999999999998 26.625 35-39 24.834999999999997 23.41 24.355 27.400000000000002 40-44 25.405 23.82 24.415 26.36 45-49 24.69 23.225 24.855 27.229999999999997 50-54 24.279999999999998 23.724999999999998 23.82 28.175 55-59 24.14 24.19 24.245 27.425 60-64 25.259999999999998 23.880000000000003 23.87 26.99 65-69 24.709999999999997 23.865 23.89 27.534999999999997 70-74 25.15 23.400000000000002 24.025 27.425 75-79 25.365 22.8 23.925 27.91 80-84 25.27 23.625 23.73 27.375 85-89 24.815 23.7 23.75 27.735 90-94 25.97 23.085 24.465 26.479999999999997 95-99 25.27 23.01 24.095 27.625 100-104 25.75 23.380000000000003 23.56 27.310000000000002 105-109 25.629999999999995 23.61 23.65 27.11 110-114 26.02 23.535 23.615 26.83 115-119 26.095000000000002 22.98 23.615 27.310000000000002 120-124 26.534999999999997 22.895 23.405 27.165 125-129 25.485000000000003 23.200000000000003 23.97 27.345000000000002 130-134 26.400000000000002 23.29 23.445 26.865 135-139 26.090000000000003 23.24 23.505000000000003 27.165 140-144 26.174999999999997 23.175 23.35 27.3 145-149 26.040000000000003 22.875 23.630000000000003 27.455000000000002 150-151 27.250000000000004 22.0625 23.225 27.462500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 1.5 28 1.5 29 5.0 30 6.5 31 7.5 32 11.5 33 16.5 34 24.0 35 28.5 36 38.0 37 50.0 38 58.0 39 65.0 40 91.0 41 118.0 42 128.0 43 147.5 44 160.5 45 154.5 46 147.5 47 156.5 48 147.0 49 137.5 50 137.0 51 133.0 52 136.5 53 123.0 54 132.0 55 133.5 56 130.0 57 135.5 58 117.5 59 106.5 60 99.5 61 87.0 62 72.0 63 72.5 64 75.0 65 72.0 66 69.0 67 67.5 68 65.5 69 61.0 70 60.5 71 50.0 72 38.5 73 28.5 74 21.5 75 20.0 76 17.0 77 13.0 78 8.0 79 4.5 80 3.0 81 2.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.425 #Duplication Level Percentage of deduplicated Percentage of total 1 94.00588707519401 87.825 2 5.325127107305326 9.950000000000001 3 0.4013914905004014 1.125 4 0.16055659620016055 0.6 5 0.10703773080010703 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACT 5 0.125 No Hit CTTGTCCGTACCAGTTCTGAGTCGACTGTTCAGCGCTCGGGGAAAGCCCC 5 0.125 No Hit GTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCGGAACCCA 5 0.125 No Hit CAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACTAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.07500000000000001 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.42500000000000004 0.0 0.0 0.0 0.0 118-119 0.45 0.0 0.0 0.0 0.0 120-121 0.5125 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.7 0.0 0.0 0.0 0.0 126-127 0.75 0.0 0.0 0.0 0.0 128-129 0.85 0.0 0.0 0.0 0.0 130-131 0.975 0.0 0.0 0.0 0.0 132-133 1.075 0.0 0.0 0.0 0.0 134-135 1.2125 0.0 0.0 0.0 0.0 136-137 1.3 0.0 0.0 0.0 0.0 138-139 1.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGCTT 10 0.006830828 145.0 6 AGATCGG 10 0.006830828 145.0 145 >>END_MODULE SRR7804174 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804174_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3485 37.0 37.0 37.0 37.0 37.0 2 36.0885 37.0 37.0 37.0 37.0 37.0 3 36.0565 37.0 37.0 37.0 37.0 37.0 4 36.193 37.0 37.0 37.0 37.0 37.0 5 36.238 37.0 37.0 37.0 37.0 37.0 6 36.164 37.0 37.0 37.0 37.0 37.0 7 36.1235 37.0 37.0 37.0 37.0 37.0 8 36.1435 37.0 37.0 37.0 37.0 37.0 9 36.31 37.0 37.0 37.0 37.0 37.0 10-14 36.1714 37.0 37.0 37.0 37.0 37.0 15-19 36.11370000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.093 37.0 37.0 37.0 37.0 37.0 25-29 35.9719 37.0 37.0 37.0 37.0 37.0 30-34 36.0124 37.0 37.0 37.0 37.0 37.0 35-39 35.995 37.0 37.0 37.0 37.0 37.0 40-44 35.8606 37.0 37.0 37.0 37.0 37.0 45-49 35.8544 37.0 37.0 37.0 37.0 37.0 50-54 35.821 37.0 37.0 37.0 37.0 37.0 55-59 35.7882 37.0 37.0 37.0 37.0 37.0 60-64 35.6634 37.0 37.0 37.0 37.0 37.0 65-69 35.6946 37.0 37.0 37.0 37.0 37.0 70-74 35.6289 37.0 37.0 37.0 37.0 37.0 75-79 35.6051 37.0 37.0 37.0 37.0 37.0 80-84 35.525 37.0 37.0 37.0 37.0 37.0 85-89 35.3986 37.0 37.0 37.0 37.0 37.0 90-94 35.3976 37.0 37.0 37.0 37.0 37.0 95-99 35.217699999999994 37.0 37.0 37.0 29.8 37.0 100-104 35.19539999999999 37.0 37.0 37.0 27.4 37.0 105-109 35.076499999999996 37.0 37.0 37.0 25.0 37.0 110-114 35.0038 37.0 37.0 37.0 25.0 37.0 115-119 34.9003 37.0 37.0 37.0 25.0 37.0 120-124 34.8655 37.0 37.0 37.0 25.0 37.0 125-129 34.7618 37.0 37.0 37.0 25.0 37.0 130-134 34.5526 37.0 37.0 37.0 25.0 37.0 135-139 34.486000000000004 37.0 37.0 37.0 25.0 37.0 140-144 34.3198 37.0 37.0 37.0 25.0 37.0 145-149 34.2545 37.0 37.0 37.0 25.0 37.0 150-151 33.492000000000004 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 4.0 15 2.0 16 2.0 17 1.0 18 0.0 19 2.0 20 0.0 21 3.0 22 8.0 23 8.0 24 9.0 25 8.0 26 12.0 27 19.0 28 27.0 29 26.0 30 29.0 31 73.0 32 100.0 33 165.0 34 357.0 35 884.0 36 2193.0 37 67.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.825 11.95 11.075 37.15 2 30.575000000000003 18.9 27.1 23.425 3 25.374999999999996 23.025000000000002 26.1 25.5 4 28.549999999999997 30.525000000000002 15.575 25.35 5 29.625 31.175000000000004 17.299999999999997 21.9 6 23.3 32.45 18.075 26.174999999999997 7 21.5 14.45 36.449999999999996 27.6 8 24.375 18.15 22.025 35.449999999999996 9 25.15 20.9 22.875 31.075000000000003 10-14 27.41 24.245 21.305 27.04 15-19 27.13 24.099999999999998 21.7 27.07 20-24 27.325 24.015 21.59 27.07 25-29 27.185 24.2 21.77 26.845000000000002 30-34 27.11 24.065 21.65 27.175 35-39 27.525 23.419999999999998 22.24 26.815 40-44 27.79 23.48 21.45 27.279999999999998 45-49 27.425 23.45 22.075 27.05 50-54 27.605 23.305 21.975 27.115000000000002 55-59 27.46 23.03 21.87 27.639999999999997 60-64 28.065 22.91 21.65 27.375 65-69 28.055000000000003 22.615 21.81 27.52 70-74 27.615000000000002 22.455 22.205 27.725 75-79 27.91 23.025000000000002 21.725 27.339999999999996 80-84 27.51 23.39 21.55 27.55 85-89 28.28 23.145 22.155 26.419999999999998 90-94 27.685 23.05 21.834999999999997 27.43 95-99 28.595 23.474999999999998 21.38 26.55 100-104 27.845 23.669999999999998 21.745 26.740000000000002 105-109 28.199999999999996 23.515 21.505 26.779999999999998 110-114 27.755000000000003 23.41 21.565 27.27 115-119 28.095 23.35 22.02 26.534999999999997 120-124 27.6 23.21 21.584999999999997 27.605 125-129 28.09 24.005000000000003 21.240000000000002 26.665 130-134 28.035 23.51 21.93 26.525 135-139 28.435 23.380000000000003 21.85 26.334999999999997 140-144 28.27 24.115000000000002 21.555 26.06 145-149 27.465 23.84 21.685 27.01 150-151 28.575 24.4 21.525 25.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.0 8 0.5 9 0.5 10 1.0 11 0.5 12 0.0 13 0.5 14 1.5 15 1.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 0.0 26 0.5 27 2.0 28 3.0 29 4.0 30 4.0 31 2.5 32 6.0 33 9.0 34 16.0 35 22.0 36 25.5 37 33.5 38 38.0 39 50.0 40 62.0 41 77.0 42 96.0 43 103.0 44 118.0 45 130.0 46 122.5 47 127.0 48 122.0 49 119.0 50 134.0 51 135.5 52 120.5 53 111.0 54 124.5 55 124.0 56 117.5 57 119.0 58 114.0 59 122.0 60 124.0 61 112.0 62 111.0 63 108.5 64 99.5 65 92.0 66 90.0 67 97.0 68 106.0 69 99.5 70 81.5 71 67.5 72 61.0 73 54.5 74 45.0 75 35.0 76 25.0 77 17.5 78 12.5 79 9.0 80 6.0 81 3.5 82 3.5 83 2.5 84 0.5 85 1.5 86 1.0 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.05 #Duplication Level Percentage of deduplicated Percentage of total 1 93.39065018807094 86.9 2 5.910800644814616 11.0 3 0.6179473401397099 1.725 4 0.05373455131649651 0.2 5 0.0 0.0 6 0.0 0.0 7 0.026867275658248254 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.07500000000000001 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.44999999999999996 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.5375000000000001 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.725 0.0 0.0 0.0 0.0 126-127 0.775 0.0 0.0 0.0 0.0 128-129 0.875 0.0 0.0 0.0 0.0 130-131 1.0 0.0 0.0 0.0 0.0 132-133 1.1 0.0 0.0 0.0 0.0 134-135 1.2375 0.0 0.0 0.0 0.0 136-137 1.325 0.0 0.0 0.0 0.0 138-139 1.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATCGG 10 0.006830828 145.0 145 >>END_MODULE Read 1741670 spots for SRR7804174.sra Written 1741670 spots for SRR7804174.sra Read 1741670 spots for SRR7804174.sra Written 1741670 spots for SRR7804174.sra Read 1741670 spots for SRR7804174.sra Written 1741670 spots for SRR7804174.sra Read 1741670 spots for SRR7804174.sra Written 1741670 spots for SRR7804174.sra Read 1741670 spots for SRR7804174.sra Written 1741670 spots for SRR7804174.sra Read 1741670 spots for SRR7804174.sra Written 1741670 spots for SRR7804174.sra Read 1741670 spots for SRR7804174.sra Written 1741670 spots for SRR7804174.sra Read 1741670 spots for SRR7804174.sra Written 1741670 spots for SRR7804174.sra Read 1741670 spots for SRR7804174.sra Written 1741670 spots for SRR7804174.sra Read 1741670 spots for SRR7804174.sra Written 1741670 spots for SRR7804174.sra Read 1741670 spots for SRR7804174.sra Written 1741670 spots for SRR7804174.sra Read 1741670 spots for SRR7804174.sra Written 1741670 spots for SRR7804174.sra Read 1741670 spots for SRR7804174.sra Written 1741670 spots for SRR7804174.sra Read 1741670 spots for SRR7804174.sra Written 1741670 spots for SRR7804174.sra Read 1741670 spots for SRR7804174.sra Written 1741670 spots for SRR7804174.sra Read 1741670 spots for SRR7804174.sra Written 1741670 spots for SRR7804174.sra Read 1741670 spots for SRR7804174.sra Written 1741670 spots for SRR7804174.sra Read 1741670 spots for SRR7804174.sra Written 1741670 spots for SRR7804174.sra Read 1741670 spots for SRR7804174.sra Written 1741670 spots for SRR7804174.sra Read 1741671 spots for SRR7804174.sra Written 1741671 spots for SRR7804174.sra SRR ids: ['SRR7804174.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jr1aaj6_ SRR7804174.sra spots: 34833401 blocks: [[1, 1741670], [1741671, 3483340], [3483341, 5225010], [5225011, 6966680], [6966681, 8708350], [8708351, 10450020], [10450021, 12191690], [12191691, 13933360], [13933361, 15675030], [15675031, 17416700], [17416701, 19158370], [19158371, 20900040], [20900041, 22641710], [22641711, 24383380], [24383381, 26125050], [26125051, 27866720], [27866721, 29608390], [29608391, 31350060], [31350061, 33091730], [33091731, 34833401]] SRR7804174 file size 11782196 SRR7804174 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804174 SRR7804174_1.fastq SRR7804174_2.fastq Input file: SRR7804174_1.fastq Paired file: SRR7804174_2.fastq trimmed: SRR7804174-trimmed-pair1.fastq, SRR7804174-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:38:47 2024 >> started Tue Dec 10 03:39:32 2024 >> done (45.694s) 34833401 read pairs processed; of these: 75 ( 0.00%) short read pairs filtered out after trimming by size control 528 ( 0.00%) empty read pairs filtered out after trimming by size control 34832798 (100.00%) read pairs available; of these: 878307 ( 2.52%) trimmed read pairs available after processing 33954491 (97.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 13 0.00% 20 16 0.00% 21 16 0.00% 22 25 0.00% 23 20 0.00% 24 26 0.00% 25 33 0.00% 26 33 0.00% 27 32 0.00% 28 28 0.00% 29 36 0.00% 30 37 0.00% 31 44 0.00% 32 49 0.00% 33 44 0.00% 34 46 0.00% 35 63 0.00% 36 48 0.00% 37 40 0.00% 38 56 0.00% 39 56 0.00% 40 69 0.00% 41 70 0.00% 42 67 0.00% 43 69 0.00% 44 60 0.00% 45 64 0.00% 46 67 0.00% 47 74 0.00% 48 82 0.00% 49 72 0.00% 50 77 0.00% 51 53 0.00% 52 106 0.00% 53 79 0.00% 54 96 0.00% 55 87 0.00% 56 92 0.00% 57 85 0.00% 58 95 0.00% 59 85 0.00% 60 112 0.00% 61 91 0.00% 62 128 0.00% 63 97 0.00% 64 117 0.00% 65 120 0.00% 66 126 0.00% 67 126 0.00% 68 156 0.00% 69 160 0.00% 70 166 0.00% 71 164 0.00% 72 203 0.00% 73 227 0.00% 74 192 0.00% 75 196 0.00% 76 249 0.00% 77 229 0.00% 78 249 0.00% 79 319 0.00% 80 337 0.00% 81 369 0.00% 82 457 0.00% 83 485 0.00% 84 487 0.00% 85 603 0.00% 86 638 0.00% 87 723 0.00% 88 725 0.00% 89 785 0.00% 90 937 0.00% 91 1022 0.00% 92 1193 0.00% 93 1382 0.00% 94 1477 0.00% 95 1683 0.00% 96 1859 0.01% 97 1986 0.01% 98 2149 0.01% 99 2270 0.01% 100 2486 0.01% 101 2787 0.01% 102 3112 0.01% 103 3462 0.01% 104 3828 0.01% 105 4228 0.01% 106 4387 0.01% 107 4524 0.01% 108 5020 0.01% 109 5258 0.02% 110 5459 0.02% 111 6172 0.02% 112 6650 0.02% 113 7175 0.02% 114 7901 0.02% 115 8341 0.02% 116 8886 0.03% 117 8999 0.03% 118 9527 0.03% 119 10087 0.03% 120 10429 0.03% 121 11138 0.03% 122 12011 0.03% 123 12788 0.04% 124 14033 0.04% 125 14841 0.04% 126 15453 0.04% 127 16069 0.05% 128 16263 0.05% 129 17098 0.05% 130 17456 0.05% 131 18554 0.05% 132 19650 0.06% 133 20583 0.06% 134 22259 0.06% 135 23323 0.07% 136 24637 0.07% 137 25369 0.07% 138 25833 0.07% 139 26697 0.08% 140 27263 0.08% 141 28404 0.08% 142 29069 0.08% 143 30620 0.09% 144 31995 0.09% 145 34246 0.10% 146 35029 0.10% 147 36165 0.10% 148 37323 0.11% 149 38453 0.11% 150 39652 0.11% 151 33954491 97.48% 34832798 reads passed initial QC criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=30 prefix-density=0.87 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGCCTCAGGGTCGTCAGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=38 fanout-score=72.87 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=4.6 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAG criterion=sequence-density sequence-density=1.17 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=18 prefix-density=1.26 prefix-fanout=2.3 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=24.54 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=2.7 sequence=CGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCGGCCAAG SRR7804174 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:40:47 Started mapping on | Dec 10 03:40:47 Finished on | Dec 10 03:44:15 Mapping speed, Million of reads per hour | 602.88 Number of input reads | 34832798 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 29872386 Uniquely mapped reads % | 85.76% Average mapped length | 300.10 Number of splices: Total | 27305986 Number of splices: Annotated (sjdb) | 25825771 Number of splices: GT/AG | 26941037 Number of splices: GC/AG | 313658 Number of splices: AT/AC | 8780 Number of splices: Non-canonical | 42511 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.35 Insertion rate per base | 0.01% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1541694 % of reads mapped to multiple loci | 4.43% Number of reads mapped to too many loci | 260711 % of reads mapped to too many loci | 0.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.98% % of reads unmapped: other | 6.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3418718 3418718 3418718 N_multimapping 1541694 1541694 1541694 N_noFeature 2417667 28988878 2613162 N_ambiguous 851736 4572 165423 UnstrandedReadsAssigned:26602983 PositiveStrandReadsAssigned:878936 NegativeStrandReadsAssigned:27093801 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804174 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804174-trimmed-pair1.fastq SRR7804174-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,832,798 reads, 27,751,397 reads pseudoaligned [quant] estimated average fragment length: 324.735 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52973 SRR7804174.ke.tsv 35125 SRR7804174.se.tsv 88098 total ==> SRR7804174.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 613.251 0 0 PNS24247 1044 720.265 66.6352 3.6817 PNS24249 1928 1604.26 171.027 4.24253 PNS24246 1044 720.265 66.6352 3.6817 PNS24248 1044 720.265 66.6352 3.6817 PNS24244 1471 1147.26 128.068 4.44234 PNS24243 293 72.0842 0 0 KQK14069 1603 1279.26 12892.3 401.059 KQK14071 474 192.044 179.275 37.1496 ==> SRR7804174.se.tsv <== BRADI_1g14170v3 13656 BRADI_1g53295v3 165 BRADI_1g59795v3 852 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 598 BRADI_1g74790v3 363 BRADI_1g09890v3 6 BRADI_1g77505v3 530 BRADI_1g48960v3 0 SRR7804174 completed mapping pipeline successfully