Starting /dee2/code/volunteer_pipeline.sh SRR7804175 current disk space = 1525962448896 free memory = 1558337108 SRR7804175 SRAfilesize 8547aea9343c83f8a196f2c36b3ca96b SRR7804175.sra SRR7804175.sra file validated SRR7804175 is paired end SRR7804175 is conventional basespace SRR7804175 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804175_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.23075 37.0 37.0 37.0 37.0 37.0 2 36.185 37.0 37.0 37.0 37.0 37.0 3 36.369 37.0 37.0 37.0 37.0 37.0 4 36.4525 37.0 37.0 37.0 37.0 37.0 5 36.614 37.0 37.0 37.0 37.0 37.0 6 36.559 37.0 37.0 37.0 37.0 37.0 7 36.349 37.0 37.0 37.0 37.0 37.0 8 36.4765 37.0 37.0 37.0 37.0 37.0 9 36.4945 37.0 37.0 37.0 37.0 37.0 10-14 36.536300000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.520599999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.489 37.0 37.0 37.0 37.0 37.0 25-29 36.4791 37.0 37.0 37.0 37.0 37.0 30-34 36.44089999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.418600000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.3379 37.0 37.0 37.0 37.0 37.0 45-49 36.2923 37.0 37.0 37.0 37.0 37.0 50-54 36.2431 37.0 37.0 37.0 37.0 37.0 55-59 36.2368 37.0 37.0 37.0 37.0 37.0 60-64 36.2085 37.0 37.0 37.0 37.0 37.0 65-69 36.1772 37.0 37.0 37.0 37.0 37.0 70-74 36.097300000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.1156 37.0 37.0 37.0 37.0 37.0 80-84 36.06230000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.0071 37.0 37.0 37.0 37.0 37.0 90-94 35.9936 37.0 37.0 37.0 37.0 37.0 95-99 35.9014 37.0 37.0 37.0 37.0 37.0 100-104 35.8731 37.0 37.0 37.0 37.0 37.0 105-109 35.7813 37.0 37.0 37.0 37.0 37.0 110-114 35.835300000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.751 37.0 37.0 37.0 37.0 37.0 120-124 35.626799999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.6279 37.0 37.0 37.0 37.0 37.0 130-134 35.497699999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.4055 37.0 37.0 37.0 37.0 37.0 140-144 35.3354 37.0 37.0 37.0 32.2 37.0 145-149 35.1348 37.0 37.0 37.0 27.4 37.0 150-151 34.6555 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 0.0 25 2.0 26 11.0 27 10.0 28 19.0 29 23.0 30 31.0 31 55.0 32 70.0 33 109.0 34 161.0 35 476.0 36 2780.0 37 251.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.1543287327478 12.823086574654956 9.560853199498117 36.46173149309912 2 24.349999999999998 18.4 35.05 22.2 3 23.549999999999997 24.275 24.325 27.85 4 28.999999999999996 29.75 18.725 22.525000000000002 5 24.85 33.074999999999996 21.325 20.75 6 21.625 32.85 23.775 21.75 7 18.15 19.45 40.6 21.8 8 20.925 19.85 26.924999999999997 32.300000000000004 9 21.4 18.85 30.125 29.625 10-14 24.795 25.169999999999998 23.76 26.275 15-19 24.175 24.21 24.86 26.755000000000003 20-24 24.310000000000002 24.64 24.185000000000002 26.865 25-29 24.43 24.89 24.66 26.02 30-34 24.25 24.515 24.310000000000002 26.924999999999997 35-39 23.97 24.035 24.685000000000002 27.310000000000002 40-44 24.81 24.834999999999997 24.065 26.290000000000003 45-49 23.835 24.59 24.47 27.105 50-54 24.59 24.545 23.69 27.175 55-59 24.445 24.145 24.14 27.27 60-64 24.72 23.93 24.415 26.935 65-69 24.560000000000002 24.12 24.3 27.02 70-74 24.975 24.349999999999998 23.315 27.36 75-79 24.59 23.7 24.33 27.38 80-84 24.85 23.68 23.895 27.575 85-89 24.845 23.72 24.495 26.939999999999998 90-94 25.765 23.705000000000002 23.835 26.695 95-99 25.369999999999997 23.599999999999998 24.035 26.995 100-104 25.39 23.905 23.544999999999998 27.16 105-109 24.975 23.5 24.14 27.384999999999998 110-114 25.814999999999998 23.06 24.0 27.125 115-119 26.0 23.45 23.365 27.185 120-124 25.505 23.715 23.59 27.189999999999998 125-129 26.22 23.49 23.805 26.484999999999996 130-134 26.13 23.215 23.36 27.295 135-139 25.965 23.84 23.595 26.6 140-144 26.11 23.435 23.47 26.985 145-149 25.85 23.98 23.04 27.13 150-151 25.8 23.3125 23.1625 27.725 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 1.0 26 2.0 27 5.5 28 5.0 29 3.0 30 4.5 31 10.0 32 11.5 33 13.0 34 24.5 35 41.5 36 51.0 37 59.5 38 76.0 39 96.5 40 116.5 41 120.0 42 125.5 43 135.0 44 145.0 45 152.5 46 157.0 47 157.0 48 142.5 49 138.0 50 147.0 51 140.0 52 125.5 53 129.5 54 133.5 55 129.5 56 117.0 57 103.0 58 92.0 59 92.0 60 98.5 61 93.0 62 82.5 63 70.0 64 66.5 65 73.5 66 75.0 67 70.0 68 68.5 69 58.5 70 42.5 71 37.0 72 35.0 73 36.0 74 30.5 75 18.5 76 12.0 77 8.5 78 6.0 79 5.5 80 4.0 81 2.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.875 #Duplication Level Percentage of deduplicated Percentage of total 1 94.30093209054594 88.52499999999999 2 5.033288948069241 9.45 3 0.5326231691078562 1.5 4 0.10652463382157124 0.4 5 0.02663115845539281 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.5125 0.0 0.0 0.0 0.0 120-121 0.5875 0.0 0.0 0.0 0.0 122-123 0.7 0.0 0.0 0.0 0.0 124-125 0.8875 0.0 0.0 0.0 0.0 126-127 0.9624999999999999 0.0 0.0 0.0 0.0 128-129 0.975 0.0 0.0 0.0 0.0 130-131 1.0875 0.0 0.0 0.0 0.0 132-133 1.25 0.0 0.0 0.0 0.0 134-135 1.3125 0.0 0.0 0.0 0.0 136-137 1.4875 0.0 0.0 0.0 0.0 138-139 1.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGCAG 10 0.006830828 145.0 7 CCACCGA 10 0.006830828 145.0 145 CGATGCA 10 0.006830828 145.0 6 >>END_MODULE SRR7804175 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804175_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.226 37.0 37.0 37.0 37.0 37.0 2 35.8195 37.0 37.0 37.0 37.0 37.0 3 36.073 37.0 37.0 37.0 37.0 37.0 4 36.1275 37.0 37.0 37.0 37.0 37.0 5 36.128 37.0 37.0 37.0 37.0 37.0 6 35.9265 37.0 37.0 37.0 37.0 37.0 7 35.973 37.0 37.0 37.0 37.0 37.0 8 36.1205 37.0 37.0 37.0 37.0 37.0 9 36.1065 37.0 37.0 37.0 37.0 37.0 10-14 36.0677 37.0 37.0 37.0 37.0 37.0 15-19 35.9798 37.0 37.0 37.0 37.0 37.0 20-24 35.9226 37.0 37.0 37.0 37.0 37.0 25-29 35.890100000000004 37.0 37.0 37.0 37.0 37.0 30-34 35.8266 37.0 37.0 37.0 37.0 37.0 35-39 35.769600000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.714 37.0 37.0 37.0 37.0 37.0 45-49 35.6134 37.0 37.0 37.0 37.0 37.0 50-54 35.687 37.0 37.0 37.0 37.0 37.0 55-59 35.6474 37.0 37.0 37.0 37.0 37.0 60-64 35.5224 37.0 37.0 37.0 37.0 37.0 65-69 35.50449999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.4447 37.0 37.0 37.0 37.0 37.0 75-79 35.3938 37.0 37.0 37.0 37.0 37.0 80-84 35.3276 37.0 37.0 37.0 34.6 37.0 85-89 35.2347 37.0 37.0 37.0 29.8 37.0 90-94 35.193799999999996 37.0 37.0 37.0 27.4 37.0 95-99 35.0209 37.0 37.0 37.0 25.0 37.0 100-104 35.0458 37.0 37.0 37.0 25.0 37.0 105-109 35.0099 37.0 37.0 37.0 25.0 37.0 110-114 34.79260000000001 37.0 37.0 37.0 25.0 37.0 115-119 34.75580000000001 37.0 37.0 37.0 25.0 37.0 120-124 34.651500000000006 37.0 37.0 37.0 25.0 37.0 125-129 34.594 37.0 37.0 37.0 25.0 37.0 130-134 34.503699999999995 37.0 37.0 37.0 25.0 37.0 135-139 34.267500000000005 37.0 37.0 37.0 25.0 37.0 140-144 34.1725 37.0 37.0 37.0 25.0 37.0 145-149 34.0544 37.0 37.0 37.0 25.0 37.0 150-151 33.49225 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 7.0 15 5.0 16 1.0 17 2.0 18 1.0 19 1.0 20 1.0 21 3.0 22 13.0 23 11.0 24 5.0 25 10.0 26 13.0 27 19.0 28 29.0 29 28.0 30 59.0 31 58.0 32 88.0 33 193.0 34 347.0 35 971.0 36 2073.0 37 56.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.825 12.6 10.725 36.85 2 29.325000000000003 19.625 28.775000000000002 22.275 3 25.974999999999998 21.475 26.674999999999997 25.874999999999996 4 28.7 30.325000000000003 16.375 24.6 5 28.175 33.5 17.575 20.75 6 22.95 33.475 18.2 25.374999999999996 7 20.974999999999998 14.75 35.675000000000004 28.599999999999998 8 23.325000000000003 18.8 23.075000000000003 34.8 9 26.625 20.125 23.225 30.025000000000002 10-14 26.255 24.215 22.105 27.425 15-19 27.200000000000003 23.715 22.49 26.595000000000002 20-24 27.375 23.635 21.97 27.02 25-29 27.065 23.445 22.89 26.6 30-34 26.790000000000003 24.36 22.625 26.224999999999998 35-39 27.439999999999998 23.630000000000003 22.215 26.715 40-44 27.29 23.31 22.37 27.029999999999998 45-49 27.839999999999996 23.45 21.94 26.77 50-54 27.21 23.580000000000002 22.855 26.355 55-59 27.334999999999997 23.544999999999998 22.165000000000003 26.955000000000002 60-64 27.275 23.355 22.155 27.215 65-69 27.24 23.395 22.925 26.44 70-74 27.305 23.419999999999998 22.605 26.669999999999998 75-79 27.625 23.79 22.28 26.305 80-84 27.235 23.47 22.384999999999998 26.91 85-89 28.139999999999997 23.015 22.134999999999998 26.71 90-94 27.994999999999997 23.73 22.045 26.229999999999997 95-99 27.61 23.544999999999998 22.935 25.91 100-104 28.255000000000003 23.31 22.275 26.16 105-109 27.57 23.335 22.35 26.745 110-114 27.62 23.380000000000003 22.395 26.605 115-119 28.33 23.580000000000002 21.66 26.43 120-124 27.67 23.995 22.14 26.195 125-129 27.644999999999996 24.145 21.825 26.384999999999998 130-134 27.639999999999997 23.925 21.995 26.44 135-139 27.68 23.474999999999998 23.145 25.7 140-144 28.015 23.68 22.505 25.8 145-149 27.605 23.96 22.79 25.645 150-151 27.525 23.8875 22.787499999999998 25.8 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.0 21 1.0 22 1.0 23 1.0 24 1.5 25 1.5 26 2.0 27 1.0 28 0.5 29 3.0 30 6.0 31 7.5 32 6.5 33 8.0 34 12.0 35 20.5 36 29.5 37 33.5 38 44.5 39 58.5 40 79.0 41 98.0 42 101.5 43 114.5 44 134.0 45 142.0 46 127.5 47 114.5 48 124.5 49 137.0 50 146.5 51 151.0 52 134.0 53 118.5 54 118.5 55 119.5 56 110.0 57 105.0 58 124.0 59 125.5 60 107.0 61 110.5 62 111.0 63 92.0 64 86.5 65 85.5 66 85.0 67 85.5 68 86.0 69 90.5 70 72.5 71 58.0 72 60.5 73 44.0 74 31.0 75 33.0 76 27.0 77 18.5 78 14.0 79 9.5 80 5.5 81 2.5 82 1.5 83 1.0 84 1.0 85 0.0 86 0.5 87 0.5 88 1.0 89 1.0 90 1.5 91 1.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 1.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.65 #Duplication Level Percentage of deduplicated Percentage of total 1 94.23384943940204 88.25 2 5.045381740523225 9.45 3 0.5072076882007475 1.425 4 0.16017084890549918 0.6 5 0.026695141484249865 0.125 6 0.026695141484249865 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGGGCTTGACATGCCGCGAATCCTCTTGAAAGAGAGGGGTGCCCTCGGG 6 0.15 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.5125 0.0 0.0 0.0 0.0 120-121 0.5875 0.0 0.0 0.0 0.0 122-123 0.7 0.0 0.0 0.0 0.0 124-125 0.8875 0.0 0.0 0.0 0.0 126-127 0.9624999999999999 0.0 0.0 0.0 0.0 128-129 0.975 0.0 0.0 0.0 0.0 130-131 1.0875 0.0 0.0 0.0 0.0 132-133 1.25 0.0 0.0 0.0 0.0 134-135 1.3250000000000002 0.0 0.0 0.0 0.0 136-137 1.5125 0.0 0.0 0.0 0.0 138-139 1.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1743015 spots for SRR7804175.sra Written 1743015 spots for SRR7804175.sra Read 1743015 spots for SRR7804175.sra Written 1743015 spots for SRR7804175.sra Read 1743015 spots for SRR7804175.sra Written 1743015 spots for SRR7804175.sra Read 1743015 spots for SRR7804175.sra Written 1743015 spots for SRR7804175.sra Read 1743015 spots for SRR7804175.sra Written 1743015 spots for SRR7804175.sra Read 1743015 spots for SRR7804175.sra Written 1743015 spots for SRR7804175.sra Read 1743015 spots for SRR7804175.sra Written 1743015 spots for SRR7804175.sra Read 1743015 spots for SRR7804175.sra Written 1743015 spots for SRR7804175.sra Read 1743015 spots for SRR7804175.sra Written 1743015 spots for SRR7804175.sra Read 1743015 spots for SRR7804175.sra Written 1743015 spots for SRR7804175.sra Read 1743015 spots for SRR7804175.sra Written 1743015 spots for SRR7804175.sra Read 1743015 spots for SRR7804175.sra Written 1743015 spots for SRR7804175.sra Read 1743015 spots for SRR7804175.sra Written 1743015 spots for SRR7804175.sra Read 1743015 spots for SRR7804175.sra Written 1743015 spots for SRR7804175.sra Read 1743015 spots for SRR7804175.sra Written 1743015 spots for SRR7804175.sra Read 1743015 spots for SRR7804175.sra Written 1743015 spots for SRR7804175.sra Read 1743030 spots for SRR7804175.sra Written 1743030 spots for SRR7804175.sra Read 1743015 spots for SRR7804175.sra Written 1743015 spots for SRR7804175.sra Read 1743015 spots for SRR7804175.sra Written 1743015 spots for SRR7804175.sra Read 1743015 spots for SRR7804175.sra Written 1743015 spots for SRR7804175.sra SRR ids: ['SRR7804175.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2wnrqtgv SRR7804175.sra spots: 34860315 blocks: [[1, 1743015], [1743016, 3486030], [3486031, 5229045], [5229046, 6972060], [6972061, 8715075], [8715076, 10458090], [10458091, 12201105], [12201106, 13944120], [13944121, 15687135], [15687136, 17430150], [17430151, 19173165], [19173166, 20916180], [20916181, 22659195], [22659196, 24402210], [24402211, 26145225], [26145226, 27888240], [27888241, 29631255], [29631256, 31374270], [31374271, 33117285], [33117286, 34860315]] SRR7804175 file size 11791316 SRR7804175 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804175 SRR7804175_1.fastq SRR7804175_2.fastq Input file: SRR7804175_1.fastq Paired file: SRR7804175_2.fastq trimmed: SRR7804175-trimmed-pair1.fastq, SRR7804175-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:21:31 2024 >> started Tue Dec 10 03:24:02 2024 >> done (150.419s) 34860315 read pairs processed; of these: 91 ( 0.00%) short read pairs filtered out after trimming by size control 562 ( 0.00%) empty read pairs filtered out after trimming by size control 34859662 (100.00%) read pairs available; of these: 996326 ( 2.86%) trimmed read pairs available after processing 33863336 (97.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 13 0.00% 20 19 0.00% 21 23 0.00% 22 24 0.00% 23 19 0.00% 24 35 0.00% 25 41 0.00% 26 29 0.00% 27 34 0.00% 28 46 0.00% 29 43 0.00% 30 56 0.00% 31 56 0.00% 32 62 0.00% 33 49 0.00% 34 56 0.00% 35 67 0.00% 36 64 0.00% 37 63 0.00% 38 57 0.00% 39 72 0.00% 40 63 0.00% 41 74 0.00% 42 90 0.00% 43 83 0.00% 44 71 0.00% 45 80 0.00% 46 104 0.00% 47 81 0.00% 48 85 0.00% 49 92 0.00% 50 118 0.00% 51 104 0.00% 52 91 0.00% 53 102 0.00% 54 130 0.00% 55 102 0.00% 56 86 0.00% 57 110 0.00% 58 128 0.00% 59 109 0.00% 60 162 0.00% 61 162 0.00% 62 164 0.00% 63 138 0.00% 64 149 0.00% 65 173 0.00% 66 167 0.00% 67 186 0.00% 68 195 0.00% 69 206 0.00% 70 225 0.00% 71 229 0.00% 72 289 0.00% 73 319 0.00% 74 295 0.00% 75 318 0.00% 76 342 0.00% 77 407 0.00% 78 419 0.00% 79 501 0.00% 80 545 0.00% 81 598 0.00% 82 763 0.00% 83 842 0.00% 84 865 0.00% 85 997 0.00% 86 1064 0.00% 87 1104 0.00% 88 1261 0.00% 89 1379 0.00% 90 1472 0.00% 91 1715 0.00% 92 1990 0.01% 93 2231 0.01% 94 2409 0.01% 95 2692 0.01% 96 2757 0.01% 97 3029 0.01% 98 3108 0.01% 99 3343 0.01% 100 3586 0.01% 101 4022 0.01% 102 4601 0.01% 103 5017 0.01% 104 5447 0.02% 105 5754 0.02% 106 6229 0.02% 107 6287 0.02% 108 6568 0.02% 109 7142 0.02% 110 7306 0.02% 111 7946 0.02% 112 8635 0.02% 113 9178 0.03% 114 10004 0.03% 115 10363 0.03% 116 10900 0.03% 117 11175 0.03% 118 11791 0.03% 119 12027 0.03% 120 12733 0.04% 121 13310 0.04% 122 14092 0.04% 123 15149 0.04% 124 16394 0.05% 125 17381 0.05% 126 17827 0.05% 127 18390 0.05% 128 18337 0.05% 129 19393 0.06% 130 19642 0.06% 131 20732 0.06% 132 22011 0.06% 133 22824 0.07% 134 24232 0.07% 135 25676 0.07% 136 26810 0.08% 137 26995 0.08% 138 28019 0.08% 139 28922 0.08% 140 29257 0.08% 141 30428 0.09% 142 31387 0.09% 143 32697 0.09% 144 34459 0.10% 145 36289 0.10% 146 37132 0.11% 147 38820 0.11% 148 39715 0.11% 149 39646 0.11% 150 41595 0.12% 151 33863336 97.14% 34859662 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=33 prefix-density=0.79 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGCCTCAGGGTCGTCAGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=33 fanout-score=76.48 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=4.0 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAG criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=16 prefix-density=0.82 prefix-fanout=2.5 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCAGGCAGCCCGTGGTACGGCTCCGACCGCGTGTTGTACCTCGGCCCGCTCTCCGGCGAACCCCCGAGCTACCTGACCGGTGAGTTCCCCGGCGATTACGGGTGGGACACCGCCGGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=32.51 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.4 sequence=AGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAGTGC SRR7804175 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:25:02 Started mapping on | Dec 10 03:25:02 Finished on | Dec 10 03:33:30 Mapping speed, Million of reads per hour | 247.04 Number of input reads | 34859662 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 30087444 Uniquely mapped reads % | 86.31% Average mapped length | 299.82 Number of splices: Total | 27600575 Number of splices: Annotated (sjdb) | 26082023 Number of splices: GT/AG | 27233255 Number of splices: GC/AG | 314926 Number of splices: AT/AC | 9753 Number of splices: Non-canonical | 42641 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.38 Insertion rate per base | 0.01% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1278682 % of reads mapped to multiple loci | 3.67% Number of reads mapped to too many loci | 161358 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.53% % of reads unmapped: other | 4.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3493536 3493536 3493536 N_multimapping 1278682 1278682 1278682 N_noFeature 2085827 29159258 2291744 N_ambiguous 874075 4770 152850 UnstrandedReadsAssigned:27127542 PositiveStrandReadsAssigned:923416 NegativeStrandReadsAssigned:27642850 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804175 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804175-trimmed-pair1.fastq SRR7804175-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,859,662 reads, 28,184,571 reads pseudoaligned [quant] estimated average fragment length: 318.401 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,124 rounds 52973 SRR7804175.ke.tsv 35125 SRR7804175.se.tsv 88098 total ==> SRR7804175.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 619.396 0 0 PNS24247 1044 726.599 72.0518 3.95588 PNS24249 1928 1610.6 129.153 3.19897 PNS24246 1044 726.599 72.0518 3.95588 PNS24248 1044 726.599 72.0518 3.95588 PNS24244 1471 1153.6 207.692 7.1822 PNS24243 293 72.9049 0 0 KQK14069 1603 1285.6 16419.3 509.496 KQK14071 474 194.523 72.4426 14.8565 ==> SRR7804175.se.tsv <== BRADI_1g14170v3 16736 BRADI_1g53295v3 200 BRADI_1g59795v3 874 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 171 BRADI_1g74790v3 366 BRADI_1g09890v3 0 BRADI_1g77505v3 547 BRADI_1g48960v3 0 SRR7804175 completed mapping pipeline successfully